Abstract
Objective
This study explores how extracellular vesicles (EVs) derived from keratinocytes cultured in Gelatin Methacryloyl (GelMA) hydrogels facilitate microvascular regeneration and enhance wound repair in diabetic skin ulcers.
Methods
EVs were harvested from keratinocyte cultures via ultracentrifugation and ultrafiltration, followed by characterization. Their uptake and angiogenic effects on human umbilical vein endothelial cells (HUVECs) were assessed in the following experimentations. Transcriptomic profiling of EV-treated HUVECs identified angiogenesis-related gene expression changes. A diabetic murine wound model was established and validated via glycemic profiling and pancreatic histology. In vivo effects of GelMA-EVs were evaluated through wound closure rates, histology (re-epithelialization, vascularization, collagen deposition), CD31 staining, and microvascular imaging.
Results
Keratinocyte-derived EVs significantly enhanced HUVEC proliferation, migration, and tube formation. Mechanistic studies reported elevated PDGF expression, activating the PI3K/AKT pathway. In vivo experiments validated that GelMA hydrogel-loaded EVs increased PDGF expression in wound tissues, promoting microvascular reconstruction and accelerating wound healing in diabetic mouse skin ulcers.
Conclusion
GelMA hydrogel-loaded EVs derived from keratinocytes upregulate PDGF, activating the PI3K/AKT pathway to promote microvascular network reconstruction and enhance wound healing in diabetic mouse skin ulcers.
Graphical Abstract
Graphical Highlight
Keratinocyte-derived EVs were loaded into GelMA hydrogel for sustained release.
GelMA-EVs significantly enhanced endothelial proliferation, migration, and tube formation.
In vivo, GelMA-EVs accelerated diabetic wound healing and microvascular reconstruction.
Mechanistically, EVs activated the PDGF/PI3K/AKT pathway to mediate regeneration.
Supplementary Information
The online version contains supplementary material available at 10.1007/s10565-025-10062-2.
Keywords: Gelatin methacryloyl hydrogel, Diabetic skin ulcer, Extracellular vesicles, PDGF, PI3K/AKT pathway
Introduction
The global burden of diabetes has escalated markedly in recent years, emerging as a pressing public health issue due to its rising prevalence and long-term complications (Ogurtsova et al. 2017). This chronic metabolic disease not only involves disturbances in glucose metabolism but also presents various complications, with impaired skin ulcer healing being particularly prominent (Frykberg et al. 2006). Normal wound healing is a complex biological process characterized by three typical stages: inflammation, proliferation, and remodeling. It involves multiple cells, cytokines, and extracellular matrix components (Martin 1997). The mechanisms behind poor wound healing in diabetes are still unclear. Conventional clinical treatments for diabetic wounds include surgical debridement and negative pressure wound therapy (Martí-Carvajal et al. 2015). However, the effectiveness of these treatments is not significant due to impaired cellular functionality in the wound's surrounding area (Pop and Almquist, 2017). Therefore, the search for new strategies and methods to accelerate the healing and repair of damaged cells in diabetic skin ulcers has become an important focus of diabetes complication research. Among these, EV-based therapy has demonstrated superior healing efficacy compared to conventional methods (Zhou et al. 2024).
Recently, extracellular vesicles (EVs) have been considered a new approach to accelerate wound healing (Golchin et al. 2018). In particular, EVs derived from mesenchymal stem cells (MSCs) have shown multiple beneficial effects, including enhanced angiogenesis, reduced inflammation, and increased cellular proliferation (Long et al. 2024). These small vesicles function as messengers in the communication between cells and have significant regulatory effects (Buzas et al. 2014). They act as carriers of specific bioactive molecules released by cells to communicate information to other cells. EVs contain various bioactive substances such as proteins, lipids, and nucleic acids (Maas et al. 2017), and these substances can exert significant regulatory effects on the behavior and function of recipient cells within a short period of time.
Previous studies have demonstrated that EVs derived from various cell types, including keratinocytes, can accelerate diabetic wound healing (Wang et al. 2019). Keratinocytes, the major constituent of the epidermis, play critical roles in both physiological and pathological skin processes (Wilson 2013). These cells secrete a wide range of bioactive components—including growth factors, cytokines, and EVs—to facilitate re-epithelialization during wound healing (Wu et al. 2023). Collectively known as the keratinocyte secretome, these secretions possess regenerative and reparative capabilities, stimulating the proliferation of fibroblasts and endothelial cells to accelerate wound closure (Li et al. 2023). EVs, as a key component of the secretome, carry bioactive molecules such as miRNAs and proteins (e.g., TOMM70), mediating interactions between keratinocytes and macrophages or fibroblasts, and coordinating the process of re-epithelialization (Li and Wu 2022). For instance, the secretome of HaCaT cells—an immortalized human keratinocyte line—has been shown to promote skin cell proliferation, regeneration, and rejuvenation (Heebkaew et al. 2023). HaCaT keratinocytes, widely utilized in dermatological research involving conditions such as psoriasis, contact dermatitis, and skin malignancies (Glady et al. 2018), have recently gained attention for their secreted EVs, which are enriched in miRNAs associated with tissue repair and regeneration (Yu et al. 2023). Thanks to their robust proliferation, straightforward culture conditions, and high EV productivity (Boukamp et al. 1988). EVs derived from this cell line offer the advantages of high yield and stability (Huldani et al. 2023). Beyond conventional intercellular communication, EVs also play essential roles in physiological and pathological processes such as wound healing and inflammation (Huang et al. 2015). In diabetic wounds, they contribute to macrophage polarization, promote fibroblast migration, and stimulate angiogenesis (Zhu et al. 2022). Building on these insights, the present study focuses on elucidating how keratinocyte-derived EVs contribute to tissue regeneration and vascular remodeling in diabetic cutaneous wounds.
Combining EVs with biomaterials can prolong the activity of the secretome, enhance regenerative effects, and prevent rapid degradation of EVs, making the choice of an ideal EV carrier critically important (Ibrahim et al. 2022). For instance, a high-performance EV-based hydrogel system for burn wound healing has been developed by incorporating EVs derived from 3D-printed ultrafine fiber cultures into a highly biocompatible hyaluronic acid (HA) matrix (Zhu et al. 2024). Another group has proposed a simplified and integrated device to facilitate hydrogel systems using HA and EV-loaded alginate composites for regenerative medicine applications (Wan et al. 2024). Gelatin Methacryloyl (GelMA) hydrogel has gained significant attention in biomedical research in recent years. Its strong biocompatibility and simplified operation have rendered it a promising biomaterial for tissue engineering and regenerative medicine applications (Wu et al. 2021a, b). GelMA possesses a porous structure, which effectively preserves drug factors and prolongs the half-life of drug release (Born et al. 2022). Moreover, GelMA hydrogel retains certain characteristics of collagen and gelatin, facilitating cell adhesion (Levett et al. 2014). By successfully combining EVs derived from keratinocytes with GelMA hydrogel, this fusion utilizes the regulating function of extracellular vesicles and the biocompatible scaffold nature of GelMA, offering new perspectives and directions for the treatment of diabetic skin ulcers.
Given the aforementioned background, our study probes into the potential molecular mechanisms of GelMA-loaded keratinocyte-derived extracellular vesicles in promoting microvascular network reconstruction and wound healing in mice with diabetic skin ulcers. Through an in-depth investigation of this prevascularized wound dressing, we aim to provide novel strategies and approaches for the treatment of diabetic skin ulcers, thus further advancing scientific research and clinical applications in the field of diabetes complications treatment.
Materials and methods
Ethical statement
All animal experiments were conducted in full compliance with institutional and national ethical guidelines for the care and use of laboratory animals. Experimental protocols were reviewed and approved by the Institutional Animal Care and Use Committee of our institution. Animals were maintained under humane conditions, and all efforts were made to reduce discomfort. At the study’s conclusion, mice were euthanized using ether anesthesia to ensure minimal distress.
Cell culture
HaCaT keratinocytes and HUVECs were procured from Qingqi Biotechnology Development Co., Ltd. (BFN60803901 and BFN6021653, Shanghai, China). Cells were cultured in DMEM (10,569,010, Thermo Fisher, USA) enriched with 10% FBS (10099141C, Thermo Fisher) and 1% penicillin–streptomycin (15,070,063, Thermo Fisher). Cultures were maintained at 37 °C with 5% CO2 in a humidified incubator (Sjöqvist et al. 2019).
Isolation of HaCaT-EVs
Conditioned medium from HaCaT cultures was sequentially centrifuged to isolate EVs. Initial low-speed spins at 300 × g for 5 min (RT) and 2000 × g for 10 min (4 °C) were used to remove cells and apoptotic bodies, followed by 10,000 × g for 30 min (4 °C) to eliminate residual debris. The clarified supernatant was ultracentrifuged at 100,000 × g for 70 min (4 °C) using a Beckman Optima MAX-XP system to pellet EVs. After washing in PBS (P1020, Solarbio, Beijing, China), the pellet underwent a second ultracentrifugation under identical conditions. The final EV pellet was resuspended in PBS and stored at −80 °C until further use (Pessolano et al. 2019). Standard centrifugations were performed with a Beckman Allegra X-15R benchtop centrifuge.
Identification of HaCaT-EVs
HaCaT-derived EVs were characterized using multiple standard approaches. For nanoparticle tracking analysis (NTA), EVs were diluted 1:200 in PBS, filtered through a 0.22 µm membrane (C85052, Millipore, USA), and analyzed for size and concentration utilizing a NanoSight LM10 system (Malvern Panalytical, UK) (Lu et al. 2023).
Morphology was assessed via transmission electron microscopy (TEM). A 20 µL aliquot of fresh EV suspension was applied to carbon-coated copper grids, allowed to adsorb for 5 min, and negatively stained with phosphotungstic acid (12,501–23-4, Sigma-Aldrich, USA). After triple PBS washes and air-drying, grids were visualized using a Hitachi H-7650 TEM (Zhang et al. 2015).
EV-specific surface markers were examined by Western blot. Total protein was quantified using a BCA kit (23,227, Thermo Fisher, USA), and 50 μg was loaded per sample. Following SDS-PAGE and membrane transfer, EVs were probed with antibodies against CD9 (ab263019, Abcam, UK) and ALIX (ab232611, Abcam) as positive markers, and Calnexin (ab133615, Abcam) as a negative control to verify sample purity (Han et al. 2022).
Uptake of HaCaT-EVs by HUVECs
To assess EV internalization, purified HaCaT-EVs were labeled with the green fluorescent dye PKH67 (D0031, Solarbio, Beijing, China). The dye was prepared by diluting PKH67 in Diluent C, then incubated with EVs for 10 min (RT). Staining was halted by adding PBS with 1% FBS. Labeled EVs were co-cultured with HUVECs (3 × 105 cells) for 12 h. After incubation, cells were rinsed thoroughly with PBS to remove excess vesicles, fixed in 4% paraformaldehyde (P1110, Solarbio), and counterstained with DAPI (1:1000; D9542, Sigma-Aldrich) to visualize nuclei. Fluorescence imaging was performed using an Olympus IX73 microscope (Wang et al. 2021a, b).
