Mesenchymal stem cell-derived exosomal CBLB ameliorates infantile pneumonia progression probably by ubiquitinating MAPK14

Abstract

Background

Infantile pneumonia (IP) is a significant cause of morbidity and mortality in young children. Mesenchymal stem cells (MSCs) have emerged as potential therapeutic agents in pneumonia due to their immunomodulatory properties. The study analyzed the role of MSCs from bone marrow in IP and the underlying mechanism.

Methods

Human embryonic lung fibroblasts (WI-38) were stimulated using lipopolysaccharide (LPS) to mimic an IP cell model. This study employed flow cytometry to analyze the expression of hematopoietic markers and marker proteins on MSCs. The differentiation potential of MSCs was assessed through microscopy, oil red O staining, and alkaline phosphatase (ALP) assays. The localization of exosomes in WI-38 cells was observed using the cell membrane green fluorescent probe DIO. Quantitative reverse transcription polymerase chain reaction (qRT-PCR), western blotting and immunohistochemistry assays were used to analyze the expression of mRNA or protein. Cell viability, proliferation, and apoptosis were evaluated using Cell counting kit-8, 5-Ethynyl-2’-deoxyuridine, and flow cytometry assays, respectively. Enzyme-linked immunosorbent assays were conducted to measure cytokine levels. A mouse model of pneumonia was utilized to assess the therapeutic potential of MSC-derived exosomes on lung injury. Co-immunoprecipitation (Co-IP) assay was performed to study the interaction between Cbl proto-oncogene B (CBLB) and mitogen-activated protein kinase 14 (MAPK14).

Results

MSC-derived exosomes could be transferred into LPS-induced WI-38 cells, where they mitigated the inhibitory effects of LPS on CBLB mRNA expression. These exosomes improved WI-38 cell proliferation, reduced apoptosis, and decreased the production of pro-inflammatory cytokines including IL-6, IL-1β, and TNF-α by regulating CBLB after LPS treatment. Moreover, in a mouse model, MSC-derived exosomes protected against LPS-induced lung injury, whereas the effect was reversed after treatment with the exosomes isolated from CBLB-deficient MSCs. In addition, CBLB was found to destabilize MAPK14 protein expression in WI-38 cells. Further, overexpression of CBLB ameliorated LPS-induced inhibitory effect on cell proliferation and promoting effects on cell apoptosis and inflammation in WI-38 cells by regulating MAPK14.

Conclusion

MSC-derived exosomal CBLB has therapeutic potential in ameliorating the progression of IP probably by ubiquitinating MAPK14, which could lead to novel clinical interventions for treating this condition.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12950-025-00450-0.

Introduction

Pneumonia is a type of lung parenchymal infectious inflammation caused by a variety of pathogens such as bacteria and viruses [1]. Pneumonia is believed to be responsible for the deaths of 750,000 to 1.2 million newborns each year, which constitutes around 10% of the total mortality rate among children globally [2]. Infantile pneumonia (IP) has a high prevalence and tends to have a longer course of illness, with some children easily developing severe conditions, affecting multiple systems, and potentially leading to multiple organ failure, ultimately resulting in the death of the child [3]. These issues have led to increasing attention being paid to infantile pneumonia in pediatric diseases. Despite significant advancements in the diagnostic techniques and treatment methods for IP in recent years, pneumonia remains a major challenge to the health of children globally [4, 5]. In light of this, medical researchers urgently need to explore new and more targeted treatment strategies in the hope of more effectively treating IP.

Stem cells and their derivatives have been proven to be an effective method for treating pneumonia [6]. These therapies not only specifically inhibit the inflammatory response caused by pneumonia but also enhance the body’s immune function against bacteria and viruses. These comprehensive effects significantly reduce the clinical severity of pneumonia, offering new strategies and hope for the treatment of this condition. Mesenchymal stem cells (MSCs) are a class of stem cells that were distinguished by their convenient harvesting, robust proliferative capabilities, low immunogenicity, susceptibility to genetic modification, and potent differentiation potential [7]. Exosomes (EXOs) are nanosized vesicles and are secreted into the extracellular environment through cellular processes. Bone marrow-derived MSCs (BMSCs) are particularly rich in exosomes, and those exosomes have emerged as promising candidates for use as delivery vehicles [8]. The application of exosomes derived from MSCs (MSC-Exos) holds great promise as a treatment modality for a wide range of benign and malignant diseases such as chronic osteomyelitis [9] and pneumonia [10]. Consequently, exploring the role and underlying mechanisms of exosomes originating from BMSCs in the progression of IP is of profound importance for its treatment.

Ubiquitination is an important post-translational modification process and its primary function is to mark intracellular proteins for degradation [11]. The Cbl proto-oncogene B (CBLB), as a RING finger-type E3 ubiquitin ligase, can direct the ubiquitination of a variety of signaling proteins [12]. CBLB is central to the ubiquitination of downstream signaling proteins of immune receptors. Through this mechanism, it effectively inhibits positive signaling cascades, thereby regulating immune responses and maintaining the stability of the intracellular environment [13]. In particular, previous evidence has shown that CBLB inhibits CD8⁺ T cell responses to protect against fungal pneumonia [14], indicating its importance in regulating pneumonia progression.

