Skip to main content
NCBI home page
Veterinární Medicína logoLink to Veterinární Medicína
. 2021 Oct 31;66(10):423–430. doi: 10.17221/130/2020-VETMED

A comprehensive study of canine parvoviruses (Carnivore protoparvovirus 1, Carnivore bocaparvovirus 1 and 2) from shelter dogs in Turkey

Hakan Isidan 1,*, Turhan Turan 1
PMCID: PMC12178629  PMID: 40547281

Abstract

A total of 150 rectal swab samples were collected from diarrheic dogs from the Sivas Municipal Animal Shelter, Turkey in April 2018. While 127 faecal samples were gathered from adults, 23 samples were collected from puppies. Canine parvovirus type 2 (Carnivore protoparvovirus 1), Canine minute virus (Carnivore bocaparvovirus 1) and Canine bocavirus (Carnivore bocaparvovirus 2) were examined by PCR with three sets of novel primers. Some of the amplicons were subjected to molecular sequencing and molecular analysis. Three faecal (2.36%) samples were found to be positive for Carnivore protoparvovirus 1, five faecal samples (3.94%) were found to be positive for Carnivore bocaparvovirus 1 and three samples (2.36%) were found to be positive for Carnivore bocaparvovirus 2 among 127 adult dogs. On the other hand, 14/23 faecal samples (60.87%) were found to be positive for Carnivore protoparvovirus 1, 8/23 faecal samples (34.78%) were found to be positive for Carnivore bocaparvovirus 1, and 6/23 faecal samples (26.09%) were found to be positive for Carnivore bocaparvovirus 2 from the puppies. Moreover, we detected two distinct clades of Carnivore bocaparvovirus 1 and 2 according to the molecular analysis. To the best of our knowledge, this is the first report for the direct detection of Carnivore bocaparvovirus 1 and 2 in Turkey.

Keywords: dog parvovirus, molecular analysis, NS1 gene, phylogeny, sequencing, VP2 gene

The family Parvoviridae consists of two subfamilies: Densovirinae, which infects insects and Parvovirinae, which infects vertebrates.

According to new taxonomy records, the subfamily Parvovirinae consists of eight genera including Amdoparvovirus, Aveparvovirus, Copipar-vovirus, Dependoparvovirus, Erythroparvovirus, Tetraparvovirus, Protoparvovirus which includes the causative agent of classical canine parvoviral enteritis (Carnivore protoparvovirus 1) and Bocaparvovirus which includes Carnivore bocaparvovirus 1–6. In scientific literature, two Bocaparvoviruses have been isolated from dogs, which are Carnivore bocaparvovirus 1, formerly known as Canine minute virus, and Carnivore bocaparvovirus 2, formerly known as Canine bocavirus 1, thus far (Cotmore et al. 2014).

Since the International Committee on Taxonomy of Viruses (ICTV) changed the name of these viruses, we use the names Carnivore protoparvovi-rus 1 instead of Canine parvovirus 2, Carnivore bocaparvovirus 1 instead of Canine minute virus and Carnivore bocaparvovirus 2 instead of Canine bocavirus 1 in this paper according to the ICTV. Both of the Carnivore bocaparvoviruses (type 1 and 2) have shown to be causative agents of haemorrhagic enteritis of dogs (Macartney et al. 1988; Jarplid et al. 1996; Truyen et al. 1996; Bodewes et al. 2014). A serological study indicated that Carnivore bocaparvovirus 1 has already been reported from Turkey, but without virological detection (Torun and Yilmaz 2005).

The aim of the study was the investigate the existence of parvoviruses in fecal samples of dogs at various ages in Turkey. To the best of our knowledge, the present report is the first report for the direct detection of Carnivore bocaparvovirus 1 and 2 in Turkey.

MATERIAL AND METHODS

Sampling

In this study, a total of 150 rectal swab specimens were collected from the Sivas Municipal Animal Shelter, Turkey. The sampled dogs had manifested gastro-intestinal problems, including 127 adult dogs (more than one-year-old) and 23 puppies that were approximately two to four months old. The collected samples were transported to the laboratory just after sampling and stored at –80 °C until being subjected to the DNA isolation.

