Essential role of hepcidin in host resistance to disseminated candidiasis

SUMMARY

Candida albicans is a leading cause of life-threatening invasive infection despite antifungal therapy. Patients with chronic liver disease are at increased risk of candidemia, but the mechanisms underlying this susceptibility are incompletely defined. One consequence of chronic liver disease is an attenuated ability to produce hepcidin and maintain organismal control of iron homeostasis. To address the biology underlying this critical clinical problem, we demonstrate the mechanistic link between hepcidin insufficiency and candida infection using genetic and inducible hepcidin knockout mice. Hepcidin deficiency led to unrestrained fungal growth and increased transition to the invasive hypha morphology with exposed 1,3-β-glucan, which exacerbated kidney injury, independent of the fungal pore-forming toxin candidalysin in immunocompetent mice. Of translational relevance, the therapeutic administration of PR-73, a hepcidin mimetic, improved the outcome of infection. Thus, we identify hepcidin deficiency as a host susceptibility factor against C. albicans and hepcidin mimetics as a potential intervention.

Graphical Abstract

In brief

Arekar et al. demonstrate that the hepatic hormone hepcidin is essential for resistance to disseminated candidiasis. Hepcidin deficiency and associated iron overload result in inexorable fungal growth and unrestricted hyphal transformation with exposed 1,3-β-glucan to drive organ pathology independent of candidalysin. This is rescued by a synthetic hepcidin mimetic.

INTRODUCTION

Candida albicans is a commensal fungus and, in >80% of the population, a part of the normal flora of the gut microbiota.^1,2 Its transition from commensalism to pathogenicity remains the predominant cause of invasive candidiasis,^3–7 with up to 40% mortality despite antifungal therapy.⁸ A defining feature of C. albicans pathogenicity is its transition from yeast to invasive hyphae that cause tissue damage via candidalysin (encoded by the ECE1 gene).^9,10 Candidalysin is a secreted peptide toxin that destabilizes the plasma membrane of host cells, promoting inflammation and necrotic cell death.^11,12 Candidalysin triggers innate epithelial immune responses via EGFR-ERK1/2-c-Fos and p38 to trigger the secretion of cytokines and alarmins from the infected cells to recruit and activate host immunity.¹³ Autopsies of patients with disseminated candidiasis and animal models^14–21 have revealed the kidneys as a major target of infection; the reasons are incompletely understood. For patients with a high risk of dissemination, The Infectious Diseases Society of America guidelines recommend imaging the kidneys to exclude abscesses, fungal balls, or urologic abnormality.²² However, while the risk of systemic candidiasis and clinical outcomes vary significantly,^23,24 host-related risk factors and associated mechanisms are incompletely defined. Thus, host susceptibility factors that promote or limit fungal growth must be identified to complement the current complement of antifungal drugs.

Iron is an essential micronutrient for host physiology^25,26 as well as a nutrient and virulence factor for C. albicans.^27–35 Iron supplementation increases the resistance of C. albicans to antifungal agents.³⁶ Injecting mice with iron preparations worsens outcomes,^37,38 and impaired iron acquisition of C. albicans reduces the capacity to damage epithelial cells.³⁹ Collectively, these studies identify iron as a crucial component for C. albicans^32,40 and support the notion that a dysregulated host iron metabolism may increase susceptibility to disseminated candidiasis. However, the current understanding of host iron content as a susceptibility factor to candida infections is based on supraphysiological injections of iron preparations in animals and, thus, lack clinical relevance.

Systemic iron metabolism is regulated primarily by the hepcidinferroportin axis. Hepcidin binds to and triggers the internalization of ferroportin, a transmembrane protein that transfers intracellular iron to the plasma.^41,42 As a part of the evolutionarily conserved nutritional immunity,⁴³ hepcidin-mediated ferroportin degradation attenuates the rate of entry of iron into plasma and extracellular fluid,^44,45 allowing transferrin to remove non-transferrin-bound iron, an iron species that is highly bioavailable to microbes and stimulates their rapid growth.^46–48 The HAMP gene encodes hepcidin and is mainly produced by hepatocytes.^44,49,50 While hepcidin production is exquisitely sensitive to iron levels, HAMP transcription is also induced by microbial sensing by pattern recognition receptors or cytokines like interleukin-1β (IL-1β), IL-6, or IL-22^49,51,52 in a STAT3-dependent manner.^51,53,54

Hepatic hepcidin levels increase after intravenous infection with C. albicans,⁵¹ suggesting that the host activates an iron-withholding program during systemic candidiasis. Candidiasis is the most common fungal infection in chronic liver disease patients and those undergoing liver transplants.^55–58 However, the mechanisms underlying this increased susceptibility are incompletely defined.

In this study, we identify the essential role of hepcidin in host defense against C. albicans in immunocompetent mice. We demonstrate the ability of iron to change fungal wall composition and exacerbate inflammation in hepcidin-deficient mice infected with a candidalysin-deficient C. albicans strain that cannot elicit a response in wild-type littermates. We uncover hepcidin-induced iron sequestration as an essential host defense mechanism against the fungal pathogen C. albicans and show that treatment of susceptible mice with a hepcidin agonist attenuates fungus-induced kidney pathology.

RESULTS

Clinical implications: Liver fibrosis attenuates hepcidin production and is associated with renal iron overload

To access the translational relevance of our study, we measured the hepatic hepcidin transcripts and serum hepcidin levels in patients with liver diseases (including alpha-1 antitrypsin disease, alcohol-induced cirrhosis, and cirrhosis due to hepatitis B and C virus infection). Compared to control individuals, liver hepcidin transcripts and serum hepcidin levels were significantly lower in patients with chronic liver disease (Figures 1A and 1B). We then asked whether liver disease-induced loss of hepcidin changes tissue iron distribution. C57BL/6 mice injected with carbon tetrachloride (CCl₄) developed severe liver fibrosis (Figures 1C and 1D), and this was associated with attenuated liver Hamp gene expression (Figure 1E) and intra-cellular iron deposition in the kidneys (Figures 1F and 1G). Given the conserved role of hepcidin in humans and mice, we anticipate that patients with chronic liver disease may accumulate iron in their kidneys, rendering them susceptible to bloodstream candida infections.

Figure 1. CLD attenuates hepcidin production and is associated with renal iron accumulation: Implications for human candidiasis and disease.

Compared to patients without liver disease, hepatic hepcidin gene expression and serum hepcidin levels are attenuated in patients with CLD (A and B). 8- to 10-week-old C57BLK/6 mice were injected intraperitoneally with 0.3% CCl₄ or vehicle (corn oil) at a dose of 10 μL/g of body weight twice weekly for 5 weeks and euthanized. Compared to vehicle, picrosirius red staining of the CCl₄ -injected livers revealed extensive fibrosis with multiple fibrotic septa and divided hepatic lobules (C and D). Scale bar: 50 μM. The intra-hepatic hepcidin gene expression was significantly attenuated in fibrotic livers (E). The kidneys of the vehicle- and CCl₄ -treated mice were stained for Perl’s detectable iron deposits. Perl’s detectable iron deposits were not observed in vehicle-treated kidneys (F). However, following CCl₄ treatment, blue Perl’s detectable iron deposits were observed in the renal tubules (G). Scale bar: 30 μM. Arrows denote the edge of the section. Each point represents a patient. A 2-tailed Mann-Whitney test determined statistical significance, plotted as mean ± SEM. **p < 0.005, ***p < 0.001.