Preparation of GelMA hydrogel
The GelMA hydrogel was prepared as follows: Initially, 5 g of porcine gelatin (48,722, Sigma-Aldrich, USA) were completely dissolved in preheated PBS buffer at 50 °C to achieve a solution concentration of 10% (w/v). Next, 4 ml of methacrylic anhydride (MA, 276,685, Sigma-Aldrich, USA) were slowly added to the gelatin solution, and the mixture was continuously stirred at 50 °C for 3 h. Subsequently, the solution was subjected to continuous dialysis at 40 °C for 7 days to remove impurities. After dialysis, a white foam-like GelMA precursor was obtained through freeze-drying (Modaresifar et al. 2017).
Preparation of GelMA-EVs
The extracellular vesicles isolated from keratinocyte cells were mixed into the GelMA solution described above, ensuring thorough and uniform mixing before UV cross-linking. The final concentration of the extracellular vesicles was 50 μg/mL. The composite hydrogel was then cross-linked using 365 nm UV light for 15 s to avoid compromising EV bioactivity (Yuan et al. 2022; Gao et al. 2022).
Characterization of GelMA and GelMA-EVs
The physicochemical properties of GelMA and GelMA-EVs were examined utilizing FTIR (Nicolet 6700) to confirm characteristic functional groups. Rheological behavior, including storage (G′) and loss (G″) moduli, was assessed with a Physica MCR301 rheometer (Anton Paar, China). Compressive strength was quantified using a Q800 dynamic mechanical analyzer (TA Instruments, USA), and corresponding stress–strain curves were generated for mechanical profiling (Guan et al. 2022).
Porosity and vesicle distribution
To examine microstructural features, GelMA and GelMA-EVs samples were lyophilized with an Alpha 1–2 LDplus freeze dryer (Martin Christ, Germany). Scanning electron microscopy (SEM; FEI Quanta 200, Thermo Fisher, USA) was then employed to visualize surface morphology and pore architecture. Prior to imaging, samples were sputter-coated with gold to enhance conductivity, and observed at an accelerating voltage of 20 kV (Deng et al. 2023).
Swelling behavior
Firstly, the dry weight (Wd) of photo-crosslinked cylindrical hydrogel samples was measured. Subsequently, the samples were immersed in 2 mL of PBS and incubated at 37 °C for 24 h to reach equilibrium swelling. Following removal of surface moisture, the wet weight after swelling (Ws) was measured (Hu et al. 2020). The swelling ratio can be calculated as:
Kinetics of EVs release from GelMA hydrogel
To investigate the release behavior of EVs from GelMA hydrogel, GelMA-EV composites were prepared and incubated in a PBS solution at 37 °C. The supernatant was collected at days 1, 3, 5, 7, 9, 11, and 14, and the concentration of free EVs in the supernatant was determined employing the BCA assay. Cumulative release curves and daily release curves were calculated and plotted over the specified time period (Liu et al. 2022).
Cell transfection
To simulate the diabetic environment in vitro, high glucose (33 mM glucose) was added to the HUVECs culture medium. Different experimental groups were co-incubated with the cells. Negative control (sh-NC) and PDGF shRNA (sh-PDGF) lentiviruses were procured from Genepharma (Shanghai, China). Cells were transduced with lentiviral supernatant supplemented with 5 μg/mL polybrene (TR1003, Sigma-Aldrich) following the manufacturer’s instructions. After a 24-h incubation, the medium was replaced. Forty-eight hours post-infection, transduced cells were selected using 2.5 μg/mL puromycin (540,411, Sigma-Aldrich). The following shRNA sequences were used: sh-PDGF, 5'- TGACAAGACGGCACTGAAGGA −3', and sh-NC, 5'-CCTAAGGTTAAGTCGCCCTCG-3'(Qi et al. 2021). HUVECs were co-incubated with different substances and divided into: control group with PBS, hydrogel group (GelMA), extracellular vesicles group (HaCaT-EVs), hydrogel-loaded extracellular vesicles group (GelMA-EVs). Additionally, the experimental groups and control groups of HUVECs with knocked-down PDGF gene co-incubated with GelMA-EVs were as follows: GelMA-EVs + sh-NC and GelMA-EVs + sh-PDGF. The dosage for each group was 50 μL.
Biocompatibility assessment
HUVECs (5 × 103 cells/well) were seeded into 96-well plates and exposed to different samples for 24 h. Cell viability was tested utilizing a live/dead staining kit (C2015M, Beyotime, China). After adding 100 μL of staining solution, cells were incubated at 37 °C in the dark for 30 min and imaged via fluorescence microscopy (Chen et al. 2023).
Proliferation assay
To evaluate the effect of EVs on HUVEC proliferation, the CCK-8 assay kit (96,992, Sigma-Aldrich, USA) was used to assess cell viability. HUVECs (5 × 103 cells/well) were seeded in a 96-well plate and incubated for 24 h before treatment with EVs. After adding 10 μL of CCK-8 reagent to each well, the plate was incubated at 37 °C for 2 h. The optical density (OD) of the samples was measured at 450 nm using an ELISA reader (Bio-Rad 680, Hercules, USA) (Chen et al. 2018).
Functional evaluation of HUVEC migration and angiogenic capacity
To investigate the functional impact of different treatments on endothelial behavior, HUVEC migration and tube formation were assessed using scratch, Transwell, and Matrigel-based assays.
For the scratch assay, confluent HUVEC monolayers (5 × 105 cells/well) were scratched with a pipette tip, washed, and incubated in serum-free medium with treatments. Migration was imaged at 0 and 24 h using an inverted microscope (TE2000, Nikon) (Glady et al. 2021)..
In the Transwell assay, HUVECs were seeded in the lower chamber, while treated serum-free medium was added to the upper chamber. After 24 h, migrated cells were fixed, stained with crystal violet, and quantified under a microscope (Olympus IX70) using ImageJ (Dai et al. 2022).
For the tube formation assay, Matrigel-coated wells (50 μL/well, 356,234, Corning, Shanghai, China) were seeded with HUVECs (1 × 104 cells/well) and incubated for 6 h. Tubule structures were visualized and analyzed with ImageJ (Gong et al. 2022).
In Vivo animal experimentation diabetic
Wound healing mouse model
Male C57BL/6 mice (8–10 weeks old) were obtained from Vital River Laboratories (101, Beijing, China). The mice were fasted for 12 h prior to modeling. Diabetes was induced by intraperitoneal injection of streptozotocin (STZ) (50 mg/kg) (S8050, Solarbio, Beijing, China). STZ was dissolved in freshly prepared citrate buffer (0.1 mol/L, pH 4.5) (C1013, Solarbio, Beijing, China) in order to prepare a 1% STZ solution, thus avoiding acute STZ toxicity. The injection was performed for 4 consecutive days. On the 12th day after the STZ injection, blood glucose was examined utilizing the Accu-Chek Performa glucometer (Roche, Switzerland) to confirm the hyperglycemic state (up to 200 mg/mL). From the 12th day after the STZ injection, fasting blood glucose was measured twice a week. When blood glucose levels remained above 16.7 mmol/L for 3 consecutive days, the successful construction of the diabetic mouse model was confirmed (Pomatto et al. 2021).
Mice were anesthetized using 3% isoflurane (792,632, Sigma-Aldrich, USA) inhalation. The dorsal area was disinfected using 10% povidone-iodine, and a full-thickness skin wound of 1 × 1 cm2 was created using a multipoint injection technique at the wound edge. The mice were randomized into control group treated with PBS, hydrogel group treated with GelMA, extracellular vesicle group treated with HaCaT-EVs, hydrogel-loaded extracellular vesicle group treated with GelMA-EVs. The infected sh-NC group without GelMA-EVs treatment served as the control group (sh-NC), GelMA-EVs-treated and sh-NC-infected group (GelMA-EVs + sh-NC), and GelMA-EVs-treated and sh-PDGF-infected group (GelMA-EVs + sh-PDGF). Each group consisted of 30 mice (Table 1). Injections of 100 μL were administered every 3 days within 14 days after the skin injury. Digital photographs of the wounds were taken daily using a Canon camera (Japan), and ImageJ software was utilized to analyze changes in wound area to monitor wound healing time and area reduction (Wei et al. 2020).
Table 1.
Experimental Grouping, Treatment, and Sample Size
| Group No | Group Name | Treatment Description | Sample Size (n) |
|---|---|---|---|
| 1 | Control | PBS injection | 30 |
| 2 | GelMA | Injection of GelMA hydrogel only | 30 |
| 3 | HaCaT-EVs | Injection of keratinocyte-derived EVs (HaCaT-EVs) | 30 |
| 4 | GelMA-EVs | Injection of EV-loaded GelMA hydrogel (GelMA-EVs) | 30 |
| 5 | sh-NC | Injection of negative control shRNA, no GelMA-EVs treatment | 30 |
| 6 | GelMA-EVs + sh-NC | Injection of GelMA-EVs combined with negative control shRNA | 30 |
| 7 | GelMA-EVs + sh-PDGF | Injection of GelMA-EVs combined with PDGF knockdown shRNA | 30 |
Observation of organizational changes
Skin samples taken from mice were immediately fixed in 4% paraformaldehyde for at least 24 h. The fixed samples were then dehydrated with a gradient of ethanol, clarified in bright isopropanol, and finally, consecutive sections with a thickness of 5 µm were obtained utilizing a paraffin microtome.
H&E Staining
Paraffin-embedded tissue sections were baked at 60 °C for 1 h, deparaffinized with xylene, and stained using standard hematoxylin (10 min) and eosin (2 min) protocols. After mounting, tissue morphology was examined under a light microscope. Reepithelialization was quantified utilizing the formula E% = (Wn/Wo) × 100, where Wo is the initial wound width and Wn is the length of regenerated epithelium(Yang et al. 2020).
Masson's Trichrome Staining
The sections were dried in an oven at 65 °C for 2 h and underwent routine deparaffinization and dehydration. They were stained with hematoxylin for 8 min and rinsed with distilled water. Subsequently, they were stained with 1% Ponceau S for 10 min. After a brief immersion in 2% acetic acid, the reaction was terminated with 1% phosphomolybdic acid solution. Without washing, the sections were directly stained with aniline blue for 2 min. Routine dehydration was performed, followed by mounting with transparent neutral resin (Wang et al. 2021a, b). Tissue sections were observed, and images were captured under an optical microscope, paying attention to significant features associated with epithelialization, neovascularization, and collagen fiber deposition. The average intensity of Masson's staining was examined utilizing Image-Pro Plus 6 software from randomly selected fields (at least 3).