The faecal samples were diluted to 1 : 10 with a 1 M phosphate buffered saline solution and centrifuged for 10 min at 1 000 g to remove the large cellular debris.

After centrifugation, the supernatants were submitted to a nucleic acid extraction procedure using a GF-1 Viral Nucleic Acid Extraction Kit (Vivantis, Selangor, Malaysia) according to the manufacturer’s instructions. The eluted nucleic acids were stored at –80 °C until use.

Polymerase chain reaction (PCR)

The molecular detection of the partial VP2 gene of Carnivore protoparvovirus 1 and Carnivore bocaparvovirus 1, and also the partial NS1 gene of Carnivore bocaparvovirus 2 were conducted by our generic primer sets (Table 1). The polymerase chain reaction (PCR) mixture was prepared as a 50 μl final volume containing a 5 μl template, 5 μl of the 10 × PCR buffer, 10 mM of dNTP, 10 pmol/μl of each set of sense/antisense primers, and 5 IU of Taq DNA polymerase (Vivantis, Selangor, Malaysia). The conditions of the PCR were adjusted accordingly to 95 °C for 2 min for the pre-denaturation for 40 cycles, 94 °C for 45 sec of denaturation, 51 °C (Carnivore bocaparvovirus 1), 55 °C (Carnivore bocaparvovirus 2) or 52 °C (Carnivore protoparvovirus 1) for 45 s of annealing, 72 °C for 1 min for the extension and lastly 10 min at 72 °C for final extension. The PCR products were separated by electrophoresis in 1.5% agarose gels, stained with ethidium bromide.

Table 1. Oligonucleotide primers for the detection and sequencing of the partial VP2 and NS1 genes of Carnivore protoparvovirus 1, Carnivore bocaparvovirus 1 and 2 respectively.

Primer ID Sequence (5'-3') Target gene Amplicon size
CPV2-3140F CCTGACAGAGCAACTCCGTTT VP2 gene of Carnivore protoparvovirus 1 640 bp
CPV2-3779R TGTGAACCATCTGAAGCAAGGT
CPV2-3778F GCTGAGGTTGGTTATAGTGCR 642 bp
CPV2-4419R TGGATTCCAAGTATGAGAKGCT
CPV2-3824Fn CACAAGGGCCATTTAAAACACC 591 bp
CPV2-4414Rn TCCAAGTATGAGAGGCTCTTAG
CMV4064F TGTGGGTGGGTCAATAATGA VP2 gene of Carnivore bocaparvovirus 1 500 bp
CMV4563R TTGTTTGTTCCGTCTTGCAC
CBoV999F CCTGACAGAGCAACTCCGTTT NS1 gene of Carnivore bocaparvovirus 2 400 bp
CBoV1398R TGTGAACCATCTGAAGCAAGGT
Open in a new tab

Sequencing and phylogenetic analysis

The corresponding amplicons were directly submitted to the sequencing. The amplicons were purified with a Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI, USA) and sequenced using the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) on an automated sequencer (ABI 3100; Applied Biosystems, Foster City, CA, USA). All of the sequenced products were used to obtain the phylogenetic data. The partial sequences were compared with other sequence data which are provided online by the National Center for Biotechnology Information (NCBI). The sequence alignment and phylogenetic analysis based on the partial nucleotide sequences of 642 and 541 bp VP2 gene (Carnivore protoparvovirus 1), 500 bp VP2 gene (Carnivore bocaparvovirus 1), and 400 bp NS1 gene (Carnivore bocaparvovirus 2) were constructed with the use of Geneious Prime Software v2019.2.3.

RESULTS AND DISCUSSION

Five faecal samples (3.94%) were found to be positive for the 500 bp partial VP2 gene of Carnivore bocaparvovirus 1. While, three samples (2.36%) were found to be positive for the 400 bp partial NS1 gene of Carnivore bocaparvovirus 2 and three samples (2.36%) were found to be positive for the 640 bp partial VP2 gene of Carnivore protoparvovirus 1 within 127 adult dogs. On the other hand, eight faecal samples (34.78%) were found to be positive for the 500 bp partial VP2 gene of Carnivore bocaparvovirus 1, six faecal samples (26.09%) were found to be positive for the 400 bp partial NS1 gene of Carnivore bocaparvovirus 2 and fourteen faecal samples (60.87%) were found to be positive for the 640 bp partial VP2 gene of Carnivore protoparvovirus 1 from the puppies. The overall PCR results are illustrated below (Table 2). Ten samples, collected from nine puppies and an adult, were found to be positive for a mixed infection. The summarised graphical representation of the infections is illustrated below (Figure 1). The detection confirmation was conducted by multiple alignments of the sequenced amplicons together with the canine parvovirus sequences gathered from GenBank.