Hepcidin is required for resistance to C. albicans infection

To determine whether hepcidin deficiency and associated tissue iron overload are risk factors in disseminated candidiasis, we compared outcomes of infection between Hamp^−/− mice and their littermate (wild-type [WT]) controls. Under physiological conditions, the splenic red pulp of WT mice accumulated iron, whereas the kidneys were devoid of iron deposits. (Figures S1A and S1C). In contrast, the splenic red pulp of Hamp^−/− mice was iron depleted, and the kidneys were iron overloaded (Figures S1B and S1D). Most of the iron was observed in the corticomedullary junction and extended to the deep cortex, and the majority of the iron was deposited in the tubular compartment with little to none in the glomerular or interstitial regions (Figure S1E). To test the hypothesis that hepcidin deficiency-associated renal iron accumulation worsens the outcome of disseminated candidiasis, WT or Hamp^−/− mice were intravenously injected with SC5314 yeast cells. The Hamp^−/− mice were moribund by days 2–3 post infection, whereas their WT littermates survived for 6 days (Figure 2A). To avoid mortality in Hamp^−/− mice, the dose of infection was halved (Figure 2B). Twenty hours post infection, we did not detect candida in the bloodstream of WT and Hamp^−/− mice (Figures S2A and S2B), which agrees with a previous report.²¹ However, 72 h post infection, unlike WT littermates, Hamp^−/− mice were lethargic and moribund, and we observed 10%–20% mortality in all experiments. Compared to WT mice, the renal and liver fungal burden was significantly higher in Hamp^−/− mice (Figures 2C–2F and S2C). In contrast, the iron-sufficient WT spleens had a significantly higher fungal burden than the iron-deficient Hamp^−/− spleens (Figures 2G and S2D). C. albicans in the WT kidneys was predominantly in yeast-pseudohypha forms (Figure 2H) but had undergone pronounced hyphal transformation in Hamp^−/− mice (Figure 2I), indicating increased virulence.⁵⁹ Periodic acid Schiff staining did not reveal obvious pathology in the spleen and liver of WT and Hamp^−/− mice (Figure S2E). Together, this demonstrates that hepcidin deficiency increases kidney susceptibility to C. albicans.

Figure 2. Hepcidin deficiency worsens outcomes of disseminated candidiasis.

12-week-old littermates (WT) and Hamp−/− mice were intravenously infected with 4 × 10⁵ C. albicans (SC5314). On day 3 post infection, 10% mortality was observed in WT mice, whereas all Hamp−/− mice died. The WT mice reached a similar endpoint by day 6 (A). To reduce mortality, mice were intravenously injected with 2 × 10⁵ C. albicans, and tissues were harvested 3 days later (B). Compared to WT mice, iron-overloaded Hamp^−/− mice had a significantly higher fungal burden in the kidneys (C–E) and liver (F). In contrast, the iron-sufficient WT spleens harbored significantly more fungal colonies than iron-deficient Hamp^−/− spleens (G). Experiments were performed twice with n = 8–9 each time, and data from a representative experiment are shown. The data were significant each time. A 2-tailed Mann-Whitney test determined statistical significance. Data are presented as mean ± SEM. *p < 0.05, **p < 0.001, ***p < 0.0001. Grocott methenamine silver staining revealed that the fungus in the WT kidney was predominantly in yeast-pseudohypha form (H) but had undergone a hyphal transformation in the Hamp^−/− kidneys (I). Representative images are shown. Scale bars: 100 and 30 μM.

Kidney iron provides a local microenvironment for the accelerated growth and virulence of C. albicans

Based on these observations, we evaluated whether the kidney iron content could accelerate the growth of C. albicans. Naive C57BL/6 kidneys were cultured 48 h with or without ferric ammonium citrate as an iron source, lysed, and inoculated with C. albicans yeast to assess fungal growth. C. albicans growth increased linearly with increased iron content of the kidney lysates (Figure S3A). Since renal proximal tubular epithelial cells (PTECs) participate in iron recycling,⁶⁰ and most of the iron in Hamp^−/− mice accumulates in the renal tubules, we loaded HK-2 cells, a human PTEC line, with or without ferric chloride, as described previously⁶¹ (Figures S3B and S3C), and exposed them to C. albicans for 24 h. When the culture supernatants from both conditions were spiked with an equal number of C. albicans yeast cells, there was significantly higher fungal growth in the supernatant of iron-loaded HK-2 cells (Figure S3D). To determine whether iron played a role in promoting the virulence of C. albicans, the fungus was grown in enriched yeast nitrogen broth and supplemented with or without iron, as described by Tripathi et al.³⁶ (Figures S3E and S3H). Independent of the medium’s iron content, under a hypha-inducing temperature (37°C), C. albicans underwent a yeast-to-hypha transition in 3 h (Figures S3F and S3I). However, 24 h later, only the high-iron medium sustained the hyphal morphotype (Figures S3G and S3J). Collectively, these data show that the kidney iron content promotes the growth of C. albicans and sustains it in its invasive hyphal form.

Increased fungal burden and hypha formation in Hamp^−/− mice worsen renal inflammation and acute kidney injury

The increased fungal burden and prominent hypha formation in Hamp^−/− mice were associated with tubular necrosis and increased immune cell infiltration (Figures 3A–3D). C. albicans infection also significantly compromised renal function, as illustrated by increased plasma creatinine levels, and injured the proximal renal tubules, as indicated by increased Ngal and Kim1 expression in the kidneys of Hamp^−/− mice (Figures 3E–3G). Thus, Hamp^−/− mice develop more severe acute kidney injury (AKI) following disseminated candidiasis. In the Hamp^−/− kidneys, there was widespread distribution of the fungal hyphae in the corticomedullar region (the region between the two yellow circles) and the deep cortex (the region outside the larger yellow circle) (Figure 3H). In contrast, the renal medulla (the region between the smaller yellow circle and black circle) and the pelvis/papilla (the region inside the black circle) had limited fungal growth (Figure 3H). The fungal growth was predominantly observed in the iron-rich regions in the Hamp^−/− kidneys (the corticomedullary region [the region between the two yellow circles] and the deep cortex [the region outside the larger yellow circle]) (Figure 3I).The gene expression of intra-renal inflammatory cytokines such as TNFα, IL-1β, and IL-6 positively correlated with the extent of AKI (Figures S2F–S2H). To rule out that the increased fungal burden and hyphal formation observed in Hamp^−/− mice were due to impaired production of chemoattractants and leukocyte infiltration, we measured the intra-renal gene expression of chemoattractants like Csf3 (neutrophils), Ccl2, and Cxcl11 (monocytes) and analyzed kidney-infiltrating leukocytes by flow cytometry. Uninfected WT and Hamp^−/− mice had comparable gene expression of Csf3, Ccl2, and Cxcl11 (Figures 3J–3L). C. albicans infection increased the gene expression of all of the above chemoattractants in WT mice, which were further significantly amplified in Hamp^−/− mice (Figures 3J–3L). Neutrophil and monocyte numbers in uninfected WT and Hamp^−/− kidneys were comparable (Figures 3M and 3N; gating strategy in Figure S4). After infection, neutrophil and monocyte numbers significantly increased in WT mice (Figures 3M and 3N). However, compared to infected WT mice, both cell types were significantly increased in infected Hamp^−/− mice (Figures 3M and 3N).

