Abstract
Background and Objectives
Human neutrophil antigen 2 (HNA‐2), encoded by the CD177 gene, is considered one of the most important neutrophil antigens in human medicine, but molecular testing of CD177 is complicated and therefore not a standard procedure for investigating CD177 expression. CD177 expression can vary from 0% to 100%, and to date, the molecular basis for altered or non‐expressed genes has not been determined. Reliance on phenotyping and crossmatching to investigate these neutropenic clinical cases is inconvenient for patients and demands substantial resources within the laboratory. The purpose of this study was therefore to test a new molecular testing approach based on long‐read nanopore sequencing.
Materials and Methods
DNA from 44 Danish blood donors with different levels of CD177 expression, 22 of whom were found to be CD177 null, was selected as test samples. All the DNA was sequenced for the first eight exons and the beginning of exon 9 of CD177.
Results
All incidences of CD177 null cases could be associated with the known variant c.787A>T;p.K263X (rs20182172), and a correlation was observed between c.787A>T heterozygosity and a reduced expression of CD177, which is consistent with previously published findings. The c.1291G>A;p.G431R (rs78718189) variant was found to be linked to the atypical expression of CD177. The nanopore assay revealed a total of 14 variants in 7 exons in the 44 tested samples.
Conclusion
On the basis of these observations, we conclude that long‐read nanopore sequencing can be a reliable tool for the routine laboratory molecular testing of CD177.
Keywords: CD177, genotyping, HNA‐2, nanopore sequencing
Highlights.
Long‐read nanopore sequencing is a reliable tool for CD177 genotyping.
All incidences of CD177 null cases were associated with the known variant c.787A>T.
The c.1291G>A variant was linked to atypical expression of CD177.
INTRODUCTION
Human neutrophil antigen 2 (HNA‐2) is encoded by the CD177 gene. CD177, located on chromosome 19, contains nine exons and two untranslated regions and encodes a 437‐amino‐acid protein. CD177 is a glycosylphosphatidylinositol (GPI)‐anchored protein [1, 2]. HNA‐2 antibodies are involved in numerous disorders, including autoimmune neutropenia (AIN), neonatal alloimmune neutropenia (NAIN) and haematopoietic stem cell graft failure [3, 4, 5, 6, 7, 8]. Additionally, HNA‐2 is considered one of the most important neutrophil antigens in human medicine because of its involvement in transfusion‐related acute lung injury (TRALI) and other transfusion‐related pulmonary reactions [9, 10, 11, 12]. HNA‐2 typically has a bimodal expression pattern with both CD177‐positive and ‐null populations. The percentages of HNA‐2‐positive neutrophils range from 0% to 100%. Approximately 3%–5% of European, Brazilian and North American populations do not express HNA‐2, while this frequency is reported to be >10% in French and Western Japanese populations [13, 14]. Individuals who have HNA‐2 non‐expression, also referred to as HNA‐2 null individuals, are at risk of producing HNA‐2 isoantibodies when the HNA‐2 antigen is introduced through transfusion, pregnancy or bone marrow transplantation. The primary genetic mechanism of HNA‐2 null and HNA‐2 expression variation is caused by the nonsense single‐nucleotide polymorphism (SNP) c.787A>T;p.K263X (rs201821720), which is located in exon 7 [15]. Another SNP, c.1291G>A;p.G431R (rs78718189) in exon 9 of CD177, has been associated with the absence of the CD177 protein in c.787A>T heterozygous individuals, as well as with atypical expression of the HNA‐2 antigen on the neutrophil surface (three peaks: one negative peak and two positive peaks). The CD177 protein contains a short stretch of hydrophobic amino acids that forms the GPI signal. The polymorphism c.1291G>A is located within the carboxy‐terminal hydrophobic region of CD177. The amino acid change from glycine to arginine may affect the hydrophobicity of the CD177 GPI signal, leading to the destabilization of the CD177 protein from the neutrophil surface [16]. The c.787A‐c.1291A haplotype could lead to reduced HNA‐2 expression levels and/or the absence of HNA‐2 expression in human subjects [16]. Copy number variation (CNV) is rare for CD177, and three copies have been found in approximately 5%, whereas 0% have been found to have zero copies of the gene, even though you would expect there to be equilibrium between copy numbers [15]. Factors other than genetic variations in the coding regions of the CD177 gene have been associated with the expression of CD177, including DNA methylation [17] and polymorphisms in the promoter region of transcription factor binding sites [18]. A recent study revealed an association of the CD177 null cell fraction with CpG methylation in the regulatory promoter region [19], but another confirmed the presence of CD177 messenger RNA (mRNA) in both CD177‐positive and CD177 null neutrophils, indicating the presence of an active gene in both subpopulations. Sequencing of CD177 mRNA revealed identical sequences in both subpopulations, rejecting gene silencing as the mechanism [14].
