Skip to main content
STAR Protocols logoLink to STAR Protocols
. 2025 May 30;6(2):103866. doi: 10.1016/j.xpro.2025.103866

Protocol to analyze tRNA and rRNA processing using biotin-labeled probes

Sseu-Pei Hwang 1,2,3,∗, Katherine Barondeau 1,3,∗∗, Catherine Denicourt 1,2,3,4,∗∗∗
PMCID: PMC12166403  PMID: 40448999

Summary

Mature tRNAs and rRNAs are derived from larger precursor transcripts through intricate endo- and exonuclease processing steps. Here, we present a protocol to analyze rRNA and tRNA processing using total RNA extracted from human cells. We describe steps for separating RNA by denaturing electrophoresis, followed by northern blotting. We detail procedures for detecting pre-rRNA intermediates or specific tRNA species using biotin-labeled probes imaged via fluorescence or chemiluminescence. This non-radioactive, high-sensitivity assay enables the investigation of rRNA and tRNA expression dynamics.

For complete details on the use and execution of this protocol, please refer to Hwang et al.1

Subject areas: Cell Biology, Genetics, Molecular Biology, Molecular/Chemical Probes

Graphical abstract

graphic file with name fx1.jpg

Highlights

  • •

    Steps for preparing total RNA samples for tRNA and rRNA processing analysis

  • •

    Procedures for resolving pre-rRNA intermediates on formaldehyde-agarose gel

  • •

    Guidelines for separating tRNA on urea-PAGE gel

  • •

    Steps for detecting different RNAs using biotin-labeled probes in northern blotting


Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.


Mature tRNAs and rRNAs are derived from larger precursor transcripts through intricate endo- and exonuclease processing steps. Here, we present a protocol to analyze rRNA and tRNA processing using total RNA extracted from human cells. We describe steps for separating RNA by denaturing electrophoresis, followed by northern blotting. We detail procedures for detecting pre-rRNA intermediates or specific tRNA species using biotin-labeled probes imaged via fluorescence or chemiluminescence. This non-radioactive, high-sensitivity assay enables the investigation of rRNA and tRNA expression dynamics.

Before you begin

This protocol describes the procedures for analyzing rRNA and tRNA processing intermediates by electrophoresis and Northern blotting using biotin-labeled probes. For rRNA processing analysis, total RNA should be dissolved in formamide rather than RNase-free water before being resolved on a formaldehyde-agarose gel. While RNA initially dissolved in RNase-free water can be mixed with formamide, this increases the sample volume for gel loading, especially when RNA concentrations are low. Therefore, we recommend dissolving the RNA pellets directly in formamide to ensure optimal sample handling and resolution for rRNA processing analysis using formaldehyde-agarose gel electrophoresis.

The design of biotin-labeled probes for detecting different regions of rRNA and iso-decoders of tRNA is critical for achieving high sensitivity and specificity. When selecting a probe sequence, factors such as sequence length, GC content, and sequence specificity should be carefully considered. For example, targeting the anticodon region of tRNA can effectively detect most variants of a specific iso-decoder while minimizing non-specific binding to other tRNAs. Notably, modifications on the tRNA can influence probe hybridization, so we recommend reviewing modification information from Modomics2 as a reference when designing the probe (see troubleshooting for more details). Here, we provide the sequences of rRNA, and tRNA-specific 5′ end biotin-labeled probes that have been tested and proven to be effective, as listed in the key resources table.1

This protocol can be applied to different cell types or tissue samples from various organisms. Total RNA should be extracted using an appropriate general RNA extraction protocol suited to the research subject. Here, we demonstrate total RNA preparation from human colon cancer HCT116, adherent cell cultures, using Invitrogen TRIzol reagent. To maintain optimal cell confluency for RNA extraction, approximately 5 × 105 cells are seeded in a 3.5 cm-dish one day prior to RNA extraction, ensuring that cell confluency does not exceed 80% on the day of RNA extraction.

Total RNA extraction

Inline graphicTiming: 1 h

  • 1.

    The day before RNA extraction, seed 5 × 105 HCT116 cells in a 3.5 cm-dish in DMEM high glucose media supplemented with 5% Fetal bovine serum, 100 U/mL penicillin, and 100 μg/mL streptomycin.

Inline graphicCRITICAL: Avoid seeding too many cells to prevent over-confluency, which can alter rRNA and tRNA synthesis and also hinder total RNA solubilization and electrophoresis resolution (see troubleshooting for further guidance).

Note: The culture dish format in this step is not restricted to the 3.5 cm-dish. The number of cells in each dish, as well as the number and format of the dishes, should be optimized specifically to the growth rate and features of the cell line. We recommend seeding HCT116 cells at a density of 5 × 105 per 3.5 cm-dish the day before RNA extraction, which will provide approximately 40 μg of total RNA for the subsequent tRNA purification steps.

  • 2.

    On the day of RNA extraction, examine the cell culture under a microscope to ensure that the confluency does not exceed 80%.

  • 3.

    Aspirate the media from the 3.5 cm-dishes.

  • 4.

    Add 1 mL of Invitrogen TRIzol directly to the 3.5 cm-dish. Gently swirl the dish to ensure complete coverage and cell lysis.

Inline graphicCRITICAL: From this point, use RNase-free equipment, plastics, and practices to prevent RNA degradation. We recommend using filter tips to minimize the chance of RNase contamination during pipetting.

  • 5.

    Resuspend the cells in TRIzol by pipetting up and down several times until the solution is homogeneous. Transfer to a microcentrifuge tube.

Inline graphicPause point: The aliquots can be stored at −80°C indefinitely or processed directly to the next step.

  • 6.

    Add 0.2 mL of chloroform per 1 mL of TRIzol Reagent. Cap the sample tubes securely. Shake the tubes vigorously by hand for 15 sec and incubate at 22 to 25°C for 2 to 3 min.

Note: If starting with frozen TRIzol samples, thaw them completely at 22 to 25°C and mix several times by inversion for a homogenous solution before adding the chloroform.

  • 7.

    Centrifuge the samples at no more than 12,000 × g for 15 min at 4°C.

Note: The mixture separates into a lower red phenol-chloroform phase, a white interphase, and a colorless upper aqueous phase. Transfer the aqueous phase to a fresh tube. The RNA remains exclusively in the aqueous phase.

Inline graphicCRITICAL: Avoid the disruption of phases and avoid taking any interphase or phenolic phase. We recommend transferring only 0.5 mL of the aqueous phase to avoid disrupting the interphase and contaminating the sample.

  • 8.
    Precipitate the RNA from the aqueous phase by mixing with isopropyl alcohol. Use 0.5 mL of isopropyl alcohol per 1 mL of TRIzol Reagent used for the initial homogenization.
    • a.
      Mix well. Incubate the samples at 22 to 25°C for 10 min.
    • b.
      Centrifuge at no more than 12,000 × g for 10 min at 2 to 8°C.
      Note: The RNA precipitate, invisible before centrifugation, forms a gel-like pellet on the bottom and the side of the tube.
    • c.
      Remove the supernatant by inverting the tube.
    • d.
      Wash the RNA pellet once with 75% freshly prepared ethanol.
      Note: Add at least 1 mL of 75% ethanol per 1 mL of TRIzol Reagent used for the initial homogenization.
    • e.
      Mix the sample by vortexing.
    • f.
      Centrifuge at no more than 7,500 × g for 5 min at 4°C.
  • 9.