Figure 3. C. albicans exacerbates AKI and inflammation in hepcidin knockout mice.

WT and Hamp^−/− mice were infected with 2e⁵ C. albicans yeast, and tissues were harvested 3 days later. 10% formalin-fixed kidney slices were used for histopathology. Hematoxylin and eosin (H&E) staining revealed that, compared to WT kidneys (A and B), the Hamp^−/− kidneys had more tubular epithelial cell necrosis (dark pink fragmented cytoplasm with no nuclei), with casts, luminal debris, and multiple foci of inflammation (C and D) Scale bars: 100 μM (A and C) and 50 μM (B and D). Markers of kidney injury and inflammation were comparable in naive WT and Hamp^−/− mice. Post infection, AKI, measured by plasma creatinine and the proximal tubular injury markers Ngal and Kim1, was exacerbated in Hamp^−/− mice (E–G). Grocott’s methenamine silver staining of the infected Hamp^−/− kidneys revealed widespread distribution of fungal hyphae, most of which were in the corticomedullar region (the region between the two yellow circles) and the deep cortex (the region outside the larger yellow circle). In contrast, the renal medulla (the region between the smaller yellow circle and black circle) and the pelvis/papilla (the region inside the black circle) had limited fungal growth (H). The region of fungal growth correlated well with the iron-loaded regions of the Hamp^−/− kidneys: the corticomedullary region (the region between the two yellow circles) and the deep cortex (the region outside the larger yellow circle) (I). Scale bar: 30 μM. Naive WT and Hamp^−/− mice had comparable intra-renal gene expression of chemoattractants such as Csf3 (J) Ccl2 (K), and Cxcl11 (L). C. albicans significantly increased the expression of all three chemoattractants in the WT kidneys, which were further significantly elevated in Hamp^−/− kidneys (J–L). The immune infiltrates composed of neutrophils (M) and monocytes (N) showed the same trend. Experiments were performed twice with n = 8–9 each time, and data from a representative experiment are shown. The data were significant each time. Data were analyzed using two-way ANOVA with HolmŠídák’s multiple comparisons test and represented as mean ± SEM. *p < 0.05, **p < 0.005, ***p < 0.001. ****p < 0.0001.

Hyphal transformation in the hepcidin knockout mice is associated with cell death and loss of kidney parenchyma

Hyphal transformation of C. albicans is associated with the expression of ECE1 (extent of cell elongation 1),⁶² a core filamentation gene expressed under the most hypha-inducing conditions.⁶³ ECE1 codes for the Ece1 polyprotein, the precursor to candidalysin, a pore-forming cytolytic toxin.^9,12 Unlike during WT kidney infection, high levels of ECE1 gene expression were observed in the infected Hamp^−/− kidneys (Figure 4A). Active penetration or induced endocytosis by viable WT C. albicans hyphae damages epithelial cells via necrosis,^11,64 and interactions with macrophages induce candidalysin-mediated pyroptosis.^65,66 Indeed, in infected Hamp^−/− kidneys, the expression of ECE1 was associated with increased gene expression of GsdmD encoding gasdermin D, a key factor of pyroptosis, and mixed-lineage kinase domain-like protein (Mlkl; necroptosis), both indicative of inflammatory forms of cell death (Figures 4B and 4C).

Figure 4. Expression of Ece1 correlates with cell death, inflammation, and loss of renal parenchyma.

3 day post C. albicans infection, the kidneys of WT and Hamp^−/− mice were analyzed for expression of the fungal gene Ece1. Ece1 gene expression was observed only in the Hamp^−/− kidneys (A). Cell death markers were comparable in naive WT and Hamp^−/− kidneys (B and C). GsdmD (pyroptosis) and Mlkl (necrosis) gene expression were not significantly induced in the infected WT kidneys (B and C). However, the infected Hamp^−/− kidneys significantly upregulated the expression of GsdmD and Mlkl (B and C). Experiments were performed twice with n = 8–9 each time, and data from a representative experiment are shown. The data were significant each time. Data were analyzed using 2-way ANOVA with Holm-Šídák’s multiple-comparisons test and represented as mean ± SEM. *p < 0.05, **p < 0.005, ***p < 0.001, ****p < 0.0001. Proximal tubular epithelial cells (PTECs) are the most abundant epithelial cells in the kidneys. Lotus tetragonolobus lectin (LTL) staining, a marker for PTECs, revealed a uniform distribution throughout the infected WT kidneys (D) (the red arrow indicates the edge of the section). However, infected Hamp^−/− kidneys presented with multiple sections devoid of LTL-positive PTECs, indicating loss of kidney parenchyma (E). Scale bars:100 μM (D and E).

Immunofluorescence staining of PTECs revealed an even distribution of PTECs in the infected WT kidneys (Figure 4D). However, large areas of infected Hamp^−/− kidneys were devoid of PTECs (Figure 4E, white dotted circle), indicating loss of renal parenchyma.

Hepcidin deficiency in immunocompetent mice induces AKI independent of candidalysin

To delineate the contribution of excessive fungal burden and examine a mechanism for pathology, we first examined the impact of candidalysin. We infected WT and Hamp^−/− mice with C. albicans lacking the ability to produce candidalysin (ECE1 null mutants: ece1Δ/Δ).^9,67 Compared to WT mice, the ece1Δ/Δ strain proliferated significantly more and underwent hyphal transformation in Hamp^−/− mice (Figures 5A–5D). This was associated with significantly greater renal injury and immune cell infiltration (Figures 5E–5H). While the fungal burden and hypha formation in Hamp^−/− mice infected with either ece1Δ/Δ or an ece1Δ revertant strain (ece1ΔΔ+ECE1, with similar virulence to SC5314)^9,68 were comparable (Figure 5B), the ece1Δ/Δstrain induced significantly less renal injury and inflammation (Figures 5E–5H), indicating that candidalysin dictates the extent of kidney pathology. However, unlike published literature on leukopenic mice infected with the ece1Δ/Δ strain,⁶⁹ our data identify that hepcidin deficiency in an immunocompetent animal still increases fungal burden, hypha formation, and kidney pathology independent of candidalysin.

Figure 5. Hepcidin deficiency drives fungal burden, but the severity of AKI depends on candidalysin.

WT and Hamp^−/− mice were infected with 2e⁵ Ece1-deficient C. albicans yeast (ece1ΔΔ), and the kidneys were harvested on day 3. Compared to WT kidneys, the fungal burden was significantly higher in the Hamp^−/− kidneys (A and B) and was comparable to Hamp^−/− kidneys infected with an isogenic strain sufficient for candidalysin (ece1ΔΔ + ECE1) (B). The ece1ΔΔ C. albicans had undergone a hyphal transformation in Hamp^−/− kidneys, and histology showed multiple foci of infection, which were not observed in WT kidneys (C and D). Scale bars: 10×, 100 μM (C); 40×, 40 μM (D). Compared to WT mice, ece1ΔΔ strain-infected Hamp^−/− mice developed significantly more AKI, as measured by plasma creatinine and intra-renal Ngal gene expression (E and F). AKI was exacerbated by the ece1ΔΔ + ECE1 strain (E and F). Compared to WT kidneys, ece1ΔΔ infected Hamp^−/− kidneys had significantly greater neutrophil and monocyte infiltrates (G and H). However, both immune cell types were significantly lower than ece1ΔΔ + ECE1 infected Hamp^−/− kidneys (G and H). Data from two independent experiments were pooled and analyzed (n = 9–10) using 2-way ANOVA with Holm-Šídák’s multiple-comparisons test and are represented as mean ± SEM. *p < 0.05, **p < 0.005, ***p < 0.001, ****p < 0.0001.