Most laboratories determine CD177 expression with flow cytometry only, and a survey of HNA investigations published by Bayat et al. in 2023 revealed that only 5 out of 17 laboratories performed molecular testing of HNA‐2 [20]. Molecular approaches are complicated by a pseudogene (CD177P1), which is highly homologous to exons 4–9 of CD177 but located on the opposite (minus) strand (Figure 1) [21, 22, 23]. Because of this, the most common way to determine HNA‐2 genotypes is to use long‐read polymerase chain reaction (PCR) to produce a long template for further investigation with either PCR‐sequence‐specific primers (PCR‐SSP) or PCR‐sequence‐based typing (PCR‐SBT) [15, 22, 23, 24, 25]. However, two rounds of PCR increase the risk of contamination during transferring first‐round amplification products to a second tube and demand more hands‐on time.
FIGURE 1.

The structure and proximity of the CD177 and CD177P1 genes, and an illustration of the current amplification and testing strategies to obtain specificity for CD177, as well as the one proposed in this study.
MATERIALS AND METHODS
Study cohort
A total of 44 samples representing as diverse a collection of phenotypes as possible were selected for sequencing. The 44 samples consisted of 22 CD177‐positive (AAL_001 to AAL_022) and 22 CD177‐null (AAL_023 to AAL_044) samples. The positive samples were selected because they presented the highest range of neutrophil expression, ranging from 18% to 85% positive cells (examples of flow‐GIFT patterns in Figure 2a,b). Five of the 22 positive samples (AAL_040 to AAL_044) presented an atypical expression pattern with two positive peaks (Figure 2c). Using the same criteria as those used in the literature [26], donors for whom fewer than 5% of granulocytes were positive according to flow cytometry analysis were called CD177‐null (Figure 2d). The Department of Clinical Immunology is the national centre for diagnostic neutrophil testing in Denmark and was the centre for sample collection in this study. All the samples were collected from healthy Danish blood donors, and the 22 CD177‐null samples were collected by screening >500 blood donors at different times. Written and oral informed consent from the participants were obtained according to the Danish Health Care Act and in accordance with the Declaration of Helsinki.
FIGURE 2.

Examples of flow cytometry graphs when testing for CD177 with MEM‐166 staining. (a) 18% positive. (b) 85% positive. (c) Atypical expression. (d) Null.
HNA‐2 phenotyping
The samples used to test the long‐read nanopore sequencing assay were selected on the basis of their HNA‐2 phenotyping. The expression of HNA‐2 and the percentage of HNA‐2‐positive neutrophils were determined with an in‐house flow granulocyte immunofluorescence test (Flow‐GIFT) using phycoerythrin (PE) mouse anti‐human CD177, MEM‐166 (BD Biosciences). Leukocytes stained with either the PE‐conjugated anti‐CD177 monoclonal antibody (MEM‐166, mouse IgG1 [mIgG1]) (BD Biosciences, NJ, USA) or the mIgG1‐PE isotype control were analysed on a FACS Canto flow cytometer (BD Biosciences, NJ, USA) or NovoCyte 3000 flow cytometer (ACEA, San Diego, USA). FACSDiva software version 6.1.3 (BD Biosciences, NJ, USA) or NovoExpress software version 1.3.0, 1.4.1 or 1.5.4 (ACEA, San Diego, USA) was used to evaluate the flow cytometry data. Characteristic light‐scattering properties were used to identify neutrophils via flow cytometry.