The MAPK pathway is a pivotal route in cellular signal transduction, responsible for transmitting signals from the cell surface to the nucleus. This pathway encompasses several major subfamilies, such as p38 MAPK, and c-jun-N-terminal kinases [15, 16]. Among them, MAPK14 is a significant member of the p38 MAPK family and is activated through dual phosphorylation at its TGY motif within the activation loop [17]. As the most prevalent and prototypical isomer, MAPK14 plays a crucial role in a multitude of physiological processes and pathological conditions, including cell proliferation, apoptosis, and inflammatory responses [18]. The exciting data also indicated its participation in pneumonia progression [19].

Thus, the study investigated the role of BMSC-derived exosomes in IP progression. The study proposed that CBLB and MAPK14 might be involved in the regulation of BMSC-derived exosomes in IP progression. The hypothesis was confirmed using in vitro and in vivo models, and the study provided novel insight into the treatment of IP using MSC-derived exosomes.

Materials and methods

Cell culture

Human embryonic lung fibroblasts (WI-38, EK-Bioscience, Shanghai, China) and bone marrow mesenchymal stem cells (MSCs) were cultured in DMEM (L110KJ, EK-Bioscience, Think-Far Technology Co., Ltd., Beijing, China) added with 10% fetal bovine serum (FBS, SH30079.02, Lianshuo Biotech, Shanghai, China) and 1% penicillin/streptomycin (BW41610024, Spectrum Chemical Manufacturing Corp, Shanghai, China) at 37˚C with 5% CO₂. Observation of the morphology and growth of BMSCs was performed under a microscope, followed by photographing and preservation.

Cell transfection

The small hairpin RNA of CBLB (sh-CBLB), CBLB overexpression plasmid (pc-CBLB), and MAPK14 overexpression plasmid (oe-MAPK14) were provided by GenePharma (Shanghai, China). WI-38 cells or mesenchymal stem cells (MSCs) were seeded into 12-well plates after trypsinization. Cell transfection was performed when the cell density reached 70–80%. Two EP tubes were taken and filled with Opti-MEM (31985070, Solarbio, Beijing, China), to one of which Lipofectamine 3000 (L3000150, Thermo Fisher, Waltham, MA, USA) was added, and to the other, the plasmid or shRNAs were added. The original medium in the 12-well plates was aspirated, and the mixtures were added to culture plates for transfection. Subsequent experimental treatments were then carried out as required.

Exosome isolation and identification

MSCs cultured in a complete DMEM medium (L110KJ, EK-Bioscience) or MSCs transfected with sh-NC or sh-CBLB were used for exosome isolation through the differential centrifugation method [20]. The isolated pellets were identified by western blotting analysis of exosome marker proteins (CD9, CD81, and TSG101).

The exosome suspension was dropped onto the carbon grid that had been fixed in place. The excess exosome suspension was blotted dry with filter paper. Twenty microliters of 2% phosphotungstic acid (Amresco-0371-500G, Ybiotech, Shanghai, China) were then applied to the carbon grid and left to stand for 20 s. The excess phosphotungstic acid was blotted dry, and the carbon grid was then placed in a glass dish and observed under a transmission electron microscope (TEM, Thermo Fisher). Additionally, the size of MSC exosomes was measured using a nanoparticle tracking analyzer (NTA, Horiba, Shanghai, China).

Cell treatment

WI-38 cells were exposed to a concentration of 10 µg/mL of lipopolysaccharide (SigmaL-2880, LPS, Lianshuo Biotech) for a duration of 24 h to establish an in vitro IP model. This exposure was designed to mimic the inflammatory conditions that might occur in a biological system during IP. Furthermore, a population of WI-38 cells, consisting of 5 × 10⁵ individual cells, was then incubated in the presence of 2 µg of exosomes, followed by LPS stimulation. The purpose of this incubation was to investigate and determine the subsequent effects that these exosomes might have on the gene expression profiles and the overall cellular functions of the LPS-induced WI-38 cells. To determine whether MSC-derived exosomes could be transferred into WI-38 cells, the exosomes were incubated with cell membrane green fluorescent probe DiO (EXOPDiO20-1, Rengen Biosciences, Chenyang, China) at 37 °C for 15 min and then added to WI-38 cells for 48 h, followed by observation under a microscope.

Flow cytometry analysis

The cells from each group were collected and prepared into single-cell suspensions. The cells were incubated with PE-conjugated fluorescent antibodies against CD11b (E-AB-F1081D, Elabscience, Wuhan, China), CD45 (E-AB-F1137D, Elabscience), CD34 (E-AB-F1143D, Elabscience), CD105 (E-AB-F1310D, Elabscience), CD90 (E-AB-F1167D, Elabscience), and CD73 (E-AB-F1242D, Elabscience). Subsequently, the cells were resuspended in PBS (P1020, Solarbio) and analyzed using a flow cytometer.