    Quickly remove the supernatant by inverting the tube and tapping it gently on a paper towel to remove most of the ethanol. Let the ethanol evaporate by leaving the tube open for about 5–10 min at 22 to 25°C.

Inline graphicCRITICAL: Make sure there are no visible droplets of ethanol inside the tube, but do not let the pellet dry out completely, as this will hinder the resuspension of the RNA (see troubleshooting for further guidance).

Note: As the RNA pellet dries, it will turn transparent starting from the edges. Do not let the pellet turn transparent completely.

  • 10.

    Resuspend the RNA pellet in about 50 μL of deionized formamide (for formaldehyde-agarose gel analysis of rRNA processing) or RNase-free water (for urea-PAGE analysis of tRNA). Store the RNA at −80°C.

  • 11.

    Evaluate the RNA concentration using a Nanodrop or Qubit assay.

Inline graphicCRITICAL: Make sure the RNA is completely dissolved. Incomplete dissolution can lead to inaccurate RNA concentration measurements (see troubleshooting for further guidance).

Inline graphicPause point: The RNA in formamide or RNase-free water can be stored at −80°C long-term if stored properly and not subject to freeze-thaw cycles.

Key resources table

REAGENT or RESOURCE SOURCE IDENTIFIER
Chemicals, peptides, and recombinant proteins

High-glucose DMEM HyClone SH30022.01
Penicillin-streptomycin 100× solution HyClone SV30010
TRIzol reagent Invitrogen 15596026
Chloroform Thermo Fisher Scientific BP1145-1
Isopropanol Thermo Fisher Scientific BP2632-4
Formamide Sigma 4610-100ML
Urea Millipore 9510-500GM
40% acrylamide/bis solution, 19:1 Bio-Rad 1610144
Tetramethylethylenediamine (TEMED) Thermo Fisher Scientific 17919
Low range ssRNA ladder NEB N0364S
microRNA marker NEB N2120S
SYBR Gold nucleic acid gel stain Invitrogen S11494
Amersham Hybond N+ nylon membrane GE Healthcare RPN303B
Extra thick blot filter paper, precut, 7.5 × 10 cm Bio-Rad 1703965
Whatman 3MM chromatography paper Cytiva 3030-347
Agarose Thermo Fisher Scientific BP160-500
Tricine Sigma T0377-250G
Triethanolamine Sigma 90279-500ML
Formaldehyde (37%) Thermo Fisher Scientific BP531-500
Casein VWR Life Science E666-500G
Streptavidin-AP Invitrogen 434322
IRDye 800CW streptavidin LI-COR Biotech 926-32230
Immun-Star AP substrate Bio-Rad 1705018

Experimental models: Cell lines

HCT116 ATCC RRID:CVCL_0291
Biotin-rRNA-5′ETS probe: 5′-Biotin-CGGAGG
CCCAACCTCTCCGACGACAGGTCGCCAG
AGGACAGCGTGTCAGC-3′
Hwang et al.1 N/A
Biotin-rRNA-ITS1 probe: 5′-Biotin-CCTCGCC
CTCCGGGCTCCGTTAATGATC-3′
Hwang et al.1 N/A
Biotin-rRNA-ITS2 probe: 5′-Biotin-GCGGCGG
CAAGAGGAGGGCGGACGCCGCCGGGT
CTGCGCTTAGGGGGA-3′
Hwang et al.1 N/A
Biotin-rRNA-3′ETS probe: 5′-Biotin-GAGGAG
GCGGGAACCGAAGAAGCGG-3′
Hwang et al.1 N/A
Biotin-tRNA-Tyr-GTA-28-57 probe: 5′-Biotin-CGAACCAGCGACCTAAG
GATCTACAGTCCT-3′
Hwang et al.1 N/A
Biotin-tRNA-Tyr-GTA-12-35 probe: 5′-Biotin-ACAGTCCTCCGCTCT
ACCAGCTGA-3′
Huh et al.3 N/A
Biotin-U6 probe: 5′-Biotin-GAACGCTTCA
CGAATTTGCGTGTC-3′
Hwang et al.1 N/A

Software and algorithms

ImageJ Schneider et al.4 https://imagej.net/software/fiji/

Other

Mini-PROTEAN Tetra Cell for 1.0 mm gels Bio-Rad 1658001
HC power supply Bio-Rad 1645052
Digital dry baths/block heaters Thermo Fisher Scientific 88870001
Trans-Blot SD semi-dry transfer cell system Bio-Rad 1703940
Blue light tray Lonza 57025
Azure Biosystems c280 imager Azure Biosystems AC2801
UVP HL-2000 HybriLinker hybridization oven/UV crosslinker UVP 95-0031-01
Owl EasyCast B3 gel system with built-in recirculation Thermo Fisher Scientific 11992955
Hybridization tube, 35 × 150 mm with screw cap SciGene 1040-02-0
Azure Biosystems Sapphire biomolecular imager Azure Biosystems 76317-608

Materials and equipment

All reagents used in this protocol should be molecular biology grade. All buffers and solutions should be prepared with RNase-free equipment and solutions.

  • •

    10% APS. Dissolve 1 g of ammonium persulfate in 10 mL of RNase-free water. Aliquot the solution into 500 μL portions in RNase-free tubes and store at −20°C indefinitely.

  • •

    2× formaldehyde loading solution. Combine 14 volumes of 2.1× TT RNA dye with 1 volume of 37% formaldehyde. Mix just before using as it is not stable upon storage.

  • •

    1× TT buffer. Dilute from 50× TT buffer before use.

  • •

    10× SSC. Dilute from 20× SSC before use.

  • •

    Methylene blue staining solution. Prepare 0.03% methylene blue in 0.3 M sodium acetate (pH 5–5.5). Filter and keep at 22 to 25°C indefinitely if stored properly without contamination, crystallization, or precipitation.

  • •

    10% SDS. Dissolve 100 g of sodium dodecyl sulfate in 1 L RNase-free water, then filter the solution. This solution can be stored at 22 to 25°C indefinitely if stored properly without contamination, crystallization, or precipitation.

  • •

    Streptavidin-AP solution. Dilute Streptavidin-AP (1.5 mg/mL) in blocking buffer to achieve a final concentration of 0.5 μg/mL before use. Prepare freshly no more than 5 min before use to prevent enzyme denaturation. The volume needed depends on the size of the membrane.

  • •

    Streptavidin-IR800 solution. Dilute Streptavidin-IR800 (1 mg/mL) in blocking buffer to achieve a final concentration of 1.0 μg/mL before use. Prepare freshly before use. The volume needed depends on the size of the membrane.

10× TBE buffer

Reagent Final concentration Amount
Tris Base 89 mM 108 g
Boric Acid 89 mM 55 g
EDTA pH 8.0 (0.5 M) 20 mM 40 mL
RNase-free water N/A Fill to 1 L
Total N/A 1 L

The buffer can be stored at 22 to 25°C indefinitely if stored properly without contamination, crystallization, or precipitation.

Note: Prepare 10× TBE buffer using RNase-free equipment. Dissolve Tris base and boric acid in approximately 800 mL of RNase-free water. Add EDTA to the solution and bring the total volume to 1 L with RNase-free water. The pH value of the 10× TBE buffer should be around 8.3. Once all of the components are fully dissolved, filter the solution through a 0.22 μm filter and store it in an RNase-free bottle.