Iron exposes fungal β-glucan and promotes inflammation in the absence of candidalysin

To mechanistically identify how the ece1Δ/Δ strain was still able to induce kidney injury in Hamp^−/− mice, we characterized ece1ΔΔ+ECE1 revertant and ece1Δ/Δ mutant cells grown under standard conditions or in the presence of high iron. Under standard growth conditions, both the fungal strains grew similarly and maintained their yeast form. However, iron-rich broth sustained hyphal morphogenesis and exposed 1, 3-β-glucan on the cell surface of both strains (Figures 6A–6D). These observations were validated in vivo using WT and Hamp^−/− mice infected with red fluorescent C. albicans (CAF2–1-dTomato).⁷⁰ Whole-kidney homogenates of WT mice infected with the CAF2–1-dTomato strain revealed yeast and occasional red fluorescent hyphae with exposed 1,3-β-glucan (Figures 6E, 6G, and 6I). In contrast, the infected kidney homogenates of Hamp^−/−mice had significantly more yeast cells and hyphae showing higher levels of exposed 1,3-β-glucan (Figures 6F, H and 6I). Next, we evaluated the effect of iron-exposed ece1Δ/Δ yeast cells on HK-2 cells (a human renal PTEC line) under hypha-forming conditions (37°C). Two hours after co-culture, the yeast cells transformed into hyphae, and the HK-2 cells secreted IL-8 in response to ece1Δ/Δ cultured under both conditions (Figure 6J), indicating recognition of the fungus. However, fungal cells cultured under high-iron conditions induced significantly higher IL-8 secretion both 2 and 4 h post infection as compared to cells grown under standard conditions (Figure 6J). Thus, iron-induced changes in C. albicans elicit a greater inflammatory response from renal parenchymal cells independent of candidalysin. The ece1Δ/Δ subcultures grown in HK-2 medium with or without iron under hypha-forming conditions (37°C) grew comparably and ruled out increased fungal burden as a cause of higher IL-8 secretion (Figure 6K). These in vitro studies shed light on the observed differences in renal pathology of WT and Hamp^−/− mice infected with candidalysin-deficient C. albicans cells.

Figure 6. Iron exposes fungal β-glucan to potentiate chemokine production in human proximal renal tubular cells independent of candidalysin.

Ece1 knockout C. albicans yeast (ece1ΔΔ) and its isogenic candidalysin revertant (ece1ΔΔ + ECE1) were grown in standard or iron-rich medium (100 μM FeCl₃, equivalent to serum iron content of Hamp^−/− mice) for 24 h and stained for exposed β-glucan and concanavalin A. Both fungal strains remained as yeast in the standard medium and did not expose β-glucan (A and B). However, adding iron to the growth medium transformed and sustained both ece1ΔΔ and ece1ΔΔ + ECE1 in their hyphal form with exposed β-glucans (C and D). Scale bar: 100 μM. Experiments were performed 3 times each with 3 technical repeats. Representative images from one of the experiments are shown. For in vivo detection and quantification of exposed 1,3-β-glucan, WT and Hamp^−/− mice were intravenously infected with 200,000 red fluorescent C. albicans (CAF2–1-dTomato). After 3 days, whole-kidney homogenates were analyzed for fungal cells with exposed 1,3-β-glucan. Infected WT kidneys revealed red yeast and occasional hyphae with exposed 1,3-β-glucan (E and G). In contrast, the infected kidney digests of Hamp^−/− mice had more red-fluorescent hyphae with exposed 1,3-β-glucan (green) (F and H). Scale bars: 20×, 100 μM (E and F) and 100×, 30 μM (F and H). For quantifying fungi with exposed 1,3-β-glucan, five random 20× images from each slide (n = 5 from each strain) were captured. Each dot represents the number of yellow fungi within an image. Individual values are plotted with standard deviation (I). A 2-tailed Mann-Whitney test was used to determine statistical significance. ***p < 0.0001. ece1ΔΔ C. albicans was grown overnight in standard or iron-rich medium (100 μM FeCl₃) at 33°C and then co-cultured with HK-2 cells at an MOI of 1:3 (cells:fungus) at 37°C. Compared to ece1ΔΔ C. albicans grown in standard medium, that grown in iron-rich medium induced significantly more IL-8 secretion (J). Data were normalized to IL-8 secreted by naive cells at each time point. The growth of ece1ΔΔ C. albicans originally grown in standard and iron-rich medium and subsequently in HK-2 medium was followed at 37°C for 4 h. There was no significant difference between the growth rate of the fungus under the two conditions (K). Experiments were performed twice each with 3 technical replicates each time, and the data were pooled for analysis. A 2-tailed Mann-Whitney test determined statistical significance at each time point, plotted as mean ± SEM. *p < 0.05, **p < 0.001.

Acute hepcidin deficiency worsens C. albicans-induced pyelonephritis and can be rescued by a synthetic hepcidin agonist

To evaluate the effect of acute, adult-onset hepcidin deficiency on outcomes of C. albicans infections, we used transgenic mice with tamoxifen-sensitive conditional Hamp1 deletion (iHamp^−/−) mice.⁷¹ These mice grow to adulthood with normal iron stores and serum iron parameters. However, upon exposure to tamoxifen, Hamp1 is irreversibly deleted, leading to iron overload in the serum, followed by the liver.⁷¹ Compared to littermates, hepcidin production was suppressed following tamoxifen administration (Figures S5A and S5B). As described previously, hepcidin deficiency was sufficient to deplete iron stores from the splenic red pulp (Figures S5C and S5D). This study identifies that acute hepcidin deficiency is sufficient to initiate kidney iron loading (Figures S5E and S5F). Following tamoxifen treatment and C. albicans infection, serum hepcidin increased in littermate controls (Figures 7A and 7B). However, tamoxifen-induced deletion of the Hamp gene in iHamp^−/− mice failed to elicit the antifungal hepcidin response. Compared to littermates, the renal fungal burden on day 4 post infection was significantly higher in iHamp^−/− mice (Figures 7C and 7D) and associated with hypha formation in the kidneys (Figures 7E and 7F) and increased tubular injury (Figure 7H). To evaluate the importance of early hepcidin activity for resistance to C. albicans infection, we injected iHamp^−/− mice post infection with mini-hepcidin (PR73, a synthetic hepcidin mimetic). Mini-hepcidin has greater potency and a longer-lasting effect than full-length hepcidin.⁷² Daily administration of mini-hepcidin significantly decreased the renal fungal burden (Figures 7C and 7D). Histology revealed a few inflammatory foci and hyphae (Figure 7G, black dotted circle) in mini-hepcidin-treated mice. However, these were markedly less compared to vehicle controls. Less fungal burden was associated with attenuated PTEC injury, as measured by intra-renal Ngal gene expression (Figure 7H).

Figure 7. Acute hepcidin deficiency exacerbates C. albicans-induced renal pathology and is attenuated by PR-73, a synthetic hepcidin mimetic.