Oil red O staining

MSCs were seeded into 6-well plates that had been pre-coated with 0.1% gelatin (Amresco-9764-100G, Ybiotech). When the cell confluence reached over 90%, DMEM medium containing dexamethasone (BioVision-1042-10G, Ybiotech), 5 mg/L insulin (PA126938, Think-Far Technology Co., Ltd), 0.5 mmol/L 3-Isobutyl-1-methylxanthine (3-Isobutyl-1-methylxanthine, ybiotech), and 60 µmol/L indomethacin (Cayman-70270-25000, ybiotech) was added to the 6-well plates. After approximately 2 weeks, cell treatment was performed using the Oil Red staining Kit (AY1515, AngYu Biotech, Shanghai, China), and the cells were observed and photographed.

Alkaline phosphatase (ALP) staining

MSCs were induced for osteogenesis in a DMEM medium containing 10⁷ mol/L dexamethasone (BioVision-1042-10G, Ybiotech), 50 µg/L vitamin C (ab75764, Khayal Bio-Technology Co., Ltd., Wuhan, China), and 2 mmol/L β-Glycerophosphate disodium salt pentahydrate (HY-D0886, MedChemExpress, Princeton, NJ, USA) for 14 days. The culture medium in the well plates was removed, and the cells were fixed with 4% paraformaldehyde, followed by processing using the ALP staining kit (CTCC-JD002, PH Biotechnology, Jiangyin, China). After removing the distilled water, the samples were photographed under a microscope.

Western blotting assay

RIPA lysis buffer prepared using phenylmethanesulfonyl fluoride (ST2573, Beyotime, Shanghai, China) and phosphatase inhibitors (P1082, Beyotime) was added to cells or exosomes for protein isolation. The lysates were incubated at 95˚C for 10 min and then subjected to electrophoresis. The protein bands were transferred onto polyvinylidene fluoride membranes. The membranes were incubated with the antibodies against TNF-α (ab183218, 1:1000, Abcam), CD9 (ab236630, 1:1000, Abcam), CD81 (ab109201, 1:5000, Abcam), TSG101 (ab125011, 1:3000, Abcam), Calnexin (ab22595, 1:1000, Abcam), CBLB (ab315021, 1:1000, Abcam), IL-6 (ab233706, 1:1000, Abcam), MAPK14 (ab170099, 1:2000, Abcam), GAPDH (ab9485, 1:2500, Abcam), and IL-1β (ab283818, 1:1000, Abcam). After incubation with the secondary antibody (ab6721, 1:5000, Abcam), the membranes were placed onto filter paper to absorb the moisture and then transferred to the tray of the imaging apparatus. The ECL chemiluminescence kit (P0018M, Beyotime) was used to evenly apply the developing solution onto the bands, and the imaging was performed with the results being photographed for preservation.

Quantitative real-time polymerase chain reaction (qRT-PCR)

Following the instructions of the RNAiso Plus reagent (9108, TaKaRa, Dalian, China), the study isolated RNA. After quantification with a NanoDrop 2000 (Thermo Fisher), RevertAid cDNA synthesis reagents (K1691, Thermo Fisher) were used to obtain cDNA. Real-time fluorescence quantification was carried out utilizing primers (shown in Table 1) and SYBR Green reagent (11762500, Thermo Fisher). Gene expression was analyzed using the 2^−ΔΔCt formula.

Table 1.

Primer sequences used for qRT-PCR

Name	Primers for qRT-PCR (5’−3’)
GAPDH	ForwardAATGGGCAGCCGTTAGGAAA
	ReverseGCGCCCAATACGACCAAATC
IL-1β	ForwardCAGAAGTACCTGAGCTCGCC
	ReverseAGATTCGTAGCTGGATGCCG
IL-6	ForwardTGAACTCCTTCTCCACAAGCG
	ReverseGGGCGGCTACATCTTTGGAA
TNF-α	ForwardCTTCTCGAACCCCGAGTGAC
	ReverseTGAGGTACAGGCCCTCTGAT
CBLB	ForwardACCCAGTGCTTATGCGGAAA
	ReverseGCTAGGGAGGAGGGTGGTAA
MAPK14	ForwardCGAGCGTTACCAGAACCTGT
	ReverseTCAGATCTGCCCCCATGAGA

Cell counting kit-8 (CCK-8) assay

WI38 cells were treated accordingly based on the different experimental purposes. CCK-8 solution (C0038, Beyotime) was added to each well, ensuring no bubbles were present to prevent the OD readings from being affected. After an incubation period of 1 to 4 h, the absorbance was measured at 450 nm using a microplate reader.

5-Ethynyl-2’-deoxyuridine (EdU) assay

An appropriate number of WI-38 cells were cultured in 96-well plates and incubated overnight. The EdU working solution (ST067, Beyotime) was added to the wells in an equal volume to the culture medium. 4% paraformaldehyde was added to each well for fixation for 15 min. 0.3% Triton X-100 was added for incubation. After aspirating out the washing solution, 4’,6-Diamidino-2-Phenylindole (C1002, Beyotime) was added. Fluorescence detection was performed under a fluorescence microscope.