Table 2. Overall PCR results for the detection of Carnivore protoparvovirus 1, Carnivore bocaparvovirus 1 and 2 both from adults and puppies.

Total samples Carnivore protoparvovirus 1
(Canine parvovirus 2)		 Carnivore bocaparvovirus 1
(Canine minute virus)		 Carnivore bocaparvovirus 2
(Canine bocavirus 1)
Adults 127 2.36% (3/127) 3.94% (5/127) 2.36% (3/127)
Puppies 23 60.87% (14/23) 34.78% (8/23) 26.09% (6/23)
Open in a new tab

Figure 1. Detailed diagram of the positive samples and the point of mixed infections.

Figure 1

Open in a new tab

One hundred fifty (127 adults and 23 puppies) diarrheic dogs were examined for canine parvoviruses from the city shelter by using three sets of novel primers. Nearly ten times higher levels of positivity were found in the puppies than the adults for both Carnivore bocaparvovirus 1 and 2. On the other hand, about 25 times higher levels of positivity were found in the puppies than the adults for Carnivore protoparvovirus 1. The presence of Carnivore protoparvovirus 1 has been reported from Turkey already (Ozkul et al. 2002; Sahna et al. 2008; Timurkan and Oguzoglu 2015). On the other hand, serological evidence of Carnivore bocaparvovirus 1 had also been reported by Torun and Yilmaz (2005) in Turkey. The seroprevalence was reported as 18% from 100 diarrheic dogs at that time. However, there is no record about Carnivore bocaparvovirus 2 by either conducting serological or virological methods in Turkey.

The classical type canine parvovirus (Carnivore protoparvovirus 1) is a well-known canine pathogen. There are numerous research studies concerned with Carnivore protoparvovirus 1 worldwide including Turkey (Yesilbag et al. 2007; Sahna et al. 2008; Touihri et al. 2009; Mohan Raj et al. 2010; Ntafis et al. 2010; Yi et al. 2016). In these reports, the positivity of puppies varies from 35% to 90%. In this study, we detected 640 bp partial VP2 gene amplicons from 2.36% (3/127) of the adults and 60.87% (14/23) of the puppies.

Fourteen PCR products from the Carnivore protoparvovirus 1 positive samples were sequenced and the data were submitted to the GenBank (accession codes: MK503182-5 and MN171410-19). Multiple alignments of 455 previous strains, which were gathered from the GenBank, as well as our strains were examined. All of the new strains reported here are genotype 2b, according to the 426th aa of the VP2 protein. Four aa changes were observed on our partial sequences in comparison with the 469 total strains. These are the 267th position “TTT/Phe to TAT/Tyr”, the 324th position “TAT/Tyr to ATT/Ile”, the 440th position “ACA/Thr to GCA/Ala”, and also the 426th “GAT/Asp” position which is a marker for the genotype distinction. On the other hand, 25 nucleotide silent mutations were observed which does not affect the aa substitution. Moreover, one of the silent mutations “ACT/Thr to ACC/Thr” is unique for our strains at the 445th aa position (nt: 1335) (Figure 2).

Figure 2. Sequences of the Carnivore protoparvovirus 1 strains based on the partial VP2 protein showing mutations and silent mutations – only mutations found in more than 5 of the total 469 strains are illustrated.