Immunofluorescence Staining
After hydration of paraffin sections, they were blocked with 1.5% goat serum. The sections were then incubated with α-SMA antibody conjugated with Fluor 488 (488 53–9760-80, 1:200, Thermo Fisher, USA) and CD31 antibody conjugated with APC (17–0311-80, 1:500, Thermo Fisher, USA). DAPI (1:1000) was used to stain the nuclei. Stained sections were observed under a fluorescence microscope, and the density of blood vessels and positive cells were quantified using Image-Pro Plus 6 software from randomly selected fields (at least 3) (Ren et al. 2022).
Microvascular imaging
Microvascular assessment at the wound site was implemented utilizing the IVIS Spectrum imaging system (PerkinElmer, USA). Mice were lightly anesthetized, and transparent tape was applied around the wound to minimize signal interference. Imaging was performed per manufacturer’s protocol, and data were analyzed using Living Image software (PerkinElmer) (Zhou et al. 2023).
RT-qPCR
Total RNA was extracted from mouse skin tissues and cultured cells utilizing TRIzol reagent (10,296,010, Thermo Fisher, USA), followed by reverse transcription with the PrimeScript™ RT kit (RR086A, TaKaRa, Japan). qPCR amplification was implemented utilizing SYBR® Premix Ex Taq™ II (DRR081, TaKaRa) on an ABI 7500 system (Thermo Fisher, USA). GAPDH served as the internal control. Reactions were run in triplicate, and gene expression levels were quantified utilizing the 2−ΔΔCt method (Wang et al. 2018). Primers (Table S1) were synthesized by Shanghai Simgen Bio. Each experiment was independently repeated three times.
Western blot
Total protein was extracted from cells or tissues using a commercial lysis kit (BB3101, Bestbio, Shanghai) with enhanced RIPA buffer enriched with protease inhibitors (AR0108, Boshide, Wuhan). Protein concentrations were determined using a BCA assay (23,227, Thermo Fisher, USA). Equal amounts of protein (50 μg) were resolved on 10% SDS-PAGE gels (P0012A, Beyotime) and transferred to PVDF membranes (IPVH00010, Millipore) at 250 mA for 90 min. Membranes were blocked with 5% skim milk in TBST for 4 h (RT), followed by overnight incubation at 4℃ with primary antibodies (Table S2) prepared in 5% BSA/TBST. After washing, membranes were incubated with HRP-conjugated secondary antibodies (Anti-Mouse, #7076; Anti-Rabbit, #7074; CST, 1:5000) for 1 h. Protein bands were visualized using enhanced chemiluminescence (P0018FS, Beyotime) and imaged in a darkroom. Band intensities were quantified with ImageJ software, normalized to GAPDH as a loading control (Luo et al. 2019; Lu et al. 2018).
Sequencing and initial data processing
Total RNA was extracted using TRIzol and dissolved in DEPC-treated water. RNA purity (A260/280 between 1.8–2.1) was assessed via NanoDrop, and integrity was confirmed with an Agilent Bioanalyzer (RIN ≥ 7). Ribosomal RNA was depleted, and sequencing libraries were constructed using NEB or Illumina kits, involving RNA fragmentation, adaptor ligation, and quality validation via Qubit and Bioanalyzer.
Sequencing was performed on Illumina HiSeq or NovaSeq platforms. Raw reads were quality-checked using FastQC (Q30 > 90%), and adapters/low-quality reads were trimmed using Trim Galore or Trimmomatic. Clean reads were aligned to the reference genome using HISAT2 or STAR, with mapping efficiency exceeding 90%.
Differential expression analysis was carried out in R (v4.2.1) using the limma package, applying thresholds of |log2FC|> 1 and P < 0.05. Heatmaps and volcano plots of differentially expressed genes (DEGs) were visualized using the heatmap and ggplot2 packages, respectively (Liu et al. 2018).
Statistical analysis
Data were analyzed using GraphPad Prism 8 (v8.0.2) and SPSS 21.0 (SPSS Inc., USA). Continuous variables were summarized as mean ± SD. Group comparisons were implemented utilizing unpaired t-tests (two groups) or one-way ANOVA (multiple groups), while two-way ANOVA was applied for time-course data. Categorical data were analyzed utilizing the chi-square test. Statistical significance was set as P < 0.05.
Results
Isolation and characterization of HaCaT-EVs and their uptake by HUVECs
EVs were successfully isolated from HaCaT cell supernatant with the help of ultracentrifugation. Through sequential centrifugation steps, we gradually removed cellular debris and impurities, and finally isolated EVs at 100,000 × g. According to BCA protein assay results, we obtained approximately 3 mL of HaCaT-EVs at a concentration of 1.45 μg/μL from 50 mL of culture supernatant. TEM revealed that the EVs displayed a circular or elliptical shape with a diameter ranging from 50–150 nm, and intact membrane structures were observed around the EVs (Fig. 1A). NTA confirmed that the majority of EVs were approximately 100 nm in diameter, with an average concentration of 1.0 × 10⁷ particles/mL (Fig. 1B). As determined by Western blot analysis, we observed significant expression of the positive markers CD9 and Alix in the extracted EVs, compared to the protein expression levels in HaCaT cells (Cell lysis group), while no expression of Calnexin (an endoplasmic reticulum membrane marker) was observed (Fig. 1C). This confirms the high purity of the isolated extracellular vesicles.
Fig. 1.
Characterization of HaCaT-EVs. Note: (A) The morphology of HaCaT-derived EVs was observed using transmission electron microscopy (TEM), with scale indicators and average concentration of 1 μm and 200 nm; (B) The size distribution of EVs was examined using NanoSigh; (C) Western blot was performed to detect EV marker proteins CD9 and Alix, as well as the negative marker protein Calnexin; (D) The internalization of HaCaT-derived EVs in HUVECs was visualized using fluorescence microscopy, with PKH67 (green) and DAPI (blue) staining. The scale indicator was set at 50 μm
To investigate the effects of EVs on HUVECs, we treated HUVECs with PKH67-labeled EVs. Fluorescence microscopy revealed that the green-labeled EVs were distributed in the perinuclear region of the cells, indicating successful uptake of the labeled EVs by HUVECs (Fig. 1D). These results demonstrate the successful isolation of HaCaT-derived EVs and internalization of HaCaT-EVs by HUVECs.
Preparation and characterization of GelMA hydrogel loaded with HaCaT-EVs
It has been reported that hydrogel loading of extracellular vesicles (EVs) can slow down their degradation rate both in vitro and in vivo (Zhang et al. 2018a, b). When HaCaT-EVs are combined with hydrogels and applied near the target tissue, therapeutic factors within the HaCaT-EVs can be delivered locally. In this study, GelMA hydrogel was successfully prepared using gelatin and methyl methacrylate (MMA) through photopolymerization, resulting in a visually intact gel with no visible cracks. Subsequently, HaCaT-EVs were loaded into GelMA, generating GelMA-EVs (Figure S1A). Based on the stress–strain curves associated with the photopolymerization of hydrogels (Figure S1B), the addition of HaCaT-EVs did not significantly alter the compressive strength of the hydrogel. The swelling properties of GelMA and GelMA-EVs hydrogels were evaluated (Figure S1C), and all prepared hydrogels were able to absorb more than double their own solution volume, facilitating the absorption of wound exudate and maintaining a moist wound environment, which is beneficial for wound healing and repair.
SEM analysis of GelMA and GelMA-EVs microstructures (Fig. 2A) revealed a typical porous structure in GelMA hydrogel, which promotes cell adhesion and infiltration, with EVs binding to the inner surface of the GelMA hydrogel. The release capability of the hydrogel was determined by using a BCA protein assay to measure the released EVs, compared with blank GelMA controls, EV-loaded hydrogels demonstrated sustained release over approximately one week, with more than 80% of the encapsulated EVs being released in an unobstructed manner (Fig. 2B-C), ensuring the bioactivity of the EVs. FTIR analysis of GelMA and GelMA-EVs (Fig. 2D) demonstrated a significant spectral overlap between the two groups, with no significant differences in peak values. By analyzing the infrared absorption peaks of GelMA and GelMA-EVs, we found no significant differences in the type and quantity of internal functional groups, suggesting that no chemical reactions occurred between the extracellular vesicles and the gel.
Fig. 2.
Physicochemical properties of GelMA hydrogel loaded with HaCaT-EVs. Note: (A) Scanning electron microscopy observation of GelMA and GelMA-EVs, scale bar: 10 μm; (B) Daily release curve of EVs from GelMA hydrogel (n = 3); (C) Cumulative release curve of EVs from GelMA hydrogel (n = 3); (D) FTIR spectra of GelMA hydrogel and GelMA-EVs; (E) Storage modulus and loss modulus of GelMA and GelMA-EVs measured using a rheometer. Cell experiments were performed in triplicate
The internal network of hydrogels plays a crucial role in regulating cellular behavior and drug diffusion, with their rheological performance reflecting structural integrity (Xia et al. 2023). As shown in Fig. 2E, both GelMA and GelMA-EVs displayed typical viscoelastic profiles, with storage modulus (G′) consistently exceeding loss modulus (G″), indicating that EV incorporation did not compromise the mechanical stability of the hydrogel.
Enhanced release, biocompatibility, migration, and angiogenesis potential of GelMA-EVs
We have determined the controlled release ability of GelMA-EVs through the aforementioned study and found that GelMA-EVs can be released continuously from the hydrogel for approximately 14 days. In order to assess the biocompatibility of the hydrogel, GelMA-EVs, HaCaT-EVs, and HUVECs were co-cultured and treated with a live/dead staining assay for cell viability analysis (Fig. 3A). Fluorescence microscopy revealed green-labeled viable cells and red-labeled dead cells, with quantitative analysis (Fig. 3B) confirming that the hydrogel exhibited minimal cytotoxicity. To further assess cell viability, a CCK-8 assay was performed over 1, 2, and 7 days (Fig. 3C). While no significant differences were observed on day 1, both HaCaT-EVs and GelMA-EVs markedly enhanced HUVEC proliferation by day 2 compared to controls. On the second day, both the HaCaT-EVs and GelMA-EVs groups significantly promoted HUVEC proliferation compared to the control group. On the seventh day, GelMA-EVs exhibited a significantly higher proliferation-promoting effect on HUVECs compared to the HaCaT-EVs group, indicating that exosomes encapsulated in GelMA hydrogel can be partially released earlier and prolong their survival time in vitro. Overall, the cell proliferation trend of the GelMA group did not significantly differ from that of the control group, indicating good biocompatibility of the hydrogel without apparent toxicity.
Fig. 3.