Cell apoptosis analysis

WI-38 cells were transfected and treated with MSC-derived exosomes. The cells were digested with trypsin and then the digestion was stopped by adding a complete medium containing FBS. These cells were then prepared into a cell suspension and distributed into flow cytometry tubes. ANNEXIN V-FITC/PI apoptosis detection kit (CA1020, Solarbio). Annexin V-FITC (Solarbio) was added to the cell suspension and incubated. The cell pellets were resuspended in PBS buffer, and propidium iodide (PI, Solarbio) staining was added for a 5-minute incubation. The cells were placed in a flow cytometer to detect the fluorescence intensity.

Enzyme-linked immunosorbent assays (ELISAs)

The production of pro-inflammatory cytokines including IL-6, IL-1β, and TNF-α in cell supernatant or serum samples was analyzed using the ELISA kits (PI330, PI326, PI305, PI301, PT518, and PT512, Beyotime). The optical density values at 450 nm wavelength were measured using a microplate reader.

Animal experiment

C57BL/6JNifdc mice (male, 6–8 weeks old) used in this experiment were sourced from Hunan Slyke Jingda Experimental Animal Co., LTD (Changsha, China). All mice were SPF-grade and were modeled in the animal facility of Jinan City People’s Hospital. Twenty C57BL/6 mice were randomly divided into four groups: control (CON), model (LPS), LPS + MSC_sh−NCEXO, and LPS + MSC_sh−CBLBEXO, with five mice in each group. The mice were then administered a single intratracheal instillation of LPS (SigmaL-2880, 5 mg/kg, Lianshuo Biotech) [21] or physiological saline. Four hours after LPS exposure, the mice were intravenously injected with 50 µL of exosomes extracted from MSCs transfected with sh-NC or sh-CBLB. Twenty-four hours later, the mice were euthanized by intraperitoneal injection of 40 mg/kg pentobarbital sodium (P3761, Lianshuo Biotech) followed by cervical dislocation. Lung tissue and serum samples were collected from the mice. The study was approved by the Animal Care and Use Committee of Jinan City People’s Hospital.

Haematoxylin and Eosin (HE) staining

The assay was performed according to the guidebook of the HE staining kit (G1120, Solarbio). The lung tissues of mice were placed in 4% paraformaldehyde solution for fixation, with a duration of at least 24 h. The sections were sequentially placed in xylene and ethanol solutions. Staining was performed with hematoxylin, followed by counterstaining with bluing reagent, and a 10-second water rinse. After staining with eosin, the sections were sequentially incubated in alcohol, ethanol, and xylene for 5 min each. The sections were observed under a light microscope for lung tissue morphology.

Masson staining assay

The assay was performed using the Masson Stain Kit (60532ES66, Yeasen, Shanghai, China) to visualize collagen and muscle fibers within tissue samples. In brief, the lung tissue sections of model mice were stained in Weigert’s iron hematoxylin solution for 60 s. The sections were then slightly washed with running water and stained with ponceau-fuchsin solution. The sections were differentiated in 1% phosphomolybdic acid solution for 8 min. Aniline blue counterstain solution was added for staining for 5 min. After rinsing with absolute ethanol, the sections were mounted with neutral gum. Microscopic observation and photography were performed.

Co-immunoprecipitation (Co-IP) assay

The assay was performed using the Co-Immunoprecipitation Kit (WLA112a, Wanleibio, Shenyang, China). WI-38 cells were cultured in 6-well plates, and the cells were collected into EP tubes when the density reached approximately 90%. After centrifugation, the cell pellets were lysed with RIPA lysis buffer (P0013B, Beyotime). The mixtures were then centrifuged at 12,500 rpm at 4 °C. Thirty micrograms of protein were taken as a positive control Input. Based on the antibody instructions, the primary antibodies against MAPK14 (ab170099, 1:100, Abcam) and CBLB antibody (A302-902 A, 1:200, Thermo Fisher) as well as IgG antibody were added to the remaining proteins. The following day, Protein A + G Agarose was added, and the mixtures were gently rotated at 4 °C for 4 h. The collected pellets were subjected to SDS-polyacrylamide gel electrophoresis using CBLB (ab315021, 1:1000, Abcam), MAPK14 (ab170099, 1:2000, Abcam), and UB antibody (58395, 1:1000, CST, Boston, MA, USA).

Protein stabilization analysis

WI-38 cells transfected with sh-NC or sh-CBLB for 48 h were digested with trypsin to prepare a cell suspension. The cell suspension was seeded into 24-well plates and placed in an incubator for continued culture. Cycloheximide (50 ng/mL, CHX, 239763-M, Sigma, St. Louis, MO, USA) was added to inhibit protein synthesis, and time points of 0, 3, 6, and 12 h were set for both cell types. The cells were harvested and western blotting analysis was conducted to assess the stability of MAPK14 protein.