2× urea-PAGE loading dye

Reagent Final concentration Amount
Formamide 95% (v/v) 9.5 mL
Bromophenol Blue 0.02% (w/v) 2 mg
EDTA pH 8.0 (0.5 M) 5 mM 100 μL
RNase-free water N/A Fill to 10 mL
Total N/A 10 mL

Aliquot and store at −20°C indefinitely.

Note: Ensure that the dye is completely thawed and vigorously vortexed before use. Any white precipitate needs to be dissolved before being used.

50× TT (tricine-triethanolamine) buffer

Reagent Final concentration Amount
Tricine 1.5 M 134.6 g
Triethanolamine 1.5 M 100 mL
RNase-free water N/A Fill to 500 mL
Total N/A 500 mL

Filter to sterilize and store at 22 to 25°C for up to a year.

Note: Triethanolamine should be colorless or pale yellow upon purchase from the manufacturer, and buffers prepared with freshly purchased triethanolamine should also retain this coloration. The final pH should be 7.8–8.0 and should not require adjustment if prepared correctly. If triethanolamine appears yellow or brown, do not use as it may indicate decomposition.

2.1× TT RNA dye

Reagent Final concentration Amount
50× TT buffer 2.1× 420 μL
EDTA pH 8.0 (0.5 M) 1 mM 20 μL
3% Bromophenol Blue 0.03% 100 μL
RNase-free water N/A 9.46 mL
Total N/A 10 mL

Filter, aliquot, and store at −20°C indefinitely.

20× SSC

Reagent Final concentration Amount
NaCl 3 M 175.3 g
Sodium citrate 0.3 M 88.2 g
HCl (14 N) N/A As needed
RNase-free water N/A Fill to 1 L
Total N/A 1 L

This solution can be stored at 22 to 25°C indefinitely if stored properly without contamination, crystallization, or precipitation.

Note: Prepare 20× SSC buffer using RNase-free equipment. Dissolve NaCl and sodium citrate in approximately 800 mL of RNase-free water. Adjust the pH to 7.0 using a few drops of a 14 N solution of HCl. Once all the components are fully dissolved, bring the total volume to 1 L with RNase-free water, then sterilize by autoclaving.

50× Denhardt’s solution

Reagent Final concentration Amount
Ficoll 400 1% (w/v) 3 g
Polyvinylpyrrolidone (PVP) 1% (w/v) 3 g
Bovine serum albumin (BSA) 1% (w/v) 3 g
RNase-free water N/A Fill to 300 mL
Total N/A 300 mL

This solution can be stored at −20°C indefinitely if stored properly without contamination, crystallization, or precipitation.

Note: Prepare Denhardt’s Solution using RNase-free equipment. Dissolve Ficoll, PVP, and BSA in approximately 250 mL of RNase-free water. Once all of the components are fully dissolved, bring the total volume to 300 mL with RNase-free water. Filter the solution, then aliquot into 50 mL portions and store at −20°C. Denhardt’s solution should not be freeze-thawed more than five times.

Hybridization buffer

Reagent Final concentration Amount
RNase-free water N/A 27 mL
SSC (20×) 5× 11.25 mL
Denhardt’s Solution (50×) 5× 4.5 mL
SDS (10% w/v) 0.5% (w/v) 2.25 mL
Total N/A 45 mL

This solution should be made fresh and kept warm at 37°C until needed.

Note: Preheat the water to 37°C before mixing together reagents. Add the reagents in the order listed in the table, mixing after adding each reagent.

Wash solution I

Reagent Final concentration Amount
RNase-free water N/A 89 mL
SSC (20×) 2× 10 mL
SDS (10% w/v) 0.1% (w/v) 1 mL
Total N/A 100 mL

This solution should be made fresh. Before use, preheat the wash solution I to 50°C.

Wash solution II

Reagent Final concentration Amount
RNase-free water N/A 492.5 mL
SSC (20×) 0.1× 2.5 mL
SDS (10% w/v) 0.1% (w/v) 5 mL
Total N/A 500 mL

This solution should be made fresh. If using the wash solution II for the optional membrane wash after step 34, pre-warm the solution to 50°C. If using the wash solution II to strip the membrane in step 45, keep the solution at 22 to 25°C and heat it to boiling immediately before stripping the membrane.

20× NB salt buffer (pH 7.4)

Reagent Final concentration Amount
NaCl 1.36 M 79.5 g
Na2HPO4 1.16 M 164.7 g
NaH2PO4 0.34 M 40.8 g
RNase-free water N/A Fill to 1 L
Total N/A 1 L

This solution can be stored at 22 to 25°C indefinitely if stored properly without contamination, crystallization, or precipitation.

Note: Prepare 20× NB salt buffer using RNase-free equipment. Dissolve NaCl, Na2HPO4, and NaH2PO4 in approximately 700 mL of RNase-free water. Once all of the components are fully dissolved, bring the total volume to 1 L with RNase-free water. This buffer is used as a stock solution to make the strep-wash buffer and blocking buffer.

Strep-wash buffer (pH 7.4)

Reagent Final concentration Amount
NB Salt Buffer (20×) 1× 100 mL
SDS (10% w/v) 0.1% (w/v) 20 mL
RNase-free water N/A 1880 mL
Total N/A 2 L

This solution can be stored at 22 to 25°C indefinitely if stored properly without contamination, crystallization, or precipitation.

Blocking buffer (pH 7.4)

Reagent Final concentration Amount
NB Salt Buffer (20×) 1× 100 mL
SDS (10% w/v) 2% (w/v) 400 mL
RNase-free water N/A 1500 mL
Total N/A 2 L

This solution can be stored at 22 to 25°C indefinitely if stored properly without contamination, crystallization, or precipitation.

Note: Before use, add casein to the blocking buffer to a final concentration of 0.3% and ensure it is fully dissolved. Casein should be added fresh before each use.

20× assay buffer

Reagent Final concentration Amount
Tris-HCl pH 9.5 (2.5 M) 2 M 400 mL
NaCl 2 M 58.44 g
RNase-free water N/A Fill to 500 mL
Total N/A 500 mL

This solution can be stored at 22 to 25°C indefinitely if stored properly without contamination, crystallization, or precipitation.

Note: Prepare 20× assay buffer using RNase-free equipment. Dissolve the NaCl in 400 mL of 2.5 M Tris-HCl pH 9.5. Once the NaCl is fully dissolved, bring the total volume to 500 mL with RNase-free water. To prepare 1× assay buffer from the 20× assay buffer, dilute the 20× assay buffer 1:20 using RNase-free water. If using a mini-gel size membrane (6 × 8.5 cm), you will need 20 mL of 1× assay buffer.

Step-by-step method details

Resolving total RNA on urea-PAGE gel for tRNA analysis

Inline graphicTiming: 3 h

In this step, total RNA is resolved on a 12% polyacrylamide denaturing gel with 8 M urea (urea-PAGE) and stained with SYBR Gold Nucleic Acid Gel Stain. The gel is then transferred to a positively charged N+ HyBond membrane for subsequent Northern blot analysis to analyze tRNA abundance and the distribution of pre-mature and mature tRNA as well as small tRNA-derived fragments. Unprocessed tRNAs are typically within 80–100 nt in length, while mature tRNA ranges from 70–90 nt in length. The sizes of small tRNA-derived fragments can vary from 14 to 50 nt. The urea-PAGE gel setup can be adapted to different formats depending on the available equipment. Here, we demonstrate the procedure using a standard Bio-Rad vertical electrophoresis 1.0 mm mini-gel setup.