Biocompatibility of GelMA hydrogel. Note: (A) Fluorescence microscopy observation of live/dead cell staining in different groups after 24 h of cell culture; scale bar: 200 μm; (B) Quantitative analysis of live/dead cell staining fluorescence; (C) CCK-8 assay evaluating the proliferation ability of HUVECs in different treatment groups. All quantitative data were expressed as mean ± standard deviation. Data in graph A is analyzed using one-way analysis of variance, while data in graph C is analyzed using two-way ANOVA to investigate differences among multiple groups. ** denotes P < 0.01 compared to the PBS group; # denotes P < 0.05 compared to the HaCaT-EVs group. All cell experiments were repeated three times
We then focused on whether the migration ability of HUVECs is influenced by GelMA-EVs. The transwell migration assay results showed an increased number of migrated HUVECs in both the HaCaT-EVs and GelMA-EVs groups relative to the respetive controls (Fig. 4A). The quantitative analysis revealed that the GelMA-EVs group exhibited a stronger effect than the HaCaT-EVs group (Fig. 4B). The wound healing assay, used to estimate the healing rate, showed a significant enhancement of HUVEC migration toward the scratched area after treatment with HaCaT-EVs and GelMA-EVs compared to the control group after 24 h (Fig. 4C). Images captured by inverted microscopy clearly showed a narrower wound width in the GelMA-EVs treated group, and quantitative analysis demonstrated a 70% increase in migration capacity relative to the control (Fig. 4D). The impact of GelMA hydrogel alone on cell migration was not significant.
Fig. 4.
Promotion of cell migration and angiogenesis by HaCaT-EVs in vitro. Note: (A) Transwell assay evaluating cell migration of HUVECs; scale bar: 100 μm; (B) Quantitative analysis of migrated cells; (C) Scratch healing results of HUVECs after 24 h of different treatments; the red line represents the boundary of the scratch, scale bar: 200 μm; (D) Quantitative analysis of wound closure rates; (E) Tube formation assay visualizing the formation of HUVEC capillary network; scale bar: 200 μm; (F) Quantitative analysis of tube formation; (G) mRNA expression levels of CD31, ANG-1, and VEGF. All quantitative data were expressed as mean ± standard deviation, and differences among multiple groups were analyzed using one-way ANOVA. ** denotes P < 0.01 compared to the PBS group; # denotes P < 0.05 compared to the HaCaT-EVs group. All cell experiments were repeated three times
To study the role of HaCaT-EVs in the angiogenesis of HUVECs, we analyzed the influence of GelMA-EVs on angiogenic activity through tube formation assays. As shown in Fig. 4E, the GelMA-EVs group produced more cord-like structures on Matrigel compared to the control group, demonstrating a stronger tube formation capability than the HaCaT-EVs group without hydrogel encapsulation (Fig. 4F).
To further validate the above results, we performed qRT-PCR to measure the mRNA expression levels of endothelial cell marker CD31 and angiogenesis-related genes (ANG-1 and VEGF) (Wu et al. 2021a, b). It was observed that GelMA-EVs treatment significantly upregulated the mRNA expression levels of CD31, ANG-1, and VEGF compared to the PBS group (Fig. 4G) and exhibited a more significant enhancement in mRNA expression compared to the HaCaT-EVs group. In conclusion, GelMA loaded with HaCaT-EVs can enhance in vitro angiogenesis more effectively, confirming its potential value in the treatment of diabetic skin ulcers.
Improved diabetic wound healing by GelMA-EVs: macroscopic and histological assessments
To assess the therapeutic effects of HaCaT-EVs on diabetic wound healing, we successfully established a diabetic mouse model by injecting STZ. Subsequently, full-thickness dermal wounds were created on the back of each mouse, followed by different treatment and macroscopic evaluation.
Figure 5A presents images of the skin wounds in diabetic mice from the four groups at days 0, 3, 7, and 14 after surgery. It can be observed that the wound areas in all treated groups significantly decreased after 14 days, whereas the control group exhibited slower wound healing throughout the experiment. Particularly, the GelMA-EVs group demonstrated the most remarkable wound-healing effect, where the wounds in diabetic mice were almost completely closed by day 14.
Fig. 5.
Acceleration of wound healing in diabetic mice by GelMA-EVs. Note: (A) Representative images of wound healing process at postoperative day 0, 3, 7, and 14 in STZ-treated mice; (B) Quantitative analysis of wound closure rate for the four groups; (C) H&E staining images of skin tissue at day 14, with unepithelialized area indicated by one-way arrow; scale bar: 100 μm; (D) Quantification of re-epithelialization of wounds; (E) Masson staining of skin tissue at day 14; (F) Quantitative analysis of collagen staining intensity. Scale bar: 100 μm. All quantitative data were expressed as mean ± standard deviation. Data in graph DF is analyzed using one-way analysis of variance, while data in graph B is analyzed using two-way ANOVA to investigate differences among multiple groups. ** denotes P < 0.01 compared to the PBS group; # denotes P < 0.05 compared to the HaCaT-EVs group, n = 6
Quantitative analysis of wound closure rate (Fig. 5B) confirmed that the GelMA-EVs group exhibited higher healing rates than the other groups throughout the entire healing process. Compared to HaCaT-EVs treatment, GelMA-EVs showed significant improvements in wound healing performance, indicating that GelMA hydrogel can promote the wound healing process through sustained release of HaCaT-EVs.
HE staining of the length and morphology of the wounds (Fig. 5C-D) revealed that the skin wound tissue treated with the GelMA-EVs group exhibited complete reepithelialization compared to the other groups. Although HaCaT-EVs also promoted wound healing, long-term release of HaCaT-EVs from GelMA hydrogel was more effective in enhancing wound healing and tissue reconstruction in diabetic skin ulcer mice. Masson staining further evaluated the maturity of collagen (Fig. 5E-F). The GelMA-EVs group showed a wider range of collagen deposition, indicating superior extracellular matrix (ECM) remodeling ability.
Insufficient neovascularization is a hallmark of diabetic wound pathology, limiting oxygen and nutrient delivery essential for repair. Endothelial cell recruitment and vessel formation are therefore critical for restoring tissue perfusion and promoting healing (Huang et al. 2020). In vitro experiments have demonstrated that GelMA-EVs possess potent angiogenic properties on HUVECs. However, it remains unclear whether GelMA-EVs would have a similar effect on wound vascularization in diabetic mice. Therefore, we conducted immunofluorescence staining analysis of the endothelial cell markers CD31 and α-smooth muscle actin (α-SMA) to assess vascularization near the wound area (Fig. 6A-B). It can be observed that the GelMA-EVs group exhibited significantly higher levels of CD31 and α-SMA positive-stained blood vessels compared to the other groups. Furthermore, blood vessels in the GelMA-EVs group were larger and displayed luminal structures. Comparatively, the HaCaT-EVs group showed higher relative densities of CD31 and α-SMA compared to the control group, indicating some therapeutic effect of HaCaT-EVs. However, due to the sustained release of EVs facilitated by GelMA hydrogel as a carrier, the therapeutic effects of GelMA-EVs were more significant. The fluorescence quantification data from the four groups also supported the results of the in vitro cell experiments, indicating that GelMA-EVs effectively enhanced vessel formation and successfully promoted vascularization in diabetic wounds.
Fig. 6.
GelMA-EVs accelerate neovascular formation in diabetic mice. Note: (A) Immunofluorescent triple staining of wound sections in four treatment groups, with CD31 (red) and DAPI (blue), followed by quantitative analysis of fluorescence intensity. Scale bar: 100 μm; (B) Immunofluorescent staining of a-SMA (green) and DAPI (blue), followed by quantitative analysis of fluorescence intensity. Scale bar: 100 μm; (C) mRNA expression levels of CD31, ANG-1, and VEGF. All quantitative data were expressed as mean ± standard deviation, and differences among multiple groups were analyzed using one-way ANOVA. ** indicates significant difference compared to the PBS group (P < 0.01); # indicates significant difference compared to the HaCaT-EVs group (P < 0.05); ## indicates significant difference compared to the HaCaT-EVs group (P < 0.01); n = 6
To further validate the above results, the expression of the endothelial cell marker CD31 and the angiogenesis-related genes ANG-1 and VEGF in skin tissues after different treatments were detected using qRT-PCR. It was found that the mRNA expression in the GelMA-EVs treatment group was notably upregulated compared to the PBS group (Fig. 6C). In summary, GelMA loaded with HaCaT-EVs can enhance vascularization in diabetic wounds more effectively, confirming its potential value in the treatment of diabetic skin ulcers.
PDGF modulates GelMA-EVs-mediated enhancement of HUVECs angiogenesis
In both in vitro and in vivo models, GelMA-EVs demonstrated superior therapeutic efficacy. To explore the molecular basis of this effect, total RNA from HUVECs co-cultured with GelMA-EVs was subjected to RNA sequencing. Among the DEGs, PDGF showed the most pronounced upregulation (Fig. 7A-B). Western blot analysis further validated this increase at the protein level (Fig. 7C). Previously, we observed elevated expression of angiogenic markers ANG-1 and VEGF in GelMA-EVs-treated groups. To elucidate the regulatory mechanism, we assessed the activation status of the PI3K/AKT pathway, a known mediator of PDGF-induced angiogenesis. This pathway is closely linked to enhanced endothelial cell migration, proliferation, and tube formation, as well as keratinocyte activation (Zhang et al. 2018a, b). Previous studies have confirmed that PDGF can promote endothelial cell survival through the PI3K/AKT pathway (Li et al. 2015) and facilitate re-endothelialization after vascular injury (Wang et al. 2012). However, whether PDGF can promote wound healing and vascular regeneration through the PI3K/AKT signaling pathway in GelMA-loaded EV therapy for diabetic patients with skin ulcers has not been demonstrated yet.
Fig. 7.
PDGF is a key gene involved in the promotion of HUVEC by GelMA-EVs. Note: (A) Heatmap analysis of cells treated with GelMA-EVs; (B) Volcano plot showing differentially expressed genes in cells treated with GelMA-EVs; (C) Western blot was performed to detect the protein expression level of PDGF. All quantitative data were expressed as mean ± standard deviation and analyzed using independent samples t-test for pairwise comparisons between experimental groups. ** indicates a significant difference compared to the NC group (P < 0.01); cell experiments were repeated 3 times
To clarify the role of PDGF in GelMA-EVs–mediated angiogenesis, HUVECs were transfected with sh-PDGF or control sh-NC prior to co-culture. qRT-PCR confirmed efficient PDGF knockdown (Fig. 8A). Western blot analysis revealed that GelMA-EVs markedly enhanced the expression of PDGF and phosphorylated PI3K, AKT, and mTOR in sh-NC-treated cells (Fig. 8B-C), while these effects were significantly diminished following sh-PDGF treatment, indicating suppression of the PI3K/AKT pathway. To further investigate whether the knockdown of PDGF also inhibits HUVEC proliferation, migration, and tube formation, we first examined changes in cell viability within 7 days using the CCK-8 assay (Fig. 8D). Transwell analysis further demonstrated reduced migration in the GelMA-EVs + sh-PDGF group compared to controls (Fig. 8E). Similarly, Matrigel-based tube formation was significantly inhibited following PDGF silencing, despite GelMA-EVs stimulation (Fig. 8F). Collectively, these results underscore PDGF as a pivotal upstream regulator of PI3K/AKT signaling in GelMA-EVs-enhanced angiogenesis.
Fig. 8.