Statistical analysis

Experimental data were analyzed statistically using GraphPad Prism software version 8.0. For data that were continuous and normally distributed, the mean ± standard deviation was used to represent the values. Comparison between two groups of data was performed using Student’s t-test, while comparisons among multiple groups were conducted using one-way ANOVA. P < 0.05 was considered statistically significant.

Results

MSC-derived exosomes could be transferred into LPS-induced WI-38 cells to regulate CBLB expression

The study identified the MSCs by analyzing the hematopoietic markers (CD11b, CD45 and CD34) and MSC characterization proteins (CD105, CD90, and CD73) by flow cytometry. As shown in Fig. 1A and B, these hematopoietic markers were negative and MSC characterization proteins were positive. In addition, the study identified the MSCs by observing their morphology and abilities to differentiate into adipocytes and osteoblasts. The results showed that these cells exhibited a spindle-shaped morphology (Fig. 1C). Moreover, when cultured in the appropriate induction medium, they stained positive for oil red and ALP (Fig. 1C), indicating that the MSCs demonstrated the ability to differentiate into adipocytes and osteoblasts. The study then identified the exosomes isolated from MSCs. As shown in Fig. 1D and E, the vesicles showed similar morphology to exosomes and had sizes concentrated in the range of 60–160 nm. The western blotting assay also showed that the exosome marker proteins, including CD9, CD81, and TSG101, were detected positively in these vesicles derived from MSCs, whereas the expression of calnexin, a transmembrane protein within cells, was not observed (Fig. 1F). These results showed that the isolated vesicles from MSCs were exosomes. Our results also showed that the exosomes could be transferred into MI-38 cells (Fig. 2A). The study analyzed the genes highly expressed in MSCs using the GSE40613 dataset, as well as the genes lowly expressed in pneumonia cells through the analysis of GSE40012. Subsequently, a Venn diagram was used to filter the intersection of the two. The results indicated that CBLB was one of the genes in the intersection (Fig. 2B). Subsequently, the results showed that LPS treatment reduced CBLB expression at mRNA and protein levels, whereas these effects were attenuated after treatment with MSC-derived exosomes (Fig. 2C and D). Further, the study analyzed the effect of the exosomes derived from CBLB-deficient MSCs on CBLB expression in LPS-induced WI-38 cells. The efficiency of CBLB knockdown in MSCs is shown in Fig. 2E. As shown in Fig. 2F, we discovered that CBLB protein expression was downregulated after incubation of LPS-induced WI-38 with the exosomes derived from CBLB-deficient MSCs. Thus, MSC-derived exosomes could be transferred into LPS-induced WI-38 cells to upregulate CBLB expression.

Fig. 1.

The identification of MSCs and the exosomes isolated from MSCs. A and B Flow cytometry analysis was performed to analyze the expression of hematopoietic markers of MSCs (CD11b, CD45 and CD34) and their marker proteins (CD105, CD90, and CD73). C The morphology of MSCs and their abilities to differentiate into adipocytes and osteoblasts were observed or analyzed using a microscope, oil red O staining experiment, and ALP assay. D-F The identification of the isolated exosomes from MSCs by TEM, NTA analysis and western blotting assay

Fig. 2.

MSC-derived exosomes could be transferred into LPS-induced WI-38 cells to regulate CBLB expression. A The exosomes from MSCs were labeled with cell membrane green fluorescent probe DIO and then incubated with MSCs, followed by observation under a microscope. B The study analyzed the genes highly expressed in mesenchymal stem cells using the GSE40613 dataset, as well as the genes lowly expressed in pneumonia cells through the analysis of GSE40012. Subsequently, a Venn diagram was used to filter the intersection of the two. C and D The effects of MSC-derived exosomes on the mRNA and protein levels of CBLB were analyzed by qRT-PCR or western blotting assay. E The efficiency of CBLB knockdown was analyzed by western blotting assay in MSCs. F The effect of CBLB-deficient exosomes from MSCs on CBLB protein expression was analyzed by western blotting assay in LPS-induced WI-38 cells. ***P < 0.001

MSC-derived exosomes could ameliorate LPS-induced effects on WI-38 cell proliferation, apoptosis and inflammation by regulating CBLB

The research then investigated whether exosomes derived from MSCs could transfer CBLB to WI-38 cells to modulate LPS-induced cellular damage. For this purpose, WI-38 cells were incubated with exosomes that had been isolated from BMCs transfected with sh-NC or sh-CBLB, followed by exposure to LPS. The findings revealed that LPS treatment significantly reduced the viability and proliferation of WI-38 cells and induced apoptosis. These detrimental effects were mitigated when the cells were treated with exosomes isolated from BMCs transfected with sh-NC (Fig. 3A-C). Conversely, the protective effects conferred by the exosomes from sh-NC-transfected BMCs were reversed when WI-38 cells were incubated with exosomes from sh-CBLB-transfected BMCs (Fig. 3A-C). Furthermore, the study demonstrated that LPS stimulation enhanced the secretion of pro-inflammatory cytokines, including IL-6, IL-1β, and TNF-α, but this inflammatory response was partially alleviated by treatment with exosomes from sh-NC-transfected BMCs (Fig. 4A-C). However, the attenuation of the inflammatory response induced by exosomes from sh-NC-transfected BMCs was negated when WI-38 cells were treated with exosomes from sh-CBLB-transfected BMCs (Fig. 4A-C). Thus, MSC-derived exosomes protected against LPS-induced cellular injury in WI-38 cells by regulating CBLB.