Note: RNase-free practices and equipment are essential in all these steps to avoid the degradation of RNA.

  • 1.
    Prepare a 12% polyacrylamide denaturing gel (8 M urea-PAGE). The recipe below is for one 8.6 cm (W) x 6.7 cm (L) x 1 mm (thickness) mini gel.
    Note: We recommend preparing the urea-PAGE freshly before use.
    • a.
      Dissolve 3.36 g of urea in 1.5 mL of RNase-free water, 0.7 mL of 10× TBE buffer and 2.1 mL of 40% acrylamide and bis-acrylamide solution (29:1).
      • i.
        Incubate the mixture in a 37°C water bath until the urea is fully dissolved.
        Note: Invert the tube periodically to facilitate the dissolution and mixing of the urea.
      • ii.
        Place the tube at 22 to 25°C to allow the solution to cool down for 5 to 10 min.
        Inline graphicCRITICAL: The urea requires warm incubation to fully dissolve. However, processing to the next step without cooling the solution to 22 to 25°C will lead to rapid polymerization, leading to a non-uniform gel structure with potential issues such as bubbles or uneven pore sizes. The cooling time may require adjustment if making multiple gels simultaneously with a larger volume of solution.
    • b.
      Add 35 μL of 10% ammonium persulfate solution (APS) and 3.5 μL of tetramethylethylenediamine (TEMED) to the gel solution at 22 to 25°C. Mix well and immediately cast the gel solution into the glass plates.
      • i.
        Fill the solution to the top edge of the glass.
      • ii.
        Place the comb into the gel immediately.
        Note: The final volume of the mixed urea-PAGE gel solution is 7 mL.
        Inline graphicCRITICAL: Load the gel solution with care. Avoid making any bubbles.
    • c.
      Let the gel polymerize at 22 to 25°C.
      Note: The polymerization of a typical 1 mm mini gel usually takes 15–20 min.
  • 2.

    Prepare warm 1× TBE buffer by pre-heating 1.08 L of RNase-free water in a microwave oven to ∼55°C (±5°C). Add 120 mL of 10× TBE to the pre-heated water. Mix well.

  • 3.
    Set up the gel in the running tank and remove the comb.
    • a.
      Fill the tank with the warm 1× TBE buffer.
    • b.
      Flush the empty wells by pipetting up and down with a 200 μL pipet to remove the urea and unpolymerized acrylamide from the bottom of the wells.
    • c.
      Pre-run the gel at 200 V for 15 to 30 min.

Inline graphicCRITICAL: The pre-run and the warm buffer keep the samples denatured during migration to ensure precise migration based on the size of RNA. Therefore, after the pre-run step, the samples should be ready to load without delay to prevent the setup from cooling down (see troubleshooting for further guidance).

Note: We recommend running the gel in a Styrofoam box to keep the apparatus warm (see troubleshooting for further guidance).

  • 4.
    Mix 2 μg of total RNA dissolved in RNase-free water with an equal volume of 2× urea-PAGE loading dye.
    • a.
      Denature the RNA by heating at 70°C for 5 min.
    • b.
      Place the sample on ice immediately after heating.

Note: The RNA sample can be prepared in advance and stored at −20°C (short-term) or −80°C (long-term) after mixing with the 2× urea-PAGE loading dye and denatured. In this case, RNA is stable in the loading dye and is ready to load on the gel once thawed.

  • 5.

    After the pre-run, flush the empty wells again with a 200 μL pipet to remove urea and unpolymerized acrylamide from the bottom of the wells.

  • 6.

    Load the samples and your desired markers into the wells.

Note: Various markers can be used according to the manufacturer's recommendation. For analyzing mature tRNAs, which are typically within 70–90 nt in length, markers such as NEB Low Range ssRNA Ladder (manufacturer’s protocol) are suitable for this goal. If smaller-sized RNA, such as tRNA-derived fragments, are also of interest, NEB microRNA Markers (manufacturer’s protocol) can be used in combination.

  • 7.

    Run the gel at 200 V for 35 min for a mini gel (8.6 cm (W) x 6.7 cm (L) x 1 mm (thickness)).

Note: We recommend running the gel in a Styrofoam box to keep the apparatus warm.

Note: The running time may vary based on the size of the gel and the settings in each lab. We recommend running the gel until the bromophenol blue dye is about to run off the gel.

  • 8.
    After running, disassemble the gel from the apparatus with care.
    • a.
      Transfer the gel to a clean RNase-free container. Rinse the gel with 0.5× TBE for 5 min with gentle shaking.
    • b.
      Dilute the SYBR Gold Nucleic Acid Gel Stain to 1× with 0.5× TBE. Stain the gel in 1× SYBR Gold Nucleic Acid Gel Stain for 3 min with gentle shaking.
      Note: The container should be covered to avoid light exposure. Make sure the gel is covered with a sufficient amount of the stain solution to ensure equal staining.
    • c.
      Visualize the gel by transillumination and save the image for further quantification (Figure 1A).
      Note: SYBR Gold Nucleic Acid Gel Stain can be visualized with a wide range of equipment, including UV transilluminators, the Dark Reader, laser scanners, or blue light transilluminators. Please consult the product information provided by your imager manufacturer to verify compatibility. We visualize the gel by transillumination at 302 nm UV.
      Note: After imaging, transfer the gel to 0.5× TBE without delay to prevent the gel from drying out.
  • 9.
    Prepare a N+ HyBond membrane for gel transfer.
    • a.
      Cut the N+ HyBond membrane to an appropriate size (slightly larger than the gel) and pre-wet it in 0.5× TBE for 5 min.
    • b.
      Soak two pieces of Extra Thick Blot Filter Paper (precut, 7.5 × 10 cm) in 0.5× TBE for a few seconds.
    • c.
      Remove excess buffer by gently touching the edge of the membrane and paper pads to a paper towel.

Note: Each piece of Extra Thick Blot Filter Paper (precut, 7.5 × 10 cm) can be replaced by 3 pieces of Whatman 3 MM paper pads (slightly larger than the membrane).

  • 10.
    Set up the semi-dry transfer.
    • a.
      Place a wet Extra Thick Blot Filter Paper on the anode (the bottom) of the semi-dry transfer apparatus.
      Inline graphicCRITICAL: Make sure the paper is fully lying flat on the anode.
    • b.
      Remove bubbles gently with a roller.
    • c.
      Remove excess liquid on the anode with a paper towel without disturbing the paper (see troubleshooting for further guidance).
    • d.
      Place the pre-wetted membrane on the center of the paper. Remove bubbles gently with a roller.
    • e.
      Place the gel on the membrane. Remove bubbles gently using your fingers.
    • f.
      Place another pre-wet paper on top. Gently smooth with fingers or a roller.
      Inline graphicCRITICAL: Avoid applying excessive pressure while rolling, as this can cause the gel to disassemble or lead to the bending of the paper and membrane.
    • g.
      Remove the excess liquid on the anode with paper towel without disturbing the transfer sandwich.
    • h.
      Carefully place the lid on the assembly. Press down on both diagonal corners until the lock mechanism clicks into place.
    • i.
      Begin the transfer at 20 V, 200 mA for 45 min.
      Note: For the transfer steps described above, we use a Bio-Rad Trans-Blot SD Semi-dry Transfer Cell system.
  • 11.
    After the transfer, disassemble the sandwich and place the membrane into a clean RNase-free container.
    • a.
      Wash the membrane twice with RNase-free water for 3 min with gently shaking.
    • b.
      Air dry the membrane on a clean paper towel.
    • c.
      Crosslink the RNA on the membrane using 254 nm UV at 1200 mJ/cm3 for 120 sec.
    • d.
      Place the membrane on a blue light tray and mark over the ladder bands on the edge of the membrane with a pencil.