PDGF activates the PI3K/AKT pathway, influencing the effects of GelMA-EVs. Note: (A) RT-qPCR analysis to detect the expression of PDGF in HUVEC; (B) Western blot was performed to assess the phosphorylation levels of PDGH and PI3K in HUVEC treated under different conditions; (C) Western blot was performed to assess the protein expression levels of AKT and mTOR phosphorylation in HUVEC treated under different conditions; (D) CCK-8 assay was used for quantitative analysis of cell viability; (E) Cell migration and quantitative analysis of HUVEC under different treatments. Scale bar: 200 μm; (F) Tube formation image and quantitative analysis of HUVEC under different treatments. Scale bar: 200 μm. All quantitative data were expressed as mean ± standard deviation, and differences among multiple groups were analyzed using one-way ANOVA. For panel D, data at different time points were analyzed using two-way ANOVA ** indicates significant difference compared to the sh-NC group (P < 0.01); # indicates significant difference compared to the GelMA-EVs + sh-NC group (P < 0.05); ## indicates significant difference compared to the GelMA-EVs + sh-NC group (P < 0.01); cell experiments were repeated 3 times
GelMA-EVs regulate PDGF-mediated PI3K/AKT pathway for enhanced wound healing
In vitro experiments have shown that GelMA-EVs promote proliferation, migration, and tubule formation of HUVECs through the PI3K/AKT pathway. In order to further investigate the effect of GelMA-EVs on wound healing in diabetic mice via the regulation of the PI3K/AKT pathway by platelet-derived growth factor (PDGF) in vivo, we performed injections near the wounds of diabetic mice using sh-PDGF. Western blot experiments revealed (Figure S2A-B) that compared to the wounds injected with only sh-NC, the wounds injected with GelMA-EVs + sh-NC exhibited a notable elevation in PDGF protein as well as the phosphorylation levels of PI3K, AKT, and mTOR. However, after the injection of sh-PDGF, there was a significant reversal in the protein expression levels of the PI3K/AKT pathway-related factors.
To further study the impact of sh-PDGF inhibitor on wound healing in diabetic mice, we collected images of the injured skin of the mice at postoperative days 0, 3, 7, and 14 (Fig. 9A). The observations showed that administration of sh-PDGF significantly inhibited wound healing compared to the GelMA-EVs + sh-NC group. Histological analyses supported the functional impairment induced by PDGF silencing. H&E staining revealed reduced epithelial regeneration and keratin coverage in the GelMA-EVs + sh-PDGF group compared to sh-NC controls (Fig. 9B). Similarly, Masson staining demonstrated diminished collagen deposition following PDGF knockdown, contrasting with the broader and more mature collagen matrix observed in the GelMA-EVs + sh-NC group (Fig. 9C).
Fig. 9.
PDGF is a key gene for promoting wound healing in diabetic mice by GelMA-EVs. Note: (A) Representative images of diabetic mouse wounds and wound closure rates; (B) Day 14, H&E staining images of skin tissue and quantitative analysis of wound re-epithelialization. Scale bar: 100 μm; (C) Day 14, Masson staining of skin tissue and quantitative analysis of collagen staining intensity. Scale bar: 100 μm; (D) Immunofluorescent triple staining of wound sections in treated groups, with CD31 (red) and DAPI (blue), followed by quantitative analysis of fluorescence intensity. Scale bar: 100 μm; (E) Immunofluorescent staining of a-SMA (green) and DAPI (blue), followed by quantitative analysis of fluorescence intensity. Scale bar: 100 μm. Continuous variables were expressed as mean ± standard deviation. For panel A, data at different time points were analyzed using one-way ANOVA, while other multiple group comparisons were performed using two-way ANOVA. ** indicates significant difference compared to the sh-NC group (P < 0.01); # indicates significant difference compared to the GelMA-EVs + sh-NC group (P < 0.05); ## indicates significant difference compared to the GelMA-EVs + sh-NC group (P < 0.01); n = 6
From the results of the in vitro experiments, it can be observed that inhibiting PDGF expression can affect the promotion of blood vessel formation by GelMA-EVs on HUVECs. Therefore, immunofluorescence staining was performed on endothelial cell marker protein CD31 and α-smooth muscle actin (α-SMA), and quantification analysis was conducted on neovascularization (Fig. 9D-E). Compared to the GelMA-EVs + sh-NC group, the injection of sh-PDGF resulted in a significant decrease in the density of CD31 and α-SMA positive stained blood vessels in the skin wound tissue of mice. The fluorescence quantification analysis data also supported the results of the in vitro cell experiments, indicating that inhibiting PDGF expression could suppress the tubule formation effect of GelMA-EVs.
Overall, the experimental results demonstrate that GelMA-EVs promote wound healing in diabetic mice by activating the PI3K/AKT pathway through PDGF.
Discussion
The diabetic skin ulcer caused by diabetes is a long-standing and unresolved medical challenge, with a complex healing process often influenced by various factors in the diabetic environment (Holl et al. 2021; Greenhalgh 2003). In this context, numerous researchers have been devoted to exploring effective treatment strategies, but methods that can be widely applied in clinical settings are still scarce. This study, based on an innovative therapeutic approach, aims to investigate in depth the mechanism by which GelMA hydrogel loaded with keratinocyte-derived EVs can promote vascular reconstruction and wound healing in diabetic patients with skin ulcers by regulating PDGF mRNA through the PI3K/Akt pathway. Our experiments and data analysis suggest that this treatment strategy has potential in multiple aspects while also proposing directions and challenges for future research.
GelMA hydrogel has attracted increasing attention due to its excellent cell affinity and biocompatibility (Ju et al. 2023; Klotz et al. 2016). Compared to the previous use of matrices and growth factors, GelMA not only provides a platform to mimic the natural cell environment but also promotes cell–cell interactions, thus accelerating wound healing (Samandari et al. 2021; Hu et al. 2023; Wang et al. 2022). In the treatment of diabetic ulcers, vascularization strategies are particularly crucial because the vascular regenerative ability of diabetic patients is impaired (Zhang et al. 2022). By combining GelMA with keratinocyte-derived EVs, this study further optimizes the pre-vascularization effect, demonstrating significant differences and advantages compared to previous strategies.
EVs, as a means of communication between cells, are increasingly recognized for their role in the wound-healing process (Lu et al. 2022; Liao et al. 2023). These small vesicles contain various bioactive substances, such as RNA and proteins, which can directly interact with cells in damaged tissues, activating their repair mechanisms (Rippe 2021; Neu et al. 2020). Compared to other ingredients used in previous studies, keratinocyte-derived EVs have unique advantages, enabling more accurate treatments specifically targeting the environment of skin ulcers (Herrmann et al. 2021; Casado-Díaz et al. 2020).
Firstly, we successfully established a PDGF knockdown cell line, which provides an effective tool for studying the role of PDGF in wound healing. By knocking down the PDGF gene, we can simulate the situation of reduced PDGF and evaluate its impact on cell behavior and healing speed. This step is crucial in the study, as PDGF, as a growth factor, plays an important role in angiogenesis and wound healing. Secondly, we successfully prepared GelMA hydrogel and used it as a carrier to deliver keratinocyte-derived EVs. The EVs can be released from the GelMA hydrogel for a long time, achieving long-term treatment of the wound. Controlled, sustained release allows for spatially and temporally regulated EV delivery, which has demonstrated significant advantages in maintaining cell viability, promoting functional expression, and supporting tissue regeneration. This approach helps to avoid the risks associated with burst release, such as localized EV over- or under-dosing. It ensures that EVs are maintained at an effective concentration over time, thereby continuously promoting cell migration and angiogenesis (Cedillo-Servin et al. 2023). In contrast, burst release may lead to an initial surge in EV exposure, followed by a rapid decline, which compromises therapeutic outcomes (Goreninskii et al. 2023).
In the in vitro experiments, we observed that GelMA hydrogel loaded with keratinocyte-derived EVs significantly promoted cell proliferation, migration, and wound healing speed. This effect is believed to be linked to the activation of the PI3K/Akt pathway (Fig. 10), which is crucial in cell survival, proliferation, and migration. Therefore, our study has not only obtained preliminary validation at the experimental level but also provided initial clues to the mechanism of the treatment strategy.
Fig. 10.
Mechanism of GelMA hydrogel loaded with HaCaT-EVs in promoting wound healing in diabetic mice
However, we also recognize the limitations of the study. Firstly, although the results of in vitro experiments are encouraging, and we also observed significant effects in animal models, there are many differences between animal models and humans. Therefore, further verification of the safety and effectiveness of this strategy is needed in clinical trials. Moreover, although mesenchymal stem cell-derived EVs (MSC-Exos) are known to promote tissue repair processes such as angiogenesis and collagen synthesis (Bicer 2024; Zhao et al. 2023), EVs from senescent MSCs may carry pro-senescent signals (e.g., miR-497, RAB27B protein), potentially contributing to"senescence drift."Regulatory changes in senescent cells may alter EV composition, especially their size and molecular cargo. As a result, senescent EVs may carry unpredictable mixtures of growth factors and cytokines. These biomolecules can exert dual effects—inducing senescence in recipient cells and initiating a pro-inflammatory “domino effect” in the tissue microenvironment, ultimately leading to chronic inflammation (Smirnova et al. 2023). Finally, more in-depth research on the molecular mechanism of the PI3K/Akt signaling pathway is required to fully understand its role in the healing process. In the future, we hope to push this research into more in-depth areas. Firstly, we will continue to explore the mechanisms of PDGF, especially how it affects cell behavior and wound healing through the PI3K/Akt pathway.
In conclusion, this study primarily focuses on the reconstruction of microvascular networks, and further exploration of other mechanisms related to diabetic ulcers can be conducted in the future. This field still has untapped potential, and we will strive to provide more choices for the management of diabetic skin ulcers, improve the quality of life for patients, and alleviate the burden on healthcare. At the same time, we hope that this research can provide new treatment ideas for other chronic wound-healing problems and contribute to the development of the medical field. The field of skin ulcer treatment is challenging but filled with hope, and we will continue to explore the path forward.
Supplementary Information
Below is the link to the electronic supplementary material.
Supplementary file1 Figure S1. Characterization of GelMA hydrogel and GelMA-EVs. Note: (A) GelMA hydrogel and GelMA-EVs exhibit a colorless and transparent appearance; (B) The stress-strain curve of the composite hydrogel; (C) Swelling ratio of the hydrogel in PBS (pH 7.2) at 37°C. Cell experiments were performed in triplicate. (JPG 432 KB)
Supplementary file2 Figure S2. PDGF is a key gene for activating the PI3K/AKT pathway in diabetic mice treated with GelMA-EVs. Note: (A) Western blot analysis of the phosphorylation levels of PDGH and PI3K in different treatment groups; (B) Western blot analysis of the protein expression levels of AKT and mTOR phosphorylation in different treatment groups. All quantitative data were expressed as mean ± standard deviation, and differences among multiple groups were analyzed using two-way ANOVA. ** indicates significant difference compared to the sh-NC group (P < 0.01); ## indicates significant difference compared to the GelMA-EVs+sh-NC group (P < 0.01); n = 6 (JPG 755 KB)
Acknowledgements
None.