Fig. 3.

MSC-derived exosomes could ameliorate LPS-induced effects on WI-38 cell proliferation and apoptosis by regulating CBLB. WI-38 cells were incubated with exosomes that had been isolated from BMCs transfected with sh-NC or sh-CBLB, followed by exposure to LPS. The WI-38 cells treated with PBS were used as a control. A Cell viability was analyzed by CCK-8 assay. B Cell proliferation was analyzed by EdU assay. C Cell apoptosis was assessed by flow cytometry. *P < 0.05, **P < 0.01 and ***P < 0.001

Fig. 4.

MSC-derived exosomes could ameliorate LPS-induced effects on inflammation in WI-38 cells by regulating CBLB. WI-38 cells were incubated with exosomes that had been isolated from BMCs transfected with sh-NC or sh-CBLB, followed by exposure to LPS. The WI-38 cells treated with PBS were used as a control. A ELISAs were performed to detect the levels of IL-6, IL-1β, and TNF-α in cell supernatant. B The mRNA levels of IL-6, IL-1β, and TNF-α were analyzed by qRT-PCR in cells. C The protein levels of IL-6, IL-1β, and TNF-α were detected by western blotting assay. **P < 0.01 and ***P < 0.001

MSC-derived exosomes could protect against LPS-induced lung injury in mice by modulating CBLB

The study established a mouse model of pneumonia by administering a single LPS dose to mice to determine the effect of exosomes isolated from MSCs that were transfected with sh-NC or sh-CBLB on lung injury during pneumonia. After 2 weeks of exosome treatment, lung tissues and serum samples were harvested for HE, Masson, IHC and ELISA assays. As shown in Fig. 5A, the lung tissue structure of the normal control group mice remained intact with tightly arranged alveolar cells. In contrast, the lung tissue of the model group mice exhibited significant changes, including thickened alveolar walls and multiple instances of alveolar cavity collapse. The group treated with MSC_sh−NCEXO showed only slight inflammatory cell infiltration when compared to the model group, with lung tissue morphology more closely resembling the normal control group. However, compared to the MSC_sh−NCEXO treatment group, the MSC_sh−CBLBEXO+LPS group had more pronounced inflammatory cell infiltration, with the lung tissue structure more akin to that of the model group. In addition, the Masson staining assay (Fig. 5B) showed that the lung tissue sections of the control group mice showed tightly and regularly arranged structures with minimal fibrous deposition around the blood vessels. In the model group, the lung tissue morphology was disordered, with a large distribution of collagen fibers, collapsed alveolar spaces, and a significant aggregation of inflammatory cells around the alveolar walls. Compared to the model group, the MSC_sh−NCEXO treatment group showed a significant reduction in the blue area, with tissue morphology similar to that of the control group’s lung tissue. However, compared to the MSC_sh−NCEXO treatment group, the MSC_sh−CBLBEXO treatment group had a significant increase in the blue area, with tissue morphology resembling that of the model group’s lung tissue. We also discovered that the CBLB-positive expression rate of CBLB was decreased in the model group, however, its positive expression rate was increased in the MSC_sh−NCEXO treatment group when compared with the model group (Fig. 5C). However, its positive expression rate was lower in the MSC_sh−CBLBEXO treatment group in comparison with the MSC_sh−NCEXO treatment group (Fig. 5C). Further, we discovered that the serum levels of IL-6, IL-1β, and TNF-α were higher in the model group than in the control group and the MSC_sh−NCEXO treatment group, but their serum levels were lower in the MSC_sh−NCEXO treatment group than in the MSC_sh−CBLBEXO treatment group (Fig. 5D). Thus, MSC-derived exosomes protected against LPS-induced lung injury in mice by regulating CBLB expression.

Fig. 5.

MSC-derived exosomes could protect against LPS-induced lung injury in mice by modulating CBLB. A mouse model of pneumonia was established by administering a single LPS dose to mice to determine the effect of exosomes isolated from MSCs that were transfected with sh-NC or sh-CBLB on lung injury during pneumonia. After 2 weeks of exosome treatment, lung tissues were harvested for HE (A), Masson (B), and IHC (C) analyses, and serum samples were collected for ELISA analysis of IL-6, IL-1β, and TNF-α (D). **P < 0.01 and ***P < 0.001