Note: Transfer efficiency can be assessed at this step by visualizing the membrane and the gel on blue light (see troubleshooting for further guidance).

Inline graphicPause point: The dry membrane can be stored at 22 to 25°C indefinitely after UV crosslink. Store the membrane in a plastic pouch or container to prevent scratches and contamination from dust.

Figure 1.

Figure 1

Detection of tRNA-Tyr using urea-PAGE and northern blotting

(A) 3 μg of total RNA from HCT116 cells was resolved on a 12% polyacrylamide denaturing gel with 8 M urea (urea-PAGE) gel and stained with SYBR Gold Nucleic Acid Gel Stain. The marker lane combines the microRNA Marker and NB Low Range ssRNA Ladder.

(B) Total RNA samples from HCT116 WT and TRMT1L KO cells were analyzed by northern blot using the indicated tRNA-Tyr and U6 probes.

Resolving total RNA on formaldehyde-agarose gel for rRNA analysis

Inline graphicTiming: 2 days

To ensure good separation of the different rRNA processing intermediate products (Figure 2), we run the total RNA on denaturing 1% agarose gel with 0.4 M formaldehyde in tricine/triethanolamine (TT) buffer.5 We recommend using a gel longer than 13 cm. Here, we demonstrate the gel running procedure with a formaldehyde-agarose gel sized 11.5 cm (W) x 13.5 cm (H).

Note: RNase-free practice and equipment are essential in all these steps to avoid the degradation of RNA.

  • 12.
    Prepare the formaldehyde-agarose gel in an RNase-free bottle.
    Note: Here, we demonstrate the preparation of a 100 mL formaldehyde-agarose gel solution to cast a gel size of 11.5 cm (W) x 13.5 cm (H). Adjust the volume of the solution according to the size of your apparatus.
    • a.
      Mix 1 g of agarose with 97 mL of RNase-free water.
    • b.
      Microwave until completely dissolved. Let it sit at 22 to 25°C for about 5 min to allow the agarose solution to cool slightly.
      Inline graphicCRITICAL: Gently swirl the solution during heating to facilitate the dissolving of agarose. Ensure the agarose is completely dissolved without any visible white solid substrate, and avoid excessive bubble formation.
    • c.
      Add 2 mL of 50× TT buffer to the mixture. Gently swirl the solution to mix.
    • d.
      In a fume hood, add 3.5 mL of 37% formaldehyde. Gently swirl the solution to mix.
    • e.
      Allow the solution to cool to 50°C.
  • 13.
    Insert the comb into the clean RNase-free gel tray and pour the formaldehyde-agarose gel solution into the gel tray.
    • a.
      Cover tightly with plastic wrap to avoid evaporation of the formaldehyde.
    • b.
      Let the gel solidify at 22 to 25°C.

Note: Do not put the gel in the electrophoresis tank with running buffer in advance, as this will cause the formaldehyde to diffuse out of the gel. Formaldehyde is toxic and evaporates quickly as a pungent gas, so the gel should be cast in a fume hood while wearing protective eyewear. The gel should be fully covered with plastic wrap while it solidifies (see troubleshooting for further guidance).

  • 14.

    To prepare the RNA samples, mix 2–3 μg of total RNA dissolved in formamide with an equal volume of 2× formaldehyde loading solution. Mix thoroughly with gentle pipetting and quickly spin down.

Note: If your RNA samples are dissolved in RNase-free water instead of formamide, add 11 μL of formamide to mix with 1–3 μL (2–3 μg of total RNA) of RNA sample dissolved in RNase-free water. Then, mix with an equal volume of 2× formaldehyde loading solution (the same volume as the overall volume of the RNA sample after mixing with formamide).

Inline graphicCRITICAL: The 2× formaldehyde loading solution should be freshly prepared by mixing 1 volume of the 37% formaldehyde with 14 volumes of 2.1× TT RNA dye. (See materials and equipment setup for further instruction).

  • 15.

    Incubate the samples at 70°C for 5 min. Place at 22 to 25°C to allow the samples to cool down.

  • 16.

    Place the solidified agarose gel in the electrophoresis tank, add a sufficient amount of 1× TT buffer to the fill line, and fully cover the gel with buffer.

Inline graphicCRITICAL: Proceed to the next step without delay to prevent formaldehyde from diffusing out of the gel.

  • 17.

    Load the entire 2–3 μg of each sample prepared in step 14 into the wells of the solidified agarose gel.

  • 18.

    Set the voltage of the gel running according to the interelectrode distance of your apparatus, aiming for 6 V/cm. Run the gel at the fixed voltage until the bromophenol blue reaches 1–3 cm from the leading end of the gel.

Note: For example, if the interelectrode distance is 18 cm, run the gel at 108 V for approximately 3.5 h. We recommend running the gel with an apparatus with a buffer exchange port or built-in recirculation system, as it can better maintain consistent buffer conditions during the extended gel running process (see troubleshooting for further guidance).

  • 19.
    Before transferring, prepare a piece of positively charged Hybond N+ nylon membrane cut to a size 5 mm larger than the gel on all sides.
    • a.
      Fully rinse the membrane in RNase-free water for 1 min, then fully soak the membrane in 10× SSC for at least 5 min before transfer.
    • b.
      Prepare six pieces of Whatman 3MM paper, each cut to a size 10 mm larger than the gel on all sides. Additionally, prepare two pieces of Whatman 3MM paper of the same height but long enough on the width to serve as the wicks.

Note: The pieces of Whatman paper that serve as the wicks should be long enough for one end to be submerged in a container of transfer buffer set up in the following step, while the other end is placed on top of the two pieces of wet Whatman 3MM paper stacked on the top of the gel in the following step (Figure 3).