Inducible hepcidin knockout mice (iHamp^−/−) and their WT littermates were injected with tamoxifen (A). Tamoxifen injection did not attenuate serum hepcidin levels in WT mice, which increased significantly post C. albicans infection (B). In contrast, tamoxifen significantly attenuated serum hepcidin levels in iHamp^−/− mice, which remained low after C. albicans infection (B). Statistical significance was determined by a 2-tailed Wilcoxon matched-pair sign rank test, plotted as mean ± SEM. ***p < 0.001, ****p < 0.0001. WT littermates and iHamp^−/− mice were injected with tamoxifen and C. albicans. A cohort of iHamp^−/− mice received vehicle or PR-73 (50 nmol, intraperitoneal) starting 4 h after Candida infection (C). Compared to WT littermates, the kidneys of vehicle-treated iHamp^−/− mice had a significantly higher fungal burden, which was significantly reduced by PR-73 therapy (D). The fungus was still in the yeast form in the WT littermates (E) but had undergone a hyphal transformation in the vehicle-treated iHamp^−/− mice (F). PR-73 treatment was associated with a reduction in hyphal morphogenesis (G). Reduced fungal burden and hyphal transformation in PR-73 treated iHamp^−/− mice mitigated PTEC injury, as measured by renal Ngal gene expression (H). Data from two independent experiments were pooled and analyzed (n = 10) using 2-way ANOVA with Holm-Šídák’s multiple-comparisons test and represented as mean ± SEM. *p < 0.05, **p < 0.005, ****p < 0.0001. Scale bars: 100 and 30 μM (E–G).

DISCUSSION

Here, we identify an essential role of hepcidin in resistance to systemic C. albicans infections. We show that hepcidin deficiency and associated kidney iron assimilation worsen the outcome of disseminated candidiasis. Mechanistically, renal iron overload (1) promotes inexorable fungal growth, (2) sustains hyphal morphogenesis, and (3) exposes fungal wall components such as 1,3-β-glucan to trigger inflammation and tissue injury independent of candidalysin in immunocompetent mice. Our conclusions are supported by genetically and inducible hepcidin-deficient mice, human observations, and in vitro studies corroborating a phenotype observed in patients with chronic liver disease (CLD). Of translational significance, we uncover a hepcidin mimetic as an intervention and ferroportin as a therapeutic target to improve outcomes of disseminated candidiasis.

We show that the loss of hepcidin compromises nutritional immunity, instigating early uncontrolled fungal growth, filamentation, and mortality. These observations are independent of the sex of the mice. Early C. albicans growth restriction by renal phagocytes protects against systemic candidiasis.^70,73,74 Hence, C. albicans initiates its own iron acquisition program to survive in the hostile host environment.^33,39,75 Following exposure to C. albicans, intra-renal hepcidin levels increase,⁷⁶ and an iron import program is initiated in monocytes⁷⁷ to limit access to iron, thereby mediating nutritional immunity. In support of this hypothesis, C. albicans isolated from WT murine kidneys has an iron starvation profile.⁷⁸ However, the loss of hepcidin leads to iron overload of the renal epithelium and negates the iron retention ability of monocytes and neutrophils,^79–81 providing unhindered access to this key nutrient. We also show that hepcidin deficiency is associated with a hyperinflammatory phenotype in C. albicans-infected kidneys. Work from our lab has demonstrated that hepcidin attenuates lipopolysaccharide and TLR3-induced immune responses in mice and macrophages.^82,83 Our study sets the stage for defining the functional consequences of monocyte and neutrophil-specific intracellular iron deficiency or excess during Candida infections.

Prior work has shown that candidalysin is essential for epithelial damage,^9,84,85 inflammatory response,⁸⁶ and renal neutrophil recruitment⁶⁹ during C. albicans infections in vitro and in vivo. We uncover a previously unknown hepcidin-iron-dependent mechanism that promotes fungal virulence and induces renal injury independent of candidalysin in immunocompetent mice. We demonstrate that iron sustains C. albicans hyphae with exposed 1,3-β-glucan and accentuates IL-8 production in human renal epithelial cells. Exposed β-glucans on C. albicans cell surfaces are recognized by oral epithelial cells via the ephrin type A receptor 2 (EphA2)⁸⁷ and trigger an inflammatory response. EphA2 is also expressed by renal tubular epithelial cells^88–90 and can account for candidalysin-independent renal pathology observed in Hamp^−/− mice. Furthermore, neutrophil EphA2 also serves as a receptor for β-glucans⁹¹ and may explain the high neutrophil numbers in ece1Δ/Δ infected Hamp^−/− mice. Dectin-1 also recognizes exposed 1,3-β-glucan and is widely expressed on cells of the myeloid lineage and different types of epithelial cells.⁹² However, its expression on the renal epithelium has not been reported, and kidney-resident macrophages and dendritic cells may initially play this role.

A key aspect of our research is its extension to human disease, as indicated by (1) attenuated hepcidin production in humans and mice with liver fibrosis, (2) identifying that liver fibrosis is associated with renal iron accumulation, and (3) the ability of PR73, a hepcidin mimetic,^93,94 to ameliorate outcomes of invasive C. albicans infection. We have shown previously that hepcidin deficiency does not influence the outcome of aspergillosis,⁹⁵ and therefore our findings appear to be relevant to specific human infections and disease states. For example, patients with chronic liver disease (CLD) are at a higher risk of candidemia than patients without liver disease, even in the absence of neutropenia.^55–57 However, the underlying mechanisms are incompletely defined. Our findings suggest that iron may accumulate in the tissues of patients with CLD due to low hepcidin levels and render them susceptible to fungal infections. While we could not obtain kidney biopsies of patients with CLD, the findings in iHamp^−/− mice and the conserved role of hepcidin in humans and mice provide a strong rationale. Our findings are also relevant to patients harboring loss-of-function STAT3 variants (Job’s syndrome), where care is directed at treating and preventing recurrent fungal infections.⁹⁶ Phosphorylation of STAT3 is critical for hepcidin transcription,^51,53,54 and the link between STAT3 variants, hepcidin, and recurrent fungal infections has not been explored.

In summary, our study provides mechanistic and translational insights into the essential role of hepcidin in orchestrating nutritional immunity during fungal disease, uncovering hepcidin as a novel host susceptibility factor in resistance to systemic candidiasis.

Translational statement

Hepcidin is a promising intervention for developing individualized risk stratification and prognostication strategies. As an endogenous peptide with a favorable safety profile (ClinicalTrials.gov identifier: NCT03381833 and NCT03165864), hepcidin and its analog carry a high translational potential. In the era of increasing fungal infections that continue to exhibit poor outcomes despite conventional antifungal therapies (https://fis.fda.gov/sense/), our studies lay the foundation to evaluate novel hepcidin mimetics such as Vamifeport^97,98 or Rusfertide,^99,100 as adjunct therapies to mitigate fungal infections and improve the prognosis of at-risk patients.