Authors’ Contribution
Qian Li: Conceptualization, methodology, and investigation; performed the isolation of extracellular vesicles (EVs) and conducted in vivo experiments. Leilei Zhou: Contributed to methodology and data analysis; performed the in vitro assays, including tube formation and proliferation assays, and assisted in the interpretation of results. Wenqiang Li: Participated in the design of the study and data analysis; conducted the immunohistochemical staining and histological assessments. Weiheng Zhao: Provided critical feedback on the study design and analysis; assisted in manuscript writing and revisions. Weimin Chen: Assisted with the analysis of transcriptome sequencing data and contributed to the discussion section of the manuscript. Mohammed S. AlQranei: Supervised the overall research project and contributed to the interpretation of results; played a role in manuscript revision. Jiarui Bi: Conducted the bioinformatics analysis and interpretation of gene expression data; contributed to the visualization of results. Ping Huang: Conceptualized the study and oversaw the research direction; assisted in writing and revising the manuscript. All authors read and approved the final manuscript.
Funding
No funding was received for this study.
Data availability
The datasets generated and analyzed during the current study are available from the corresponding author on reasonable request.
Declarations
Ethical approval
All experiments involving mice were approved by the Animal Ethics Committee of Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technolog.
Conflict of interest
The authors declare no competing interests.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Qian Li, Leilei Zhou, and Wenqiang Li have contributed equally to this work.
References
- Bicer M. Revolutionizing dermatology: harnessing mesenchymal stem/stromal cells and exosomes in 3D platform for skin regeneration. Arch Dermatol Res. Springer Science and Business Media LLC; 2024. Available from: 10.1007/s00403-024-03055-4 [DOI] [PMC free article] [PubMed]
- Born LJ, McLoughlin ST, Dutta D, Mahadik B, Jia X, Fisher JP, et al. Sustained released of bioactive mesenchymal stromal cell‐derived extracellular vesicles from 3D‐printed gelatin methacrylate hydrogels. J Biomedical Materials Res. Wiley; 2022; p. 1190–8. Available from: 10.1002/jbm.a.37362 [DOI] [PMC free article] [PubMed]
- Boukamp P, Petrussevska RT, Breitkreutz D, Hornung J, Markham A, Fusenig NE. Normal keratinization in a spontaneously immortalized aneuploid human keratinocyte cell line.. The Journal of cell biology. Rockefeller University Press; 1988; p. 761–71. Available from: 10.1083/jcb.106.3.761 [DOI] [PMC free article] [PubMed]
- Buzas EI, György B, Nagy G, Falus A, Gay S. Emerging role of extracellular vesicles in inflammatory diseases. Nat Rev Rheumatol. Springer Science and Business Media LLC; 2014; p. 356–64. Available from: 10.1038/nrrheum.2014.19 [DOI] [PubMed]
- Casado-Díaz A, Quesada-Gómez JM, Dorado G. Extracellular Vesicles Derived From Mesenchymal Stem Cells (MSC) in Regenerative Medicine: Applications in Skin Wound Healing. Front. Bioeng. Biotechnol. Frontiers Media SA; 2020; Available from: 10.3389/fbioe.2020.00146 [DOI] [PMC free article] [PubMed]
- Cedillo-Servin G, Louro AF, Gamelas B, Meliciano A, Zijl A, Alves PM, et al. Microfiber-reinforced hydrogels prolong the release of human induced pluripotent stem cell-derived extracellular vesicles to promote endothelial migration. Biomaterials Advances. Elsevier BV; 2023; p. 213692. Available from: 10.1016/j.bioadv.2023.213692 [DOI] [PubMed]
- Chen C-Y, Rao S-S, Ren L, Hu X-K, Tan Y-J, Hu Y, et al. Exosomal DMBT1 from human urine-derived stem cells facilitates diabetic wound repair by promoting angiogenesis. Theranostics. Ivyspring International Publisher; 2018. p. 1607–23. Available from: 10.7150/thno.22958 [DOI] [PMC free article] [PubMed]
- Chen Z, Wang L, Guo C, Qiu M, Cheng L, Chen K, et al. Vascularized polypeptide hydrogel modulates macrophage polarization for wound healing. Acta Biomaterialia. Elsevier BV; 2023. p. 218–34. Available from: 10.1016/j.actbio.2022.11.002 [DOI] [PubMed]
- Dai X, Xie Y, Dong M. Cancer-associated fibroblasts derived extracellular vesicles promote angiogenesis of colorectal adenocarcinoma cells through miR-135b-5p/FOXO1 axis. Cancer Biology & Therapy. Informa UK Limited; 2022. p. 76–88. Available from: 10.1080/15384047.2021.2017222 [DOI] [PMC free article] [PubMed]
- Deng Y, Li Y, Chu Z, Dai C, Ge J. Exosomes from umbilical cord-derived mesenchymal stem cells combined with gelatin methacryloyl inhibit vein graft restenosis by enhancing endothelial functions. J Nanobiotechnol. Springer Science and Business Media LLC; 2023. Available from: 10.1186/s12951-023-02145-1 [DOI] [PMC free article] [PubMed]
- Frykberg RG, Zgonis T, Armstrong DG, Driver VR, Giurini JM, Kravitz SR, et al. Diabetic Foot Disorders: A Clinical Practice Guideline (2006 Revision). The Journal of Foot and Ankle Surgery. Elsevier BV; 2006. p. S1–66. Available from: 10.1016/s1067-2516(07)60001-5 [DOI] [PubMed]
- Gao W, Yuan L, Zhang Y, Huang F, Gao F, Li J, et al. miR-1246-overexpressing exosomes suppress UVB-induced photoaging via regulation of TGF-β/Smad and attenuation of MAPK/AP-1 pathway. Photochem Photobiol Sci. Springer Science and Business Media LLC; 2022. p. 135–46. Available from: 10.1007/s43630-022-00304-1 [DOI] [PubMed]
- Glady A, Tanaka M, Moniaga CS, Yasui M, Hara-Chikuma M. Involvement of NADPH oxidase 1 in UVB-induced cell signaling and cytotoxicity in human keratinocytes. Biochemistry and Biophysics Reports. Elsevier BV; 2018. p. 7–15. Available from: 10.1016/j.bbrep.2018.03.004 [DOI] [PMC free article] [PubMed]
- Glady A, Vandebroek A, Yasui M. Human keratinocyte-derived extracellular vesicles activate the MAPKinase pathway and promote cell migration and proliferation in vitro. Inflamm Regener. Springer Science and Business Media LLC; 2021. Available from: 10.1186/s41232-021-00154-x [DOI] [PMC free article] [PubMed]
- Golchin A, Hosseinzadeh S, Ardeshirylajimi A. The exosomes released from different cell types and their effects in wound healing. J of Cellular Biochemistry. Wiley; 2018. p. 5043–52. Available from: 10.1002/jcb.26706 [DOI] [PubMed]
- Gong M, Wang M, Xu J, Yu B, Wang Y-G, Liu M, et al. Nano-Sized Extracellular Vesicles Secreted from GATA-4 Modified Mesenchymal Stem Cells Promote Angiogenesis by Delivering Let-7 miRNAs. Cells. MDPI AG; 2022. p. 1573. Available from: 10.3390/cells11091573 [DOI] [PMC free article] [PubMed]
- Goreninskii S, Volokhova A, Frolova A, Buldakov M, Cherdyntseva N, Choynzonov E, et al. Prolonged and Controllable Release of Doxorubicin Hydrochloride from the Composite Electrospun Poly(ε-Caprolactone)/Polyvinylpyrrolidone Scaffolds. Journal of Pharmaceutical Sciences. Elsevier BV; 2023. p. 2752–5. Available from: 10.1016/j.xphs.2023.08.025 [DOI] [PubMed]
- Greenhalgh DG. Wound healing and diabetes mellitus. Clinics in Plastic Surgery. Elsevier BV; 2003. p. 37–45. Available from: 10.1016/s0094-1298(02)00066-4 [DOI] [PubMed]
- Guan P, Liu C, Xie D, Mao S, Ji Y, Lin Y, et al. Exosome-loaded extracellular matrix-mimic hydrogel with anti-inflammatory property Facilitates/promotes growth plate injury repair. Bioactive Materials. Elsevier BV; 2022. p. 145–58. Available from: 10.1016/j.bioactmat.2021.09.010 [DOI] [PMC free article] [PubMed]
- Han C, Yang J, Sun J, Qin G. Extracellular vesicles in cardiovascular disease: Biological functions and therapeutic implications. Pharmacology & Therapeutics. Elsevier BV; 2022. p. 108025. Available from: 10.1016/j.pharmthera.2021.108025 [DOI] [PMC free article] [PubMed]
- Heebkaew N, Promjantuek W, Chaicharoenaudomrung N, Phonchai R, Kunhorm P, Soraksa N, et al. Encapsulation of HaCaT Secretome for Enhanced Wound Healing Capacity on Human Dermal Fibroblasts. Mol Biotechnol. Springer Science and Business Media LLC; 2023. p. 44–55. Available from: 10.1007/s12033-023-00732-z [DOI] [PubMed]
- Herrmann IK, Wood MJA, Fuhrmann G. Extracellular vesicles as a next-generation drug delivery platform. Nat. Nanotechnol. Springer Science and Business Media LLC; 2021. p. 748–59. Available from: 10.1038/s41565-021-00931-2 [DOI] [PubMed]
- Holl J, Kowalewski C, Zimek Z, Fiedor P, Kaminski A, Oldak T, et al. Chronic Diabetic Wounds and Their Treatment with Skin Substitutes. Cells. MDPI AG; 2021. p. 655. Available from: 10.3390/cells10030655 [DOI] [PMC free article] [PubMed]
- Hu H, Dong L, Bu Z, Shen Y, Luo J, Zhang H, et al. miR‐23a‐3p‐abundant small extracellular vesicles released from Gelma/nanoclay hydrogel for cartilage regeneration. J of Extracellular Vesicle. Wiley; 2020. Available from: 10.1080/20013078.2020.1778883 [DOI] [PMC free article] [PubMed]
- Hu N, Cai Z, Jiang X, Wang C, Tang T, Xu T, et al. Hypoxia-pretreated ADSC-derived exosome-embedded hydrogels promote angiogenesis and accelerate diabetic wound healing. Acta Biomaterialia. Elsevier BV; 2023. p. 175–86. Available from: 10.1016/j.actbio.2022.11.057 [DOI] [PubMed]