Figure 2

Open in a new tab

Experimental and/or field surveys indicate that Carnivore bocaparvovirus 1 causes pneumonitis and/or enteritis and varies from mild to severe in puppies while adults look healthy (Ohshima et al. 2010). The seropositivity of Carnivore bocaparvovirus 1 varies from 5% to 70% worldwide (Carmichael et al. 1994; Pratelli et al. 1999; Torun and Yilmaz 2005; Sahna et al. 2008; Touihri et al. 2009; Timurkan and Oguzoglu 2015). However, there is only one molecular epidemiological study of Carnivore bocaparvovirus 1, other than seroepidemiological studies, which detected the viral genome in 1.2% (4/346) of dogs among enteric and/or respiratory diseased domestic dogs in Japan (Mochizuki et al. 2002). In this research, we detected the 500 bp partial VP2 gene amplicons of Carnivore bocaparvovirus 1 from 3.94% (5/127) of the adults and 34.78% (8/23) of the puppies. The results indicate that the prevalence of Carnivore bocaparvovirus 1 was detected higher that it is supposed to in puppies.

Carnivore bocaparvovirus 1 and 2 have also been reported in both respiratory and enteric diseased puppies (Hashimoto et al. 2001; Jang et al. 2003; Kapoor et al. 2012; Lau et al. 2012; Bodewes et al. 2014). However, the epidemiological data about Carnivore bocaparvovirus 1 and 2 is limited in the literature. On the other hand, some research indicates that the positivity of Carnivore bocaparvovirus 2 varies, such as 4.1% in China (Lau et al. 2012), 9.6% in South Korea (Choi et al. 2015), and 22.78% in the USA (Kapoor et al. 2012). In this study, we detected 400 bp partial NS1 gene amplicons in 2.36% (3/127) of the adults and in 26.09% (6/23) of the puppies.

According to the molecular analysis based on the 500 bp partial sequences of the VP2 gene of Carnivore bocaparvovirus 1, two distance lineages were observed (Figure 3). All the Turkish isolates were constituted at lineage 2 together with three Chinese strains (MH540355.1–MH540357.1). The nucleotide identity of the lineage 1 isolates varies from 97.0% to 99.6% and the lineage 2 isolates varies from 97.60% to 100%. The nucleotide identity between lineage 1 and 2 was 94.4% to 97.0%. We also detected two unique mutations ("GCC/Ala to ACC/Thr") on MK503188 and ("AGC/Ser to AAC/Asn") on MK503186, MK503187, and MK503188 (Figure 4). As a result, we discovered Carnivore bocaparvovirus 1 isolates, which are genetically distinct from previously known isolates of Carnivore bocaparvovirus 1. Further investigations will be needed to study Carnivore bocaparvovirus 1 infections in dogs, since we must consider that Carnivore bocaparvovirus 1 is more widely distributed than previously recognised.

Figure 3. A cladogram representing the consensus (1 000 replicates) neighbour joining phylogenetic tree of the Carnivore bocaparvovirus 1 strains based on the 500 bp partial VP2 gene.

Figure 3

Open in a new tab

Figure 4. Multiple alignment of the 500 bp partial VP2 gene sequences of the Carnivore bocaparvovirus 1 strains indicating two point mutations on MK503186, MK503187 and MK503188.

Figure 4

Open in a new tab

The consensus (1 000 replicates) neighbour joining phylogenetic tree of the Carnivore bocaparvovirus 2 strains also indicated that two distinct lineages were substituted (Figure 5) based on the 400 bp partial NS1 gene. All the Turkish isolates and a South Korean isolate (KF771828.1) were situated in the same lineage. The nucleotide identity of lineage 1 isolates varied from 97.5% to 100% and lineage 2 isolates varied from 98.50% to 99.0%. The nucleotide identity between lineage 1 and 2 was 95.25% to 97.0%. We also detected a unique mutation ("CAG/Glu to CAC/His") on MK503191 and MK503193 (Figure 6). As a result, we propose that the Turkish Carnivore bocaparvovirus 2 isolates, which are genetically distinct from previously known isolates, are just the same as Turkish Carnivore bocaparvovirus 1 strains.

Figure 5. A cladogram representing the consensus (1 000 replicates) neighbour joining phylogenetic tree of the Carnivore bocaparvovirus 2 strains based on the 400 bp partial NS1 gene.

Figure 5

Open in a new tab

Figure 6. Multiple alignment of the 400 bp partial NS1 gene sequences of the Carnivore bocaparvovirus 2 strains indicating a point mutation on MK503191 and MK503193.