Limitations of the study

Our finding that acute and chronic hepcidin deficiency exacerbate fungal burden and worsen outcomes in immunocompetent mice is remarkable. However, our study does not determine whether tissue iron potentiates secretion of virulence factors to increase the pathogenicity of C. albicans. Additionally, we did not isolate and genetically profile C. albicans isolated from Hamp^−/− and WT kidneys to identify changes in the fungal transcriptome, which can provide additional insight into fungal virulence. Furthermore, we did not evaluate how intracellular iron deficiency (due to high ferroportin and loss of hepcidin) affects the effector function and phenotype of neutrophils and monocytes, and this warrants further investigation. We acknowledge that there could be additional mechanisms by which candidalysin-deficient mutants induce kidney injury and immune infiltration in an iron-overloaded kidney. Finally, it remains uncertain whether non-hepatocyte-derived hepcidin would improve the outcomes of bloodstream C. albicans infection in mice and whether the protective mechanisms also apply to other hepcidin-producing cell types, such as monocytes, dendritic cells, macrophages, and renal tubular epithelial cells. Thus, the role of hepcidin in these cells, particularly within the fungal microenvironment, requires further investigation.

RESOURCE AVAILABILITY

Lead contact

Requests for further information and resources should be directed to and will be fulfilled by lead contact, Yogesh Scindia (yogesh.scindia@medicine.ufl.edu).

Materials availability

This study did not generate new unique reagents.

Data and code availability

All data reported in this paper will be shared by the lead contact upon request. This paper does not report original code.

STAR★METHODS

EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS

Human subjects

The liver tissue and serum samples were collected under the protocol approved by the Clinical Research Ethics Committee of the University of Florida (IRB201601019) following written informed consent from subjects in accordance with the Declaration of Helsinki Principles.¹⁰¹ Forty-three deidentified samples from 21 to 71-year patients were used. The serum from 26 healthy controls and 43 patients with chronic liver disease were analyzed for hepcidin. Healthy subjects were selected from the Alpha-1 Foundation DNA and Tissue Bank. Percutaneous liver biopsy was performed with a 16 gauge BioPince core biopsy needle after using ultra-sonography to mark the location and stored in Allprotect tissue reagent at −80°C till further use. Liver tissue from alpha1 antitrypsin deficient patients without liver disease (n = 6) and with chronic liver disease (n = 6) were used to analyze hepcidin gene expression.

Mice

All experiments were performed following the National Institutes of Health and Institutional Animal Care and Use Guidelines and were approved by The Animal Care and Use Committee of the University of Florida (IACUC# 202400000692). The mice were maintained at 23°C (range ±2°C), 30–70% humidity, and a 14:10-h light: dark cycle. Hepcidin knockout mice (Hamp^−/−) on a C57BL/6 background were obtained from Sophie Vaulont (Institut Cochin, France), and their wild-type littermate controls (C57BL/6 background) were housed and maintained in the animal facilities of the University of Florida on a regular diet. The genetic Hamp^−/− mice are characterized by plasma iron overload, high transferrin saturation, multi-visceral iron accumulation, and ferritin buildup.^102,103 We also utilized the inducible Hamp^−/−(iHamp^−/−) knockout mice (on a C57BL/6 background) obtained from Alexander Drakesmith (Oxford University, UK). In these mice, Hamp1 alleles are floxed. They can be conditionally excised at any age by activating a ubiquitously expressed Cre-recombinase fused to a mutated estrogen receptor ligand-binding domain (CreERT2).⁷¹ Equal number of 10–12-week-old male and female mice were used in these throughout studies.

Fungal strain and mouse model of systemic candidiasis

The Candida albicans strains SC5314 was purchased from ATCC. C. albicans candidalysin deficient strain ECE1 KO (ece1ΔΔ) and its isogenic candidalysin sufficient strain ece1ΔΔ+ECE1 (ece1Δ revertant, with comparable virulence to SC5314)⁶⁸ were a kind gift from Dr. Bernhard Hube, Hans Knoell Insitute, Germany. The description of the red fluorescent Candida albicans strain CAF2–1-dTomato used in this study is provided in previous publications.⁷⁰ All the strains were streaked on agar plates composed of yeast extract, peptone, and dextrose medium containing penicillin and streptomycin (Gibco) at 33°C. Single colonies were added to the broth of identical composition and grown in a shaking incubator at 33°C. Cells were centrifuged, washed in PBS, counted using a hemocytometer, and injected into Hamp^−/− or littermates (wild type) mice via the lateral tail vein. 2– 4×10⁵ C. albicans yeast cells were injected per mouse.

Inducible mouse model of systemic candidiasis

The iHamp^−/− mice received 1 mg tamoxifen for three consecutive days (intraperitoneally). Following the tamoxifen regimen, these mice were infected with C. albicans (SC5314). In a cohort of iHamp^−/− mice, following tamoxifen and C. albicans, were daily administered 50 nM mini-hepcidin PR-73 (a synthetic hepcidin agonist) intraperitoneally^72,104 post tamoxifen and C. albicans injections. The first dose of PR-73 was 4 h post C. albicans injection. Experiments were terminated on days 3–4 post-infection.

Induced liver fibrosis model

8–10 weeks old C57Bl6 mice were used in this study. Carbon tetrachloride (CCl₄) (Sigma) was injected to induce liver inflammation.^105,106 0.3% CCl₄ (diluted in olive oil) was injected intraperitoneally twice weekly for 5 weeks at a dose of 10 μL/g of body weight. Two days after the last dose, animals were euthanized, and organs were harvested for further studies.

Cell line

HK-2 cells a human proximal tubular epithelial cell line was purchased from ATCC, CRL-2190, and were maintained in ATCC-recommended Keratinocyte Serum-Free Medium (Gibco) supplemented with Bovine Pituitary Extract (0.05 mg/mL) and Human Recombinant Epidermal Growth Factor (5 ng/mL) at 37C and 5% CO₂. Cells were used between passage 3–5. Cells were tested for mycoplasma contamination at each passage using the MycoFluor Mycoplasma Detection Kit from ThermoFisher Scientific.

METHOD DETAILS

Fungal burden determination

50 μL blood was collected by tail bleeding the mice 20 h post-infection, serially diluted in PBS, and 10 μL of each dilution was plated on yeast extract, peptone, and dextrose agar plates (YPD agar, Difco) containing penicillin and streptomycin. Colony forming Units (CFUs) were determined after 24 h of incubation at 37°C, and results were expressed as CFUs/mL. The mice were euthanized on days 3 and 6 after infection to determine the tissue fungal burden in the kidney. The kidney, spleen, and liver were aseptically removed and homogenized using a tissue homogenizer. The tissue homogenates were serially diluted, and CFU was measured as mentioned above and expressed as CFU/organ.

Biochemical assays and tissue samples

Before euthanasia, animals were anesthetized with ketamine (120 mg/kg)/xylazine (12 mg/kg), and blood was drawn from the axilla. All the tissue slices were fixed with 10% neutral-buffered formalin for paraffin embedding and with periodate-lysine-paraformaldehyde fixative (PLP) to be frozen in optimal cutting temperature compound or snap frozen in liquid nitrogen for subsequent RNA and protein extraction, and immunofluorescence.

Histopathology analysis

PAS and H&E staining

Kidney tissue was fixed in 10% formalin and was submitted to the molecular pathology core at the University of Florida. Five μM thick paraffin-embedded sections were cut and stained for Periodic Schiffs (PAS) and hematoxylin and eosin (H&E) by the molecular pathology core at the University of Florida.

Grocott methenamine silver staining

10% formalin-fixed tissue sections were deparaffinized in xylene and stained by Grocott’s methenamine silver staining to determine the morphological changes of C. albicans during infection in mice. The tissue sections were collected post-infection and processed. The protocol described by the manufacturer, Polysciences (described in the table), was followed for the staining.