CBLB destabilized MAPK14 protein expression through its ubiquitinating activity

The study performed a Venn diagram analysis to identify the intersection between genes highly expressed in pneumonia cells in the GSE40012 dataset and the 213 genes predicted to be regulated by CBLB in the UbiBrowser database. The result showed that MAPK14 was a candidate (Fig. 6A). Subsequently, the result showed that LPS treatment increased MAPK14 expression at the mRNA and protein levels in WI-38 cells (Fig. 6B and C). Moreover, the mRNA and protein expression of MAPK14 was downregulated after CBLB silencing in WI-38 cells (Fig. 6D and E). The Co-IP assay revealed that the CBLB antibody was capable of enriching MAPK14, and conversely, the MAPK14 antibody also effectively enriched CBLB in WI-38 cells (Fig. 6F). The results also showed that CBLB knockdown reduced the level of endogenous ubiquitinated MAPK14 (Fig. 6G). As shown in Fig. 6H, the degradation of MAPK14 protein was weakened after CBLB silencing. Further, we discovered that CBLB overexpression inhibited MAPK14 protein expression, whereas the effect was relieved after treatment of MG132, a proteasome inhibitor (Fig. 6I). Thus, CBLB accelerated MAPK14 degradation through the ubiquitination process.

Fig. 6.

CBLB destabilized MAPK14 protein expression through its ubiquitinating activity. A The study performed a Venn diagram analysis to identify the intersection between genes highly expressed in pneumonia cells in the GSE40012 dataset and the 213 genes predicted to be regulated by CBLB in the UbiBrowser database. B and C The effects of LPS treatment on the mRNA and protein levels of MAPK14 were analyzed by qRT-PCR or western blotting assay in WI-38 cells. D and E The effects of CBLB knockdown on the mRNA and protein levels of MAPK14 were analyzed by qRT-PCR or western blotting assay. F and G The Co-IP assay was performed to identify the association of CBLB and MAPK14. H The CHX assay was performed to analyze the effect of CBLB knockdown on the degradation of MAPK14 protein. I WI-38 cells were divided into three groups, including the pcDNA 3.1 group, the pc-CBLB group or the pc-CBLB + MG132 group, and the protein expression of MAPK14 and CBLB was detected by western blotting assay. ***P < 0.001

CBLB overexpression ameliorated LPS-induced cellular injury by regulating MAPK14 in WI-38 cells

The study further analyzed the effect of CBLB in LPS-induced cellular damage and its association with MAPK14 in the regulation of WI-38 cells. The result showed that LPS treatment promoted MAPK14 protein expression, whereas the effect was relieved after transfection with CBLB overexpression plasmid (Fig. 7A). Moreover, we discovered that CBLB overexpression counteracted the LPS-induced inhibitory effects on cell viability and proliferation and promoting effects on cell apoptosis as well as the levels of IL-6, IL-1β, and TNF-α (Figs. 7B-D and 8A-C). However, ectopic expression of CBLB induced these effects on MAPK14 protein expression, cell viability, cell proliferation, cell apoptosis, and the levels of IL-6, IL-1β, and TNF-α were relieved after transfection with MAPK14 overexpression plasmid (Figs. 7 and 8). Thus, CBLB protected WI-38 cells from LPS-induced injury by regulating MAPK14.

Fig. 7.

CBLB overexpression ameliorated LPS-induced effects on cell proliferation and apoptosis by regulating MAPK14 in WI-38 cells. WI-38 cells were divided into four groups, including the CON group (the cells treated with LPS), the LPS + vector group, the LPS + oe-CBLB group and the LPS + oe-CBLB + oe-MAPK14 group. A The protein expression of CBLB and MAPK14 was analyzed by western blotting assay. B Cell viability was analyzed by CCK-8 assay. C Cell proliferation was analyzed by EdU assay. D Cell apoptosis was assessed by flow cytometry. **P < 0.01 and ***P < 0.001

Fig. 8.

CBLB overexpression ameliorated LPS-induced effects on inflammation by regulating MAPK14 in WI-38 cells. WI-38 cells were divided into four groups, including the CON group (the cells treated with LPS), the LPS + vector group, the LPS + oe-CBLB group and the LPS + oe-CBLB + oe-MAPK14 group. A ELISAs were performed to detect the levels of IL-6, IL-1β, and TNF-α in cell supernatant. B The mRNA levels of IL-6, IL-1β, and TNF-α were analyzed by qRT-PCR in cells. C The protein levels of IL-6, IL-1β, and TNF-α were detected by western blotting assay. **P < 0.01 and ***P < 0.001

Discussion

IP is a severe acute infectious disease of the lung parenchyma, and it is a major threat to the lives and health of children in developing countries [22]. Bone marrow-derived MSC-Exos are a novel biological therapeutic vector that inherits the multifaceted biological functions of MSCs. These exosomes participate in intercellular communication and can effectively deliver biomolecules such as proteins, mRNA, and microRNA to target cells, thereby exerting therapeutic effects [23]. Therefore, MSC-Exos, as a cell-free therapeutic strategy, hold promise in replacing traditional cell therapy, opening up new avenues for the treatment of diseases [24]. This study aims to delve into the mechanism of action of bone marrow-derived MSC-Exos in the development of IP, with the hope of uncovering their potential value in the treatment of IP and providing practical guidance for clinical treatment. The study showed that MSC-derived exosomal CBLB ameliorated IP progression probably by ubiquitinating MAPK14.