  • 20.
    After the electrophoresis is completed, set up the transfer in the following order on a flat surface (Figure 3).
    Inline graphicCRITICAL: To set up the transfer, make sure all layers are carefully aligned and stacked evenly on a flat surface. This will help ensure that the transfer proceeds efficiently and uniformly across the entire gel. When stacking each layer in the setup, make sure it is fully lying flat onto the adjacent layers without any bubbles.
    • a.
      Stack paper towels up to 3–5 cm high on a flat surface.
    • b.
      Stack two pieces of dry Whatman 3MM paper, cut into a size 10 mm larger than the gel on all sides, on the center of the paper towel stack.
    • c.
      Fully soak another two pieces of Whatman 3MM paper in 10× SSC and stack them on top of the dry Whatman 3MM paper.
    • d.
      Place the wet membrane on top of the wet Whatman 3MM papers. Make sure there are no bubbles between the paper and the membrane by gently pushing the bubbles out with your fingers.
    • e.
      Place the gel on top of the membrane, and make sure there are no bubbles between the gel and the paper by gently pushing the bubbles out with your fingers.
    • f.
      Lay another two pieces of wet Whatman 3MM paper, fully soaked in 10× SSC, on top of the gel.
    • g.
      Remove any bubbles between the gel and the paper by gently pushing the bubbles out with your fingers.
    • h.
      Apply a plastic wrap around the side of the membrane, gel and paper stack.
      Inline graphicCRITICAL: Make sure the plastic wrap covers the area where the wicks could contact the paper towel or the Whatman 3MM paper underneath the gel and membrane. This prevents the transfer buffer (10× SSC) from being drawn from the wick to the paper towels without passing through the gel and the membrane.
    • i.
      Fully soak the two long pieces of Whatman 3MM paper wicks in 10× SSC.
    • j.
      Place the two wicks on top of the stack, fully covering the Whatman 3MM paper on top of the gel.
    • k.
      Place the other ends of the wicks in a clean container filled with 10× SSC. Ensure the other ends of the wicks are fully submerged in the 10× SSC for the duration of the 16 h transfer.
      Note: We recommend having at least 300 mL of 10× SSC in the container for a 16 h transfer to ensure the transfer process runs efficiently.
    • l.
      Place a plastic wrap on top of the setup to prevent the transfer buffer (10× SSC) from evaporating. Then, place a glass plate on top to apply a lightweight and ensure even pressure across the transfer stack.
  • 21.

    Allow the transfer to proceed for 16 h.

  • 22.

    After the transfer is complete, carefully disassemble the transfer stack. Transfer the membrane to a clean container and rinse it with RNase-free water for a few seconds.

Note: Gently pour the water into the container avoiding direct contact with the membrane to avoid disturbing the transferred RNA.

  • 23.
    Stain the membrane with methylene blue staining solution to evaluate the transfer quality.
    • a.
      Gently agitate the membrane in the staining solution for 1–2 min until the 28S and 18S bands become visible.
      Inline graphicCRITICAL: Ensure the membrane is fully submerged for uniform staining.
    • b.
      Rinse the membrane with RNase-free water to remove excess stain and destain.
      Inline graphicCRITICAL: Ensure the membrane is fully submerged in RNase-free water for uniform destaining.
    • c.
      Once sufficient contrast is achieved, remove the water and transfer the membrane (RNA side facing up) to a clean paper towel and air-dry.
    • d.
      Take a picture of the membrane to record the methylene blue staining result (Figure 2A).
  • 24.

    Once the membrane is completely dried, mark the band positions on the side of the membrane with a pencil (Figure 2A).

Inline graphicCRITICAL: Make sure you mark the position of the major rRNA species before Northern blotting since the hybridization buffer in Northern blotting will remove the methylene blue stain from the membrane.

  • 25.

    Crosslink the membrane using 254 nm UV at 1200 mJ/cm3 for 120 sec to fix the RNA to the membrane.

Note: The membrane can be stored dry for 2–3 days before the hybridization.

Figure 2.

Figure 2

Analysis of rRNA processing using formaldehyde-agarose gel electrophoresis and northern blotting

(A) 2.5 μg of total RNA from HCT116 cells was resolved on 1% denaturing agarose gel with 1.3% formaldehyde and visualized with EtBr staining under 302 nm UV. After transfer, the membrane was stained with methylene blue (MB) staining solution.

(B) A schematic overview of the human pre-rRNA processing precursors (pink) and the location of example probes provided in the key resources table for northern blotting are indicated by the purple-color-shaded area.

Figure 3.

Figure 3

The setup for transferring RNA from the formaldehyde-agarose gel to the membrane

(A) A schematic diagram and (B) a picture of the setup for transferring RNA from the formaldehyde-agarose gel to the membrane.

Northern blot

Inline graphicTiming: 2 days

In this step, a biotin-labeled probe specifically recognizing different rRNA regions or tRNA species is incubated with the membranes prepared in the previous sections (“resolving total RNA on urea-PAGE gel for tRNA analysis” and “resolving total RNA on formaldehyde-agarose gel for rRNA analysis”). The hybridized probes are then detected using Streptavidin-AP for chemiluminescence visualization or Streptavidin-IR800 (or any other fluorophore) for fluorescence visualization. The volume of buffers and solutions in each step should be adjusted based on the size of the membrane and the matched container to ensure efficient hybridization and unbiased detection. Here, we demonstrate the steps for blotting a mini-gel size membrane (6 × 8.5 cm).

Note: The same membrane can be reblotted multiple times with different probes after stripping. However, due to the potential reduction in detection sensitivity after each re-blotting, we recommend starting with the detection that is expected to give the weakest signal. We also recommend blotting a known, stably expressing abundant RNA, such as U6 RNA, with the same membrane to ensure comparability in the amount of loading samples (see troubleshooting for further guidance).

  • 26.

    Place the crosslinked membrane into an RNase-free hybridization oven bottle, ensuring that the RNA-transferred side (RNA side) faces inward while the other side rests against the bottle wall. Add 15 mL of pre-warmed hybridization buffer (37°C) to the bottle.

Inline graphicCRITICAL: Ensure that the membrane is correctly positioned with the RNA side facing the interior of the bottle. Once the hybridization buffer is added, prevent the membrane from drying at any stage, as this can lead to background signal (see troubleshooting for further guidance).

  • 27.

    Place the hybridization bottle containing the membrane onto the rotor of a pre-warmed hybridization oven set at 50°C. Set the hybridization oven to rotate at a low speed (around 10 rotations/min) for 1 h at 50°C for pre-hybridization.

Note: The bottles should be balanced on the rotor in all subsequent steps when using the hybridization oven. If only one blotting is performed, balance the hybridization bottle with another hybridization bottle containing the same amount of liquid on the opposite side of the rotating arm.

  • 28.
    Thaw an aliquot of your desired tRNA probe and place it on ice before use.
    • a.
      Dilute it with RNase-free water to prepare 60 μL of a 5 μM probe solution.
    • b.
      Denature the 5 μM probe by heating it at 98°C for 2 min.
    • c.
      After denaturation, immediately chill the probe on ice for 1–2 min.
  • 29.

    Add the 60 μL of 5 μM probe to 15 mL of pre-warmed hybridization buffer (37°C) and mix thoroughly.

  • 30.

    After pre-hybridization, discard the hybridization buffer from the bottle. Add 15 mL of the probe-containing hybridization buffer to the bottle without delay.

Note: Avoid pouring the probe-containing hybridization buffer directly onto the membrane to prevent uneven distribution of the probe.

  • 31.

    Place the hybridization bottle containing the probe and membrane back into the hybridization oven. Set the hybridization oven to rotate at a slow speed (around 10 rotations/min) and incubate 16 h at 50°C.

  • 32.
    After the 16 h hybridization, discard the probe-containing hybridization buffer.
    • a.
      Add 25 mL of pre-warmed wash solution I (50°C) to the bottle to rinse the membrane.
    • b.
      Seal the bottle and gently rotate it horizontally, allowing the wash solution I to flow over the membrane a few times.
    • c.
      Discard the wash solution I.
  • 33.

    Add another 25 mL of pre-warmed wash solution I (50°C) to the hybridization bottle and place the bottle back into the hybridization oven. Incubate at 50°C for 5 min with slow speed rotations (around 10 rotations/min).