KEY RESOURCES TABLE

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
PE/Cyanine7 anti-mouse CD45 (Clone 30-F11)	Biolegend	AB_103114
FITC anti-mouse/human CD11b (Clone M1/70)	Biolegend	AB_101206
PE anti-mouse Ly-6C (Clone HK 1.4)	Biolegend	AB_128008
APC anti-mouse Ly-6G (Clone 1A8)	Biolegend	AB_127614
(1–3)-beta-glucan-directed monoclonal antibody	Biosupplies Australia PTY LTD	AB_400–2
Concanavalin A	Invitrogen	AB_C11252
Goat Anti-Mouse IgG, Human ads- PE	Southern Biotech	AB_1030–09S
Goat Anti-mouse IgG AF647	Abcam	AB_Ab150115
Experimental models: organisms/strains
Candida albicans SC5314	ATCC	MYA-2876
Candida albicans ece1ΔΔ	Bernhard Hube (Leibniz Institute for Natural Product Research and Infection Biology- Hans Knoll Institute, Germany)	N/A
Candida albicans ECE1 revertant ece1ΔΔ + ECE1
Candida albicans CAF2–1-dTomato	Michail Lionakis (NIH, Bethesda)70
Mouse: Hepcidin KO mice (Hamp−/−)	Sophie Vaulont (Institut Cochin, France)	N/A
Mouse: Inducible hepcidin KO mice (iHamp−/−)	Alexander Drakesmith (Oxford University, UK)	N/A
Chemicals, peptides, and recombinant proteins
Yeast Peptone Dextrose agar	Difco	DF0427-17-6
YNB Broth w/o ammonium sulfate, w/o copper sulfate, w/o copper sulfate, w/o ferric chloride	MP Biomedicals	4027112
Yeast Peptone Dextrose Broth	Difco	DF0428-17-5
Copper sulfate, Pentahydrate	LabCHem	LC134051
Ferric Ammonium Citrate	Sigma	F5879
Ammonium sulfate	Fisher chemical	A702–500
Glucose	Sigma	G7021–100G
CSM (Powder)	MP Biomedicals	4500012
Penicillin/Streptomycin	Gibco	15140122
Ketamine	UF ACS	N/A
Xylazine	UF ACS	N/A
10% Formalin	Fisher Brand	245–684
Tamoxifen	Sigma	T5648
Triton X-100	Sigma Aldrich	50-178-1841
Trizol	Ambion	15596018
Chloroform	Sigma-Aldrich	319988
CCl4- Carbon Tetrachloride	Sigma	289116
Keratinocyte serum-free medium	Gibco	17005042
Bovine pituitary extract	Gibco	13028–014
Human recombinant epidermal growth factor	Gibco	10450–013
Renal epithelial cell growth basal medium 2	PromoCell	C-26235
Supplement Pack Renal Epithelial Cell GM2	PromoCell	C-39605
PR-73 mini hepcidin	Kind gift from Elizabeta Nemeth, UCLA, USA	N/A
ProLong Gold antifade agent with DAPI	Invitrogen	P36962
ProLong Gold antifade agent without DAPI	Invitrogen	P36961
Nuclear Fast Red	Sigma	N3020
Collagenase (Type IV)	Worthington	LS004188
DNase	Roshe	04536282001
Critical commercial assays
Creatinine Assay (Enzymatic)	Diazyme	DZ072B
Urea Nitrogen (BUN) colorimetric assay	Arbor assays	K024-H
RNeasy Plus mini kit	Qiagen	74104
IL-8 Human ELISA kit	Invitrogen	KHC0082
Grocott Methenamine Silver Stain (GMS) for Fungus and PCP	Polysciences	25087–1
Hepcidin IDx ELISA Kit (human)	Intrinsic Lifesciences	ICE-007
MycoFluor Mycoplasma Detection Kit	ThermoFisher Scientific	M7006
Experimental models: Cell lines
HK-2 Cells	ATCC	CRL-22
Oligonucleotides
Human: HAMP	Bio-Rad	qHsaCID0020626
Human: GAPDH	Bio-Rad	qHsaCIP0029958
Mouse: Ppia	Bio-Rad	qMmuCED0041303
Mouse: Tnfα	Bio-Rad	qMmuCED0004141
Mouse: IL-1β	Bio-Rad	qMmuCID0005641
Mouse: IL-6	Bio-Rad	qMmuCEDD0045760
Mouse: Gsdmd	Bio-Rad	qMmuCED0003802
Mouse: Mlkl	Bio-Rad	qMmuCED0044462
Mouse: Csf3	Bio-Rad	qMmuCED0004279
Mouse: Ccl2	Bio-Rad	qMmuCED0003785
Mouse: Cxcl11	Ori-gene	MP202411
Fungus: ECE1 forward	Integrated DNA technologies	atcgaaaatgccaagagag
Fungus: ECE1 Reverse	Integrated DNA technologies	agcattttcaataccgacag
Fungus: TDH3 Forward	Integrated DNA technologies	atcccacaaggactggaga
Fungus: TDH3 Reverse	Integrated DNA technologies	gcagaagctttagcaacgtg
Software and algorithms
FlowJo™ Software	BD Life Sciences	V10.8
GraphPad software	GraphPad Software, LLC. Boston, Massachusetts, USA	www.graphpad.com
Microsoft Excel	Microsoft	https://www.microsoft.com/en-us/microsoft-365

Perls staining

As described in our previous studies, 10% formalin-fixed tissue sections were deparaffinized in xylene and stained for Perl’s detectable iron deposits.¹⁰³ After washing excess reagent, tissue was counter-stained with nuclear fast red and imaged for blue iron deposits.

Plasma creatinine assay

Serum and plasma creatinine were measured using a commercial assay as described by the manufacturer (Diazyme, description in key resources table).

Immunofluorescence

Three-micron, PLP-fixed kidney sections were used for the immunofluorescence detection of lotus tetragonolobus lectin (LTL) positive proximal tubular epithelial cells. Briefly, tissue sections were air-dried and incubated with 0.3% Triton X-100/10% horse serum in PBS for 30 min. After washing the sections with PBS, an anti-CD16/32 antibody was added to block F_C receptors. This was followed by incubation for 90 min with FITC-labeled LTL (Vector Labs, 1:300). The sections were then washed 3 times in PBS and mounted with ProLong Gold antifade agent with DAPI (Life Technologies). The sections were imaged on a Keyence BZ-X800 fluorescence imaging microscope.

In vitro detection of exposed β-1,3-glucan

For exposed β-1,3-glucan staining, ece1ΔΔ+ECE1 and ece1ΔΔ Candida albicans were grown in YPD broth at 33°C 200 RPM for 16 h. After washing with PBS, an aliquot was resuspended in YPD broth with or without 100 μM FeCl₃ and grown overnight. Two million yeast cells from each condition were added on a 15 μM thick glass coverslip in a 12-well plate at 37°C. After overnight growth, the coverslips were fixed in 4% paraformaldehyde for 20 min and sequentially treated with 0.5% Triton X-100 for 5 min, ice-cold 3% BSA/PBS for 1 h, and primary antibody for β-1,3-glucan (Mouse monoclonal) for 90 min (1:800 in 3% BSA-PBS). This was followed by incubation with Goat anti-Mouse PE, (1:600) and FITC conjugated anti-Concavilin A (30 μg/mL) for 45 min in the dark.¹⁰⁷ After PBS wash, the coverslips were mounted with ProLong mountant without DAPI (Life technologies). Sections were imaged on a Keyence BZ-X800 fluorescence imaging microscope.