- Huang P, Bi J, Owen GR, Chen W, Rokka A, Koivisto L, et al. Keratinocyte Microvesicles Regulate the Expression of Multiple Genes in Dermal Fibroblasts. Journal of Investigative Dermatology. Elsevier BV; 2015. p. 3051–9. Available from: 10.1038/jid.2015.320 [DOI] [PubMed]
- Huang X, Liang P, Jiang B, Zhang P, Yu W, Duan M, et al. Hyperbaric oxygen potentiates diabetic wound healing by promoting fibroblast cell proliferation and endothelial cell angiogenesis. Life Sciences. Elsevier BV; 2020. p. 118246. Available from: 10.1016/j.lfs.2020.118246 [DOI] [PubMed]
- Huldani H, Kozlitina IA, Alshahrani M, Daabo HMA, Almalki SG, Oudaha KH, et al. Exosomes derived from adipose stem cells in combination with hyaluronic acid promote diabetic wound healing. Tissue and Cell. Elsevier BV; 2023. p. 102252. Available from: 10.1016/j.tice.2023.102252 [DOI] [PubMed]
- Ibrahim R, Mndlovu H, Kumar P, Adeyemi SA, Choonara YE. Cell Secretome Strategies for Controlled Drug Delivery and Wound-Healing Applications. Polymers. MDPI AG; 2022. p. 2929. Available from: 10.3390/polym14142929 [DOI] [PMC free article] [PubMed]
- Ju Y, Hu Y, Yang P, Xie X, Fang B. Extracellular vesicle-loaded hydrogels for tissue repair and regeneration. Materials Today Bio. Elsevier BV; 2023. p. 100522. Available from: 10.1016/j.mtbio.2022.100522 [DOI] [PMC free article] [PubMed]
- Klotz BJ, Gawlitta D, Rosenberg AJWP, Malda J, Melchels FPW. Gelatin-Methacryloyl Hydrogels: Towards Biofabrication-Based Tissue Repair. Trends in Biotechnology. Elsevier BV; 2016. p. 394–407. Available from: 10.1016/j.tibtech.2016.01.002 [DOI] [PMC free article] [PubMed]
- Levett PA, Melchels FPW, Schrobback K, Hutmacher DW, Malda J, Klein TJ. A biomimetic extracellular matrix for cartilage tissue engineering centered on photocurable gelatin, hyaluronic acid and chondroitin sulfate. Acta Biomaterialia. Elsevier BV; 2014. p. 214–23. Available from: 10.1016/j.actbio.2013.10.005 [DOI] [PubMed]
- Li D, Wu N. Mechanism and application of exosomes in the wound healing process in diabetes mellitus. Diabetes Research and Clinical Practice. Elsevier BV; 2022. p. 109882. Available from: 10.1016/j.diabres.2022.109882 [DOI] [PubMed]
- Li L, Xu M, Li X, Lv C, Zhang X, Yu H, et al. Platelet-Derived Growth Factor-B (PDGF-B) Induced by Hypoxia Promotes the Survival of Pulmonary Arterial Endothelial Cells through the PI3K/Akt/Stat3 Pathway. Cell Physiol Biochem. S. Karger AG; 2015. p. 441–51. Available from: 10.1159/000369709 [DOI] [PubMed]
- Li X, Zhang D, Yu Y, Wang L, Zhao M. Umbilical cord‐derived mesenchymal stem cell secretome promotes skin regeneration and rejuvenation: From mechanism to therapeutics. Cell Proliferation. Wiley; 2023. Available from: 10.1111/cpr.13586 [DOI] [PMC free article] [PubMed]
- Liao Y, Zhang Z, Ouyang L, Mi B, Liu G. Engineered Extracellular Vesicles in Wound Healing: Design, Paradigms, and Clinical Application. Small. Wiley; 2023. Available from: 10.1002/smll.202307058 [DOI] [PubMed]
- Liu J, Lichtenberg T, Hoadley KA, Poisson LM, Lazar AJ, Cherniack AD, et al. An Integrated TCGA Pan-Cancer Clinical Data Resource to Drive High-Quality Survival Outcome Analytics. Cell. Elsevier BV; 2018. p. 400–416.e11. Available from: 10.1016/j.cell.2018.02.052 [DOI] [PMC free article] [PubMed]
- Liu Z, Guo S, Dong L, Wu P, Li K, Li X, et al. A tannic acid doped hydrogel with small extracellular vesicles derived from mesenchymal stem cells promotes spinal cord repair by regulating reactive oxygen species microenvironment. Materials Today Bio. Elsevier BV; 2022. p. 100425. Available from: 10.1016/j.mtbio.2022.100425 [DOI] [PMC free article] [PubMed]
- Long X, Yuan Q, Tian R, Zhang W, Liu L, Yang M, et al. Efficient healing of diabetic wounds by MSC-EV-7A composite hydrogel via suppression of inflammation and enhancement of angiogenesis. Biomater. Sci. Royal Society of Chemistry (RSC); 2024. p. 1750–60. Available from: 10.1039/d3bm01904g [DOI] [PubMed]
- Lu J, Liu Q-H, Wang F, Tan J-J, Deng Y-Q, Peng X-H, et al. Exosomal miR-9 inhibits angiogenesis by targeting MDK and regulating PDK/AKT pathway in nasopharyngeal carcinoma. J Exp Clin Cancer Res. Springer Science and Business Media LLC; 2018. Available from: 10.1186/s13046-018-0814-3 [DOI] [PMC free article] [PubMed]
- Lu S, Lu L, Liu Y, Li Z, Fang Y, Chen Z, et al. Native and engineered extracellular vesicles for wound healing. Front. Bioeng. Biotechnol. Frontiers Media SA; 2022. Available from: 10.3389/fbioe.2022.1053217 [DOI] [PMC free article] [PubMed]
- Lu W, Zeng M, Liu W, Ma T, Fan X, Li H, et al. Human urine-derived stem cell exosomes delivered via injectable GelMA templated hydrogel accelerate bone regeneration. Materials Today Bio. Elsevier BV; 2023. p. 100569. Available from: 10.1016/j.mtbio.2023.100569 [DOI] [PMC free article] [PubMed]
- Luo A, Zhou X, Shi X, Zhao Y, Men Y, Chang X, et al. Exosome-derived miR-339–5p mediates radiosensitivity by targeting Cdc25A in locally advanced esophageal squamous cell carcinoma. Oncogene. Springer Science and Business Media LLC; 2019. p. 4990–5006. Available from: 10.1038/s41388-019-0771-0 [DOI] [PubMed]
- Maas SLN, Breakefield XO, Weaver AM. Extracellular Vesicles: Unique Intercellular Delivery Vehicles. Trends in Cell Biology. Elsevier BV; 2017. p. 172–88. Available from: 10.1016/j.tcb.2016.11.003 [DOI] [PMC free article] [PubMed]
- Martí-Carvajal AJ, Gluud C, Nicola S, Simancas-Racines D, Reveiz L, Oliva P, et al. Growth factors for treating diabetic foot ulcers. Cochrane Database of Systematic Reviews. Wiley; 2015. Available from: 10.1002/14651858.cd008548.pub2 [DOI] [PMC free article] [PubMed]
- Martin P. Wound Healing--Aiming for Perfect Skin Regeneration. Science. American Association for the Advancement of Science (AAAS); 1997. p. 75–81. Available from: 10.1126/science.276.5309.75 [DOI] [PubMed]
- Modaresifar K, Hadjizadeh A, Niknejad H. Design and fabrication of GelMA/chitosan nanoparticles composite hydrogel for angiogenic growth factor delivery. Artificial Cells, Nanomedicine, and Biotechnology. Informa UK Limited; 2017. p. 1–10. Available from: 10.1080/21691401.2017.1392970 [DOI] [PubMed]
- Neu CT, Gutschner T, Haemmerle M. Post-Transcriptional Expression Control in Platelet Biogenesis and Function. IJMS. MDPI AG; 2020. p. 7614. Available from: 10.3390/ijms21207614 [DOI] [PMC free article] [PubMed]
- Ogurtsova K, da Rocha Fernandes JD, Huang Y, Linnenkamp U, Guariguata L, Cho NH, et al. IDF Diabetes Atlas: Global estimates for the prevalence of diabetes for 2015 and 2040. Diabetes Research and Clinical Practice. Elsevier BV; 2017. p. 40–50. Available from: 10.1016/j.diabres.2017.03.024 [DOI] [PubMed]
- Pessolano E, Belvedere R, Bizzarro V, Franco P, De Marco I, Petrella F, et al. Annexin A1 Contained in Extracellular Vesicles Promotes the Activation of Keratinocytes by Mesoglycan Effects: An Autocrine Loop Through FPRs. Cells. MDPI AG; 2019. p. 753. Available from: 10.3390/cells8070753 [DOI] [PMC free article] [PubMed]
- Pomatto M, Gai C, Negro F, Cedrino M, Grange C, Ceccotti E, et al. Differential Therapeutic Effect of Extracellular Vesicles Derived by Bone Marrow and Adipose Mesenchymal Stem Cells on Wound Healing of Diabetic Ulcers and Correlation to Their Cargoes. IJMS. MDPI AG; 2021. p. 3851. Available from: 10.3390/ijms22083851 [DOI] [PMC free article] [PubMed]
- Pop MA, Almquist BD. Biomaterials: A potential pathway to healing chronic wounds?. Experimental Dermatology. Wiley; 2017. p. 760–3. Available from: 10.1111/exd.13290 [DOI] [PMC free article] [PubMed]
- Qi L, Lu Y, Wang Z, Zhang G. microRNA‐106b derived from endothelial cell–secreted extracellular vesicles prevents skin wound healing by inhibiting JMJD3 and RIPK3. J Cellular Molecular Medi. Wiley; 2021. p. 4551–61. Available from: 10.1111/jcmm.16037 [DOI] [PMC free article] [PubMed]
- Ren S, Chen J, Guo J, Liu Y, Xiong H, Jing B, et al. Exosomes from Adipose Stem Cells Promote Diabetic Wound Healing through the eHSP90/LRP1/AKT Axis. Cells. MDPI AG; 2022. p. 3229. Available from: 10.3390/cells11203229 [DOI] [PMC free article] [PubMed]
- Rippe K. Liquid–Liquid Phase Separation in Chromatin. Cold Spring Harb Perspect Biol. Cold Spring Harbor Laboratory; 2021. p. a040683. Available from: 10.1101/cshperspect.a040683 [DOI] [PMC free article] [PubMed]
- Samandari M, Alipanah F, Majidzadeh-A K, Alvarez MM, Trujillo-de Santiago G, Tamayol A. Controlling cellular organization in bioprinting through designed 3D microcompartmentalization. Applied Physics Reviews. AIP Publishing; 2021. Available from: 10.1063/5.0040732 [DOI] [PMC free article] [PubMed]
- Sjöqvist S, Imafuku A, Gupta D, EL Andaloussi S. Correction to: Isolation and Characterization of Extracellular Vesicles from Keratinocyte Cultures. Methods in Molecular Biology. New York, NY: Springer US; 2019. p. 293–293. Available from: 10.1007/7651_2019_274 [DOI] [PubMed]