  • 34.

    Discard the wash solution I and repeat the wash step again as described in step 33 with another 25 mL of pre-warmed wash solution I (50°C).

Optional: After step 34, if the signal from your selected probe is very strong and results in nonspecific signals, an additional secondary wash step can be performed. To do so, discard the wash solution I, and add 25 mL of pre-warmed wash solution II (50°C) to the hybridization bottle. Perform a quick wash at 22 to 25°C. If the non-specific signal persists, perform the wash by incubating at 50°C for 10 min with slow-speed rotations (around 10 rotations/min) (see troubleshooting for further guidance).

  • 35.

    Transfer the membrane to a clean RNase-free container with a pair of tweezers.

Inline graphicCRITICAL: Make sure the RNA side of the membrane is facing up when transferring it to the clean RNase-free container.

  • 36.
    Add 10 mL of strep-wash buffer to the container and incubate the membrane with the strep-wash buffer for 5 min at 22 to 25°C with gentle shaking at 10-15 rpm on a rocking shaker.
    • a.
      Discard the strep-wash buffer after the incubation and repeat this washing step again with another 10 mL of strep-wash buffer.
    • b.
      Discard the strep-wash buffer after the second wash.

Inline graphicCRITICAL: Ensure that the membrane is completely covered with buffer. If needed, add more buffer to fully submerge the membrane. 10 mL of buffer is typically enough to cover a small (6.0 × 8.5 cm) membrane from steps 36–42, but depending on the size of the container used and the size of the membrane, more buffer may be needed to fully cover the membrane.

It is critical that the membrane does not dry out at any point during this process.

(see troubleshooting for further guidance).

  • 37.
    Add 10 mL of blocking buffer to the container and incubate for 5 min at 22 to 25°C with low-speed shaking at around 5 rpm.
    • a.
      Discard the blocking buffer after incubation and repeat this step again with another 10 mL of blocking buffer.
    • b.
      Discard the blocking buffer after the second incubation.

Inline graphicCRITICAL: Make sure that the casein is added to the blocking buffer, and that it is fully dissolved before use to prevent any interference in the blocking process.

  • 38.

    Add another 10 mL of blocking buffer to the container and incubate for 30 min at 22 to 25°C with low-speed shaking at around 5 rpm. Discard the blocking buffer.

  • 39.

    Add 9 mL of Streptavidin-AP or Streptavidin-IR800 solution to the container and incubate for 30 min at 22 to 25°C with low-speed shaking at around 5 rpm. Discard the Streptavidin-AP or Streptavidin-IR800 solution.

Inline graphicCRITICAL: The Streptavidin-AP or Streptavidin-IR800 solution should be prepared freshly. For Streptavidin-AP, dilute 3 μL of Streptavidin-AP (1.5 mg/mL) in 9 mL of blocking buffer. For Streptavidin-IR800, dilute 9 μL of Streptavidin-IR800 (1 mg/mL) in 9 mL of blocking buffer to have a final concentration of 1.0 μg/mL. If using Streptavidin-IR800, cover the container with a foil or dark lid to protect it from light-induced degradation.

  • 40.
    Add 10 mL of fresh blocking buffer to the container and incubate the membrane with the blocking buffer for 10 min at 22 to 25°C with low-speed shaking at around 5 rpm.
    • a.
      Discard the blocking buffer.
  • 41.
    Add 10 mL of strep-wash buffer to the container and incubate for 5 min at 22 to 25°C while gently shaking at 10-15 rpm.
    • a.
      Discard the strep-wash buffer.
    • b.
      Repeat this wash step again with another 10 mL of strep-wash buffer.
  • 42.

    If using Streptavidin-AP, add 10 mL of 1× assay buffer to the container and incubate the membrane with the 1× assay buffer for 2 min at 22 to 25°C with gentle shaking at 10-15 rpm. Discard the assay buffer. Repeat this step again with another 10 mL of 1× assay buffer.

Optional: If using Streptavidin-IR800, the membrane can be directly processed for imaging on an appropriate instrument (skip steps 42-44). We use an Azure Biosystems Sapphire Biomolecular Imager.

  • 43.

    Cover the membrane thoroughly with the Immune-Star AP substrate solution and incubate at 22 to 25°C for 5 min.

Note: We generally use 2–3 mL of Immune-Star AP substrate solution for a mini-gel size membrane (6 × 8.5 cm). If using a larger membrane, adjust the volume accordingly to ensure complete coverage. Make sure the solution spreads evenly across the membrane.

Inline graphicCRITICAL: Ensure that the Immune-Star AP substrate solution is applied to the RNA side of the membrane.

  • 44.

    Visualize the signal using a chemiluminescence imaging system, ensuring optimal exposure time to capture the signal effectively.

Note: If you plan to strip and re-blot the same membrane, wrap it in plastic wrap during the imaging process to prevent it from drying out.

  • 45.
    To strip the membrane after imaging, heat 250 mL of wash solution II in a clean microwave-safe container until it begins to boil.
    • a.
      Immediately fully submerge the membrane in the boiling wash solution II.
    • b.
      Place the container on a rocking shaker and shake at low speed until the solution cools to 22 to 25°C.
    • c.
      Discard the wash solution II.
    • d.
      Repeat this step with another 250 mL of wash solution II.

Note: It takes approximately 10–15 min for the boiling solution to cool down to 22 to 25°C.

  • 46.

    After stripping, remove excess solution and wrap the damp membrane in plastic wrap. Store at −20°C or immediately process to re-blot with another probe starting from step 26.

Inline graphicCRITICAL: The membrane should not be allowed to dry before storing. We recommend wrapping the membrane immediately after it is removed from the wash solution II to prevent drying.

Note: Membranes can be stored indefinitely at −20°C.

Expected outcomes

This protocol describes the procedures for analyzing rRNA and tRNA processing by resolving total RNA by electrophoresis on denaturing formaldehyde-agarose gel and urea-PAGE gel, respectively, followed by Northern blotting with biotin-labeled probes. The hybridized probes can be successfully detected by either using Streptavidin-IR800 or Streptavidin-AP. While the use of Streptavidin-AP requires additional steps and reagents, we find that it offers higher sensitivity and sharper signal compared to fluorescence imaging with Streptavidin-IR800.

In successful rRNA processing analysis, the mature form of human 18S and 28S rRNA are distinctly separated on the formaldehyde-agarose gel, appearing as two high-intensity bands on the membrane stained with methylene blue after transfer (Figure 2A). The success of the transfer can be assessed by the uniformity of the methylene blue staining across the membrane. The most abundant pre-rRNA intermediate products, such as the human 32S and 47S pre-rRNA, although much weaker than the mature rRNA signal, can also be detected by methylene blue staining (Figure 2A). After Northern blotting, probes specific to pre-rRNA different regions can identify various processing intermediates of different lengths (Figure 2B) (For an example, see Hwang et al., Figure S2B1).

For tRNA detection analysis, a successful urea-PAGE gel electrophoresis effectively identifies mature tRNAs as well as the non-processed 5′leader, 3′ trailer or intron-containing tRNAs (Figure 1). This approach also has the sensitivity to detect changes in the level of different tRNA iso-decoder expressed, depending on the choice of probes. For instance, we demonstrate that reduced levels of tRNA-Tyr in TRMT1L KO cells can be detected using this method (Figure 1B, also see Hwang et al; Figure 6E1).