Figure 6

Open in a new tab

It is plausible that we had a considerable drawback in our study. Despite that some of the causal agents that subjected to in this study are intermittently detected in clinically healthy animals, i.e., bocaparvoviruses (Manteufel and Truyen 2008; Martella et al. 2018), our study focused on diarrheic dogs only. Thus, we conjecture that this study implies the need for more comprehensive studies in the subfamily Parvovirinae in clinically healthy and diarrheic dogs.

In conclusion, we report that this is the first virological detection of these two viruses (Carnivore bocaparvovirus 1 and 2) in shelter dogs in Turkey. It is also the only study that examined 3 carnivore parvoviruses in dogs with diarrhoea. We also believe that this study will especially contribute to expanding of the scientific knowledge on Carnivore bocaparvovirus 1 and 2.

Acknowledgement

We thank to Mustafa Ozan Atasoy for his valuable help on sample collection in the animal shelter.

Conflict of interest

The authors declare no conflict of interest.

REFERENCES

  1. Bodewes R, Lapp S, Hahn K, Habierski A, Forster C, Konig M, Wohlsein P, Osterhaus AD, Baumgartner W. Novel canine bocavirus strain associated with severe enteritis in a dog litter. Vet Microbiol. 2014 Nov 7;174(1-2):1-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Carmichael LE, Schlafer DH, Hashimoto A. Minute virus of canines (MVC, canine parvovirus type-1): Pathogenicity for pups and seroprevalence estimate. J Vet Diagn Invest. 1994 Apr;6(2):165-74. [DOI] [PubMed] [Google Scholar]
  3. Choi JW, Lee KH, Lee JI, Lee MH, Lee KK, Oem JK. Genetic characteristics of canine bocaviruses in Korean dogs. Vet Microbiol. 2015 Sep 30;179(3-4):177-83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Cotmore SF, Agbandje-McKenna M, Chiorini JA, Mukha DV, Pintel DJ, Qiu J, Soderlund-Venermo M, Tattersall P, Tijssen P, Gatherer D, Davison AJ. The family Parvoviridae. Arch Virol. 2014 May;159(5):1239-47. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Hashimoto A, Takiguchi M, Hirai K, Kida H, Carmichael LE. A serological survey of minute virus of canines (MVC; canine parvovirus type-1) in dogs in the Tokai area of Japan. Jpn J Vet Res. 2001 Nov;49(3):249-53. [PubMed] [Google Scholar]
  6. Jang HK, Tohya Y, Han KY, Kim TJ, Song CS, Mochizuki M. Seroprevalence of canine calicivirus and canine minute virus in the Republic of Korea. Vet Rec. 2003 Aug 2;153(5):150-2. [DOI] [PubMed] [Google Scholar]
  7. Jarplid B, Johansson H, Carmichael LE. A fatal case of pup infection with minute virus of canines (MVC). J Vet Diagn Invest. 1996 Oct;8(4):484-7. [DOI] [PubMed] [Google Scholar]
  8. Kapoor A, Mehta N, Dubovi EJ, Simmonds P, Govindasamy L, Medina JL, Street C, Shields S, Lipkin WI. Characterization of novel canine bocaviruses and their association with respiratory disease. J Gen Virol. 2012 Feb;93(Pt 2):341-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Lau SKP, Woo PCY, Yeung HC, Teng JLL, Wu Y, Bai R, Fan RYY, Chan KH, Yuen KY. Identification and characterization of bocaviruses in cats and dogs reveals a novel feline bocavirus and a novel genetic group of canine bocavirus. J Gen Virol. 2012 Jul;93(Pt 7):1573-82. [DOI] [PubMed] [Google Scholar]
  10. Macartney L, Parrish CR, Binn LN, Carmichael LE. Characterization of minute virus of canines (MVC) and its pathogenicity for pups. Cornell Vet. 1988 Apr;78(2):131-45. [PubMed] [Google Scholar]