- Smirnova A, Yatsenko E, Baranovskii D, Klabukov I. Mesenchymal stem cell-derived extracellular vesicles in skin wound healing: the risk of senescent drift induction in secretome-based therapeutics. Military Med Res. Springer Science and Business Media LLC; 2023. Available from: 10.1186/s40779-023-00498-0 [DOI] [PMC free article] [PubMed]
- Wan L, He Y, Wang A, Pan J, Xu C, Fu D, et al. Development of an integrated device utilizing exosome-hyaluronic acid-based hydrogel and investigation of its osteogenic and angiogenic characteristics. Materials & Design. Elsevier BV; 2024. p. 112565. Available from: 10.1016/j.matdes.2023.112565
- Wang C, Wang M, Xu T, Zhang X, Lin C, Gao W, et al. Engineering Bioactive Self-Healing Antibacterial Exosomes Hydrogel for Promoting Chronic Diabetic Wound Healing and Complete Skin Regeneration. Theranostics. Ivyspring International Publisher; 2019. p. 65–76. Available from: 10.7150/thno.29766 [DOI] [PMC free article] [PubMed]
- Wang G, Jin S, Huang W, Li Y, Wang J, Ling X, et al. LPS-induced macrophage HMGB1-loaded extracellular vesicles trigger hepatocyte pyroptosis by activating the NLRP3 inflammasome. Cell Death Discov. Springer Science and Business Media LLC; 2021a. Available from: 10.1038/s41420-021-00729-0 [DOI] [PMC free article] [PubMed]
- Wang G, Ma K, Zhang Y, Hu Z, Liu L, Lu J, et al. Platelet microparticles contribute to aortic vascular endothelial injury in diabetes via the mTORC1 pathway. Acta Pharmacol Sin. Springer Science and Business Media LLC; 2018. p. 468–76. Available from: 10.1038/s41401-018-0186-4 [DOI] [PMC free article] [PubMed]
- Wang H, Yin Y, Li W, Zhao X, Yu Y, Zhu J, et al. Over-Expression of PDGFR-β Promotes PDGF-Induced Proliferation, Migration, and Angiogenesis of EPCs through PI3K/Akt Signaling Pathway. PLoS ONE. Public Library of Science (PLoS); 2012. p. e30503. Available from: 10.1371/journal.pone.0030503 [DOI] [PMC free article] [PubMed]
- Wang J, Wu H, Peng Y, Zhao Y, Qin Y, Zhang Y, et al. Hypoxia adipose stem cell-derived exosomes promote high-quality healing of diabetic wound involves activation of PI3K/Akt pathways. J Nanobiotechnol. Springer Science and Business Media LLC; 2021b. Available from: 10.1186/s12951-021-00942-0 [DOI] [PMC free article] [PubMed]
- Wang Y, Cao Z, Wei Q, Ma K, Hu W, Huang Q, et al. VH298-loaded extracellular vesicles released from gelatin methacryloyl hydrogel facilitate diabetic wound healing by HIF-1α-mediated enhancement of angiogenesis. Acta Biomaterialia. Elsevier BV; 2022. p. 342–55. Available from: 10.1016/j.actbio.2022.05.018 [DOI] [PubMed]
- Wei F, Wang A, Wang Q, Han W, Rong R, Wang L, et al. Plasma endothelial cells-derived extracellular vesicles promote wound healing in diabetes through YAP and the PI3K/Akt/mTOR pathway. Aging. Impact Journals, LLC; 2020. p. 12002–18. Available from: 10.18632/aging.103366 [DOI] [PMC free article] [PubMed]
- Wilson VG. Growth and Differentiation of HaCaT Keratinocytes. Methods in Molecular Biology. New York, NY: Springer New York; 2013. p. 33–41. Available from: 10.1007/7651_2013_42 [DOI] [PubMed]
- Wu D, Chang X, Tian J, Kang L, Wu Y, Liu J, et al. Bone mesenchymal stem cells stimulation by magnetic nanoparticles and a static magnetic field: release of exosomal miR-1260a improves osteogenesis and angiogenesis. J Nanobiotechnol. Springer Science and Business Media LLC; 2021a. Available from: 10.1186/s12951-021-00958-6 [DOI] [PMC free article] [PubMed]
- Wu K, He C, Wu Y, Zhou X, Liu P, Tang W, et al. Preservation of Small Extracellular Vesicle in Gelatin Methacryloyl Hydrogel Through Reduced Particles Aggregation for Therapeutic Applications. IJN. Informa UK Limited; 2021b. p. 7831–46. Available from: 10.2147/ijn.s334194 [DOI] [PMC free article] [PubMed]
- Wu Y, Wu X, Wang J, Chen S, Chen H, Liu J, et al. Fibroblast-Derived Extracellular Vesicle-Packaged Long Noncoding RNA Upregulated in Diabetic Skin Enhances Keratinocyte MMP-9 Expression and Delays Diabetic Wound Healing. Laboratory Investigation. Elsevier BV; 2023. p. 100019. Available from: 10.1016/j.labinv.2022.100019 [DOI] [PubMed]
- Xia W, Lai G, Li Y, Zeng C, Sun C, Zhang P, et al. Photo-crosslinked adhesive hydrogel loaded with extracellular vesicles promoting hemostasis and liver regeneration. Front. Bioeng. Biotechnol. Frontiers Media SA; 2023. Available from: 10.3389/fbioe.2023.1170212 [DOI] [PMC free article] [PubMed]
- Yang J, Chen Z, Pan D, Li H, Shen J. <p>Umbilical Cord-Derived Mesenchymal Stem Cell-Derived Exosomes Combined Pluronic F127 Hydrogel Promote Chronic Diabetic Wound Healing and Complete Skin Regeneration</p>. IJN. Informa UK Limited; 2020. p. 5911–26. Available from: 10.2147/ijn.s249129 [DOI] [PMC free article] [PubMed]
- Yu L, Qin J, Xing J, Dai Z, Zhang T, Wang F, et al. The mechanisms of exosomes in diabetic foot ulcers healing: a detailed review. J Mol Med. Springer Science and Business Media LLC; 2023. p. 1209–28. Available from: 10.1007/s00109-023-02357-w [DOI] [PubMed]
- Yuan M, Liu K, Jiang T, Li S, Chen J, Wu Z, et al. GelMA/PEGDA microneedles patch loaded with HUVECs-derived exosomes and Tazarotene promote diabetic wound healing. J Nanobiotechnol. Springer Science and Business Media LLC; 2022. Available from: 10.1186/s12951-022-01354-4 [DOI] [PMC free article] [PubMed]
- Zhang B, Wu X, Zhang X, Sun Y, Yan Y, Shi H, et al. Human Umbilical Cord Mesenchymal Stem Cell Exosomes Enhance Angiogenesis Through the Wnt4/β-Catenin Pathway. Stem Cells Translational Medicine. Oxford University Press (OUP); 2015. p. 513–22. Available from: 10.5966/sctm.2014-0267 [DOI] [PMC free article] [PubMed]
- Zhang J, Zhang J, Zhang C, Zhang J, Gu L, Luo D, et al. Diabetic Macular Edema: Current Understanding, Molecular Mechanisms and Therapeutic Implications. Cells. MDPI AG; 2022. p. 3362. Available from: 10.3390/cells11213362 [DOI] [PMC free article] [PubMed]
- Zhang K, Zhao X, Chen X, Wei Y, Du W, Wang Y, et al. Enhanced Therapeutic Effects of Mesenchymal Stem Cell-Derived Exosomes with an Injectable Hydrogel for Hindlimb Ischemia Treatment. ACS Appl. Mater. Interfaces. American Chemical Society (ACS); 2018a. p. 30081–91. Available from: 10.1021/acsami.8b08449 [DOI] [PubMed]
- Zhang W, Bai X, Zhao B, Li Y, Zhang Y, Li Z, et al. Cell-free therapy based on adipose tissue stem cell-derived exosomes promotes wound healing via the PI3K/Akt signaling pathway. Experimental Cell Research. Elsevier BV; 2018b. p. 333–42. Available from: 10.1016/j.yexcr.2018.06.035 [DOI] [PubMed]
- Zhao H, Li Z, Wang Y, Zhou K, Li H, Bi S, et al. Bioengineered MSC-derived exosomes in skin wound repair and regeneration. Front. Cell Dev. Biol. Frontiers Media SA; 2023. Available from: 10.3389/fcell.2023.1029671 [DOI] [PMC free article] [PubMed]
- Zhou L, Meng H, Guo W, Liu F, Hu Z, Ren X, et al. Anthocyanidin-Loaded Superabsorbent Self-Pumping Dressings for Macrophage Immunomodulation and Diabetic Wound Healing. ACS Appl. Mater. Interfaces. American Chemical Society (ACS); 2024. p. 41949–59. Available from: 10.1021/acsami.4c09902 [DOI] [PubMed]
- Zhou Z, Guo C, Sun X, Ren Z, Tao J. Extracellular Vesicles Secreted by TGF-β1-Treated Mesenchymal Stem Cells Promote Fracture Healing by SCD1-Regulated Transference of LRP5. Stem Cells International. Wiley; 2023. p. 1–17. Available from: 10.1155/2023/4980871 [DOI] [PMC free article] [PubMed]
- Zhu D, Hu Y, Kong X, Luo Y, Zhang Y, Wu Y, et al. Enhanced burn wound healing by controlled-release 3D ADMSC-derived exosome-loaded hyaluronan hydrogel. Regenerative Biomaterials. Oxford University Press (OUP); 2024. Available from: 10.1093/rb/rbae035 [DOI] [PMC free article] [PubMed]
- Zhu W, Dong Y, Xu P, Pan Q, Jia K, Jin P, et al. A composite hydrogel containing resveratrol-laden nanoparticles and platelet-derived extracellular vesicles promotes wound healing in diabetic mice. Acta Biomaterialia. Elsevier BV; 2022. p. 212–30. Available from: 10.1016/j.actbio.2022.10.038 [DOI] [PubMed]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supplementary file1 Figure S1. Characterization of GelMA hydrogel and GelMA-EVs. Note: (A) GelMA hydrogel and GelMA-EVs exhibit a colorless and transparent appearance; (B) The stress-strain curve of the composite hydrogel; (C) Swelling ratio of the hydrogel in PBS (pH 7.2) at 37°C. Cell experiments were performed in triplicate. (JPG 432 KB)
Supplementary file2 Figure S2. PDGF is a key gene for activating the PI3K/AKT pathway in diabetic mice treated with GelMA-EVs. Note: (A) Western blot analysis of the phosphorylation levels of PDGH and PI3K in different treatment groups; (B) Western blot analysis of the protein expression levels of AKT and mTOR phosphorylation in different treatment groups. All quantitative data were expressed as mean ± standard deviation, and differences among multiple groups were analyzed using two-way ANOVA. ** indicates significant difference compared to the sh-NC group (P < 0.01); ## indicates significant difference compared to the GelMA-EVs+sh-NC group (P < 0.01); n = 6 (JPG 755 KB)
Data Availability Statement
The datasets generated and analyzed during the current study are available from the corresponding author on reasonable request.