Limitations

The success of this experiment hinges on the meticulous design of biotin-labeled probes, which are essential for detecting intermediates of rRNA processing products or specific tRNA iso-decoders. Given the high sequence similarity among tRNAs, identifying specific tRNA variants or iso-decoders can be particularly challenging. Although the described approach is sensitive enough to detect small tRNA-derived fragments, those present at very low abundance may necessitate more sophisticated methods, such as small RNA sequencing, to achieve enhanced resolution.

Troubleshooting

Problem 1

Poor resolution in electrophoresis (step 8c, 23d, 42, and 44; Figures 1A and 2A).

Potential solution

  • •

    Ensure proper quality control of total RNA. If the total RNA is impure or not fully dissolved, it may result in streaky RNA bands during electrophoresis. Common issues include improper dissolution of RNA, over-confluency of cells, insufficient TRIzol reagent for RNA extraction, incomplete homogenization of the sample after mixing with TRIzol, over-drying of the RNA pellet after isopropanol precipitation, and inadequate RNase-free water or formamide for dissolving the RNA pellet. To prevent these issues, ensure that cells are seeded in a number that results in no more than 80% confluency on the day of harvesting. Use an appropriate amount of TRIzol, adjusting the reagent volume proportionally to the number of cells throughout the extraction process. When dissolving RNA, use sufficient RNase-free water or formamide and avoid over-drying the RNA pellet. If needed, incubate the RNA in RNase-free water at 55–60°C for 10–15 min to allow its complete solubilization.

  • •

    For the urea-PAGE gel, make sure the electrophoresis is performed at a temperature higher than 40°C to maintain proper denaturation of the RNA. We also recommend running the gel in a Styrofoam box to keep the apparatus warm throughout the electrophoresis process.

  • •

    When running a formaldehyde-agarose gel, make sure the gel is covered and sealed as it solidifies to avoid the release of formaldehyde.

  • •

    The gel running length can be optimized, as migration rates may vary depending on the specific settings and equipment used in different laboratories. It’s important to monitor the progress and adjust the running time to ensure optimal separation of RNA bands.

Problem 2

The dye in the formaldehyde loading solution turned yellow during electrophoresis, and the samples migrated unevenly (step 18).

Potential solution

  • •

    Facilitate buffer circulation. During extended runs of the formaldehyde-agarose gel, the dye color may turn yellow due to a shift in pH towards acidity. This indicates that the running buffer might not be properly buffered, leading to pH fluctuations. Using an apparatus with a buffer exchange port or a built-in recirculation system can help maintain consistent buffer conditions by facilitating circulation throughout the extended gel running process.

Problem 3

Strong nonspecific signal or noise in the Northern blot (step 42 and 44).

Potential solution

  • •

    Make sure that the membrane does not dry out throughout the entire Northern blotting process, from the pre-hybridization to the imaging. Always ensure that the membrane is fully covered with an adequate amount of buffer at each step. The buffer volume should be adjusted based on the size of both the membrane and the container. The membrane should not stick to the sides of the container when incubated in buffers on the shaker, as this can lead to uneven hybridization or washing. Additionally, if the membrane dries, it can cause nonspecific binding of the probe, which cannot be removed in the washing step. Avoid adding the diluted biotin-labeled probe directly to the membrane, as this can lead to speckles and high background signal.

  • •

    If your selected probes, such as the ITS1 and ITS2 probes listed in the key resources table, produce stronger nonspecific signals, consider performing an additional secondary wash step with wash solution II after the main washes (see the optional step in step 34).

Problem 4

No or weak signal (step 42 and 44).

Potential solution

  • •

    Ensure the RNA is successfully transferred to the membrane. For tRNA detection, visualize the SYBR Gold staining signal on a blue light tray after the transfer as described in step 8. A successful transfer should display uniform RNA transfer with minimal residual signal remaining on the urea-PAGE gel. For rRNA processing analysis, the transfer efficiency can be visualized by methylene blue staining in step 23. If the RNA is not properly transferred, verify that the transfer setup is correctly assembled, ensuring no bubbles are trapped between layers and that the arrangement of the membrane and gel are correctly oriented. Do not apply excessive weight on top of the transfer stack, as this can lead to uneven transfer. For tRNA transfer, avoid excessive buffer in the transfer setup and ensure the correct electric current direction.

Resource availability

Lead contact

Requests for further information and resources should be directed to and will be fulfilled by the lead contact, Catherine Denicourt (Catherine.Denicourt@uth.tmc.edu).

Technical contact

Technical questions on executing this protocol should be directed to and will be answered by the technical contacts, Sseu-Pei Hwang (Sseu-Pei.Hwang@uth.tmc.edu) and Katherine Barondeau (Katherine.Barondeau@uth.tmc.edu).

Materials availability

This study did not generate new unique reagents.

Data and code availability

This study did not generate new datasets or codes.

Acknowledgments

This work was supported by the National Institutes of Health (grant number R01-CA230746). S.-P.H. received the CPRIT Fellowship in the Biomedical Informatics, Genomics and Translational Cancer Research Training Program (BIG-TCR) (CPRIT RP210045). The graphical abstract and Figure 2A were created with BioRender.com.

Author contributions

S.-P.H. and K.B. performed the experiments. C.D. guided the research. C.D., S.-P.H., and K.B. designed the experiments and wrote the paper.

Declaration of interests

The authors declare no competing interests.

Contributor Information

Sseu-Pei Hwang, Email: sseu-pei.hwang@uth.tmc.edu.

Katherine Barondeau, Email: katherine.barondeau@uth.tmc.edu.

Catherine Denicourt, Email: catherine.denicourt@uth.tmc.edu.

References

  • 1.Hwang S.P., Liao H., Barondeau K., Han X., Herbert C., McConie H., Shekar A., Pestov D.G., Limbach P.A., Chang J.T., Denicourt C. TRMT1L-catalyzed m(2)(2)G27 on tyrosine tRNA is required for efficient mRNA translation and cell survival under oxidative stress. Cell Rep. 2025;44 doi: 10.1016/j.celrep.2024.115167. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Cappannini A., Ray A., Purta E., Mukherjee S., Boccaletto P., Moafinejad S.N., Lechner A., Barchet C., Klaholz B.P., Stefaniak F., Bujnicki J.M. MODOMICS: a database of RNA modifications and related information. 2023 update. Nucleic Acids Res. 2024;52:D239–D244. doi: 10.1093/nar/gkad1083. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Huh D., Passarelli M.C., Gao J., Dusmatova S.N., Goin C., Fish L., Pinzaru A.M., Molina H., Ren Z., McMillan E.A., et al. A stress-induced tyrosine-tRNA depletion response mediates codon-based translational repression and growth suppression. EMBO J. 2021;40 doi: 10.15252/embj.2020106696. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Schneider C.A., Rasband W.S., Eliceiri K.W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods. 2012;9:671–675. doi: 10.1038/nmeth.2089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Mansour F.H., Pestov D.G. Separation of long RNA by agarose-formaldehyde gel electrophoresis. Anal. Biochem. 2013;441:18–20. doi: 10.1016/j.ab.2013.06.008. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

This study did not generate new datasets or codes.


Articles from STAR Protocols are provided here courtesy of Elsevier

RESOURCES