MSC-derived exosomes have therapeutic potential in pneumonia. Previous data have shown that the exosomes isolated from MSCs attenuate murine cytomegalovirus-infected pneumonia through the regulation of the NF-κB/NLRP3 signaling [10]. Li et al.. reported that MSC-derived exosomes transferred miR-335-5p to protect against LPS-induced lung injury by modulating integrin subunit beta 4 [25]. Our findings aligned with these previous observations as we showed that MSC-derived exosomes could transfer CBLB into WI-38 cells. Notably, LPS treatment reduced CBLB expression both in vitro and in vivo, an effect that was mitigated by the administration of MSC-derived exosomes. Furthermore, our data indicated that MSC-derived exosomes protected against LPS-induced cellular injury in WI-38 cells and lung injury by regulating CBLB. CBLB is a ubiquitin ligase that has been reported to ameliorate pneumonia progression. For example, CBLB protected against fungal pneumonia by constraining inactivated CD8⁺ T cell responses [14]. Bachmaier et al.. showed that CBLB attenuated the sequestration of inflammatory cells in a LPS-induced lung injury model by regulating the association between toll-like receptor 4 [26]. In our study, we found that CBLB overexpression improved LPS-induced cellular injury through the regulation of MAPK14.

Subsequent results from our study demonstrated for the first time that CBLB accelerated the degradation of the MAPK14 protein through its ubiquitinating activity. MAPK14 is a critical signaling molecule in the inflammatory response associated with both viral (influenza A) and bacterial (LPS-induced) pneumonia. Previous studies have shown that modulating the activity of MAPK14, either directly or through upstream regulators like TNF receptor associated factor 6 and ubiquitin specific peptidase 7, can aggravate the inflammatory process in pneumonia [19, 27]. Our findings aligned with these studies by showing that CBLB protected against LPS-induced lung injury by reducing MAPK14 expression. Our results also extend the current understanding by indicating that MAPK14 exacerbates LPS-induced inhibition of cell proliferation and promotion of cell apoptosis, which is in line with the known role of MAPK14 in phosphorylating and inhibiting key cell cycle regulators, leading to cell cycle arrest [28], and inducing apoptosis through the activation of pro-apoptotic proteins like Bax and inhibition of anti-apoptotic proteins such as Bcl-2 [29]. In addition, our data revealed that MAPK14 promoted the secretion of pro-inflammatory cytokines including IL-6, IL-1β, and TNF-α after LPS treatment, thus inducing an inflammatory response. Thus, the ubiquitination of MAPK14 by exosomal CBLB may serve as a regulatory mechanism to counteract these effects induced by MSC-derived exosomal CBLB.

However, the study used the WI-38 human fibroblast cell line to model the effects of LPS-induced inflammation. While WI-38 cells are a common tool in respiratory research, they may not fully represent the complex environment and responses of actual lung tissue in vivo. Moreover, the use of CBLB-deficient MSCs to reverse the protective effects of exosomes is a strong experimental approach, but it does not rule out the possibility that other factors within the exosomes could also play a role in the observed effects.

Taken together, our study uncovered a novel mechanism wherein ubiquitination of MSC-derived exosomal CBLB targeted MAPK14 for degradation, thereby attenuating its activity and mitigating the effects on cell proliferation, apoptosis, and inflammation during IP. This discovery not only sheds light on the intricate pathology of IP but also opens avenues for innovative therapeutic interventions. In the context of therapeutic targeting, the challenges associated with directly modulating ubiquitination events necessitate alternative strategies. We propose the use of small RNA therapeutics as a feasible and innovative approach to regulate the CBLB/MAPK14 pathway. Drawing inspiration from recent studies, such as the potential of miR-510-3p as a therapeutic target in preeclampsia [30] and the involvement of various miRNAs in cancer carcinogenesis via the PTEN/PI3K/AKT axis [31], we suggest that specifically designed small interfering RNAs (siRNAs) or microRNAs (miRNAs) could effectively inhibit CBLB or enhance the ubiquitination of MAPK14. Moreover, the encapsulation of these small RNA molecules in exosomes offers a targeted delivery system, akin to the use of miR-7-3p as a biomarker and therapeutic target in head and neck cancer [32], ensuring specific targeting of cells involved in IP. In conclusion, our findings propose a novel therapeutic strategy that could alleviate the severity of IP, supported by a growing body of evidence on the efficacy of small RNA-based therapies in various diseases.

Authors’ contributions

F.G. and F.S. conducted the experiments and drafted the manuscript. Z.C. collected and analyzed the data. N.N. prepared figures. L.S. and M.Y. contributed the methodology and edited the manuscript. M.L. designed and supervised the study. All authors reviewed the manuscript.

Funding

None.

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethics approval and consent to participate

The study was approved by the Animal Care and Use Committee of Jinan City People’s Hospital.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.