  11. Manteufel J, Truyen U. Animal bocaviruses: A brief review. Intervirology. 2008;51(5):328-34. [DOI] [PubMed] [Google Scholar]
  12. Martella V, Lanave G, Mihalov-Kovacs E, Marton S, Varga-Kugler R, Kaszab E, Di Martino B, Camero M, Decaro N, Buonavoglia C, Banyai K. Novel parvovirus related to primate bufaviruses in dogs. Emerg Infect Dis. 2018 Jun;24(6):1061-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Mochizuki M, Hashimoto M, Hajima T, Takiguchi M, Hashimoto A, Une Y, Roerink F, Ohshima T, Parrish CR, Carmichael LE. Virologic and serologic identification of minute virus of canines (Canine parvovirus type 1) from dogs in Japan. J Clin Microbiol. 2002 Nov;40(11):3993-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Mohan Raj J, Mukhopadhyay HK, Thanislass J, Antony PX, Pillai RM. Isolation, molecular characterization and phylogenetic analysis of canine parvovirus. Infect Genet Evol. 2010 Dec;10(8):1237-41. [DOI] [PubMed] [Google Scholar]
  15. Ntafis V, Xylouri E, Kalli I, Desario C, Mari V, Decaro N, Buonavoglia C. Characterization of Canine parvovirus 2 variants circulating in Greece. J Vet Diagn Invest. 2010 Sep;22(5):737-40. [DOI] [PubMed] [Google Scholar]
  16. Ohshima T, Kawakami K, Abe T, Mochizuki M. A minute virus of canines (MVC: canine bocavirus) isolated from an elderly dog with severe gastroenteritis, and phylogenetic analysis of MVC strains. Vet Microbiol. 2010 Oct 26;145(3-4):334-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Ozkul A, Keles I, Karaoglu T, Cabalar M, Burgu I. Detection and RFLP analysis of canine parvovirus (CPV) DNA by polymerase chain reaction (PCR) in a dog. Turk J Vet Anim Sci. 2002;26(5):1201-3. [Google Scholar]
  18. Pratelli A, Buonavoglia D, Tempesta M, Guarda F, Carmichael L, Buonavoglia C. Fatal Canine parvovirus type-1 infection in pups from Italy. J Vet Diagn Invest. 1999 Jul;11(4):365-7. [DOI] [PubMed] [Google Scholar]
  19. Sahna KC, Gencay A, Atalay O. Viral aetiology of diarrhoea in puppies from a same shelter in Turkey: Presence of mixed infections. Revue Méd Vét. 2008;159(6):345-7. [Google Scholar]
  20. Timurkan M, Oguzoglu T. Molecular characterization of canine parvovirus (CPV) infection in dogs in Turkey. Vet Ital. 2015 Jan-Mar;51(1):39-44. [DOI] [PubMed] [Google Scholar]
  21. Torun S, Yilmaz Z. A serological evidence of minute virus of canines (MVC; Canine parvovirus type-1) in dogs in Turkey. Turk J Vet Anim Sci. 2005;29(3):923-5. [Google Scholar]
  22. Touihri L, Bouzid I, Daoud R, Desario C, El Goulli AF, Decaro N, Ghorbel A, Buonavoglia C, Bahloul C. Molecular characterization of Canine parvovirus-2 variants circulating in Tunisia. Virus Genes. 2009 Apr;38(2):249-58. [DOI] [PubMed] [Google Scholar]
  23. Truyen U, Wolf G, Carmichael LE. Das “andere” Parvovirus: Erstbeschreibung des Minute Virus of Canines (Canines parvovirus typ 1) in Deutschland [The “other” parvovirus: First description of the minute virus of canines (Canine parvovirus type 1) in Germany]. Tierarztl Prax. 1996 Oct;24(5):511-3. German. [PubMed] [Google Scholar]
  24. Yesilbag K, Yilmaz Z, Ozkul A, Pratelli A. Aetiological role of viruses in puppies with diarrhoea. Vet Rec. 2007 Aug 4;161(5):169-70. [DOI] [PubMed] [Google Scholar]
  25. Yi L, Tong M, Cheng Y, Song W, Cheng S. Phylogenetic analysis of canine parvovirus VP2 gene in China. Transbound Emerg Dis. 2016 Apr;63(2):e262-9. [DOI] [PubMed] [Google Scholar]

Articles from Veterinární Medicína are provided here courtesy of Czech Academy of Agricultural Sciences

RESOURCES