In vivo detection and quantification of exposed 1,3-β-glucan

WT and Hamp^−/− mice (n = 5) were infected (intravenous) with two hundred thousand red fluorescent Candida albicans (CAF2–1-dTomato)⁷⁰ and the kidneys were harvested 3 days later. An entire kidney was homogenized (Tissue Tearor, BioSpec Inc) in 1 mL PBS for 20–30 s. The homogenate was filtered through a 100 μM filter and fixed in 4% PFA for 20 min. Subsequent steps and antibody dilutions were as described above. Goat anti-Mouse Alexa Fluor 647 (1:600) was used to detect β-1,3-glucan. After PBS wash, the digest was diluted in 300 μL ProLong mountant without DAPI (Life technologies) and after vortexing, 100 μL was added onto a glass slide (Fisher, Superforst Plus) and mounted with cover slips. 4 random, 20X images of each slide were taken on a Keyence BZ-X800 fluorescence imaging microscope. Red hyphae with exposed β-1,3-glucan (green) colocalized as yellow were counted.

Flow cytometry

Single-cell suspensions from the kidney were prepared as described in our previous publication.⁸³ The kidney was cut into small pieces and digested with collagenase (type 4; Worthington) and 100 μg/mL DNAse (Roche) for 20 min at 37°C. The digested kidney was then passed serially through a 70 μm and 40 μm sieve to collect the cell suspension. The cells were then incubated with eBioscience Fixable Viability Dye eFlour 780 (Invitrogen) (1:3000) and anti-CD16/32 (Fc block, clone 93; BioLegend, San Diego, CA) (1:100) in PBS for 20 min in the dark. After washing with FAC buffer, cells were stained with PE-Cy7 conjugated anti-CD45 (30-F11), FITC-conjugated anti-CD11b (M1/70), PE-conjugated anti-Ly6c (HK 1.4) APC-conjugated anti-Ly6G (1A8 BD Bioscience). Flow cytometry data were acquired using Cytek Arora 3 laser (Fremont, CA). 500,000 events/samples were acquired and analyzed with FlowJo software 9.0 (Tree Star Inc., Ashland, OR).

Real-time PCR

For RNA isolation, frozen tissues were re-suspended in RLT buffer (Qiagen Inc., Valencia, CA) and homogenized using the TissueLyser system (Qiagen). For isolating fungal RNA, infected kidneys were homogenized in 2 mL Trizol and bead-beaten using zirconia beads for 45 s twice (with 5-min intervals on ice). After spinning for 2 min at 12,000 rpm the supernatant was added to 200 μL of chloroform and phase separated. The top RNA layer was isolated and further purified using a RNeasy Plus mini kit (Qiagen). After loading RNA on the spin column (Qiagen), on-column DNA digestion (Qiagen) was performed for 30 min at room temperature. Total RNA from tissue homogenates was then purified using the RNeasy Plus mini kit (Qiagen) following the manufacturer’s instructions. 1 μg of RNA was used to synthesize cDNA using the iScript cDNA synthesis kit (Bio-Rad Laboratories, Hercules, CA). The cDNA template was mixed with iTAQ SYBR green universal super mix (Bio-Rad) and quantitative PCR was carried out on a CFX Connect system (Bio-Rad). Data are expressed as fold change over control and were calculated using the 2^−ΔC(T) method. PPIA was used as the reference gene for mice and TDH3 for C. albicans. All the primers used in this study and their sequences are listed in the key resources table.

In-vitro studies

Influence of iron on the growth of C. albicans in mouse kidneys and human PTEC cell lysates

The kidneys of C57BLK/6 mice were excised, cut into small pieces, and digested with 1.2 mg/mL collagenase (type 4; Worthington) and 100 μg/mL DNAse (Roche) for 20 min at 37°C. After washing, the whole kidney digest was cultured for 48 h in renal epithelial cell growth basal medium 2 (PromoCell, Heidelberg, Germany) supplemented with recombinant human epidermal growth factor (10 ng/mL), recombinant human insulin (5 μg/mL) epinephrine (0.5 μg/mL), hydrocortisone (36 ng/mL), human holotransferrin (5 μg/mL), triiodo-L thyronine (4 pg/mL), and 0.5% fetal calf serum.¹⁰⁸ After 24 h, 50 or 100 μM ferric ammonium citrate was added to the cultures. Forty-eight hours later, the adherent cells were washed, treated with trypsin, and lysed in water. The supernatant were bought up to 1X PBS and spiked with 10,000 C albicans yeast cells and growth curves were generated for 19 h at 32°C.

To evaluate the growth of C. albicans, HK-2 cells (2×10⁵/well) were iron overloaded using Ferric Chloride (100 μM) as described by van Raaji et al.⁶¹ After washing to remove any non-internalized iron, the vehicle or iron-loaded HK-2 cells were treated with C. albicans (50,000/well) for 20 h. The supernatant was inoculated with 10,000 C albicans, and growth curves were generated for 12 h at 32°C.

Effect of iron on C. albicans hyphal sustenance

To determine the role of iron in hyphal sustenance, C. albicans ece1ΔΔ+ ECE1 and ece1ΔΔ were grown for 18 h in YNB broth supplemented with 2% glucose, 5 gm/L NH₄ SO₄, 0.79 gm/L amino acid supplement, and 2 mM/L CuSO₄ at 33°C. After 18 h, an aliquot was resuspended in YNB broth supplemented with ammonium sulfate, copper sulfate with or without 100 mM ferric ammonium citrate (source of iron) as described by Tripathi et al.¹⁰⁷ The next day, 1 × 10⁶ yeast cells were plated in 12 well plates in the same broth and grown at 37°C. Images were taken at 0 h, 3 h, and 24 h using the Keyence BZ-X800 microscope.

Effect of ece1ΔΔ C. albicans grown in excess iron on human proximal renal tubular cells immune response

The ece1ΔΔ Candida albicans were grown in YPD broth at 33°C 200 RPM for 16 h, and an aliquot was resuspended in YPD broth with or without 100 μM FeCl₃ for overnight growth. After washing, the yeast cells were resuspended in keratinocyte-SFM media and added to HK-2 cells (MOI 1:3 Cells: Fungus). Supernatants were collected at different time points. IL-8 was measured using a commercial sandwich ELISA as recommended by the manufacturer.

QUANTIFICATION AND STATISTICAL ANALYSIS

A 2-tailed Mann-Whitney test was performed to determine the change in fungal burden in Figure 1, IL-8 production, change in hepcidin levels, change in gene expression, and difference in growth rate. A two-way ANOVA using Holm-Šídák’s multiple comparisons test was performed to compare the fungal burdens, immune cell infiltration, and fold change in gene expression. A 2-tailed Wilcoxon matched pair sign rank test was used to compare the change in plasma hepcidin levels. For all tests, Data is presented as mean ± SEM. *p < 0.05, **p < 0.001, ***p < 0.0001.

Supplementary Material

Supplemental information can be found online at https://doi.org/10.1016/j.celrep.2025.115649.

Highlights.

• Hepcidin deficiency worsens candidiasis

• Therapeutic use of hepcidin mimetic improves outcomes