Long‐read nanopore sequencing
DNA was extracted from EDTA‐stabilized whole blood via the Maxwell RSC blood DNA kit on the Maxwell RSC instrument (Promega, Madison, WI, USA). The forward primers for CD177‐specific amplification, shown in Table 1, were designed with CLC Main Workbench 21 (Qiagen, Hilden, DE), and Ensembl [27] was used to confirm that the primer did not target the pseudogene CD177P1. The reverse primer was previously used by Wu et al. [16]. The amplicon (9248 bp) included the first eight exons and the beginning of exon 9. Each 20 μL PCR consisted of 200 ng of template DNA, 10 μL of long‐range PCR: GoTaq® Long PCR Master Mix (Promega, Madison, WI, USA) and 1 μL of primer mixture (final conc. 0.5 mM of each). PCR was performed on a Proflex™ (Applied Biosystems, Carlsbad, CA, USA) with the following conditions: 95°C for 2 min, 35 cycles of 94°C for 30 s, 63°C for 30 s, 65°C for 9 min and 1 cycle of 72°C for 10 min. PCR products were visualized via gel electrophoresis (1% agarose in Tris Borate EDTA buffer) and quantified with a Qubit FlexFluorometer (Thermo Fisher Scientific, Waltham, MA, USA) via a broad range kit (Thermo Fisher Scientific, Waltham, MA, USA). Barcoding and sequencing were performed with the rapid sequencing gDNA‐barcoding kit (SQK‐RBK110.96) using the protocol (version RBK_9126_v110_revO_24Mar2021) (Oxford Nanopore, Oxford, UK). Two hundred nanograms of amplification product were diluted to a volume of 7.5 μL, and 2.5 μL of barcoding mixture was added according to the manufacturer's protocol (Oxford Nanopore, Oxford, UK). The sample was cleaned with AMPure XP (Beckman Coulter, Brea, CA, USA) beads before pooling. Sequencing was performed with an R9.4 flow cell on a MinION Mk 1B sequencer (Oxford Nanopore, Oxford, UK). Basecalling was performed with guppy alignment software version 6.1.5 within the MinKNOW software during acquisition (Oxford Nanopore, Oxford, UK). Sequencing files were aligned to the human genome reference (Hg38) via minimap2 version 2.22 [28, 29], indexing was performed with the SAMtools index and coverage was determined with SAMtools coverage [30]. Manual analysis was performed via Integrated Genomics Viewer (IGV) version 2.16.1 [31, 32, 33, 34].
TABLE 1.
Primer design for long‐read amplification of CD177 (9248 bp).
| Orientation | Sequence | Positioned | Genomic location | Melting temperature | Length | Source |
|---|---|---|---|---|---|---|
| Forward | GGGGGAACCTCGGGTCAAGATG | Before exon 1 | 19:43,353,123–43,353,144 | 63.6 | 22 bp | Designed with CLC |
| Revers | AGGTTGAGTGTGGGTGGTCAGC | Inside exon 9 | 19:43,362,350–43,362,371 | 64 | 21 bp | [16] |
Statistics
Statistical analysis was conducted via the statistical programme Stata (version 18.0, StataCorp, College Station, TX). SNP frequencies were estimated via direct counting. The expression patterns were compared via a chi‐square test, and the distributions were visualized via a boxplot.
RESULTS
Amplification and sequencing
Amplicons, with expected size 9248 bp, were confirmed for all 44 test samples by gel electrophoresis. Figure 3 shows a gel electrophoresis with a blank well containing the no template control (NTC) and two wells with bands between 8 and 10 kb containing amplicons from a sample that was CD177 positive and CD177 null for HNA‐2 expression. The sequence length of the shortest contig at 50% of the total assembly length, the N50, was 3.2 kb. The sequencing and mapping results for each sample are shown in Table 2. The number of reads aligned (after filtering) to the region (NC_000019.10: 43353145–43362349) varied from 959 to 32,325. The number of covered bases with depth ≥1 covered the whole region (9205 bases), resulting in a coverage of 100%. The mean depth coverage ranged from 124× to 12,117×. All samples produced high mean base qualities (21.2–25.1) and high mapping qualities (55.5–58.2). The sequencing results confirmed that the amplicons indeed aligned to the CD177 gene.
FIGURE 3.

Gel electrophoresis (1% agarose) testing long‐range polymerase chain reaction amplification products of CD177 (9248 bp). Lane 1: 10‐kb ladder; lane 2: no template control; lane 3: CD177 positive; lane 4: CD177 null.
TABLE 2.
Nanopore sequencing results of CD177 amplicons in the 44 tested samples.
| ID | Number of reads | Covered bases | Coverage (%) | Mean depth of coverage | Mean baseQ | Mean mapQ |
|---|---|---|---|---|---|---|
| AAL_001 | 9396 | 9205 | 100 | 3869.7 | 21.2 | 57.8 |
| AAL_002 | 24,482 | 9205 | 100 | 8488.0 | 22.2 | 55.7 |
| AAL_003 | 24,394 | 9205 | 100 | 9595.4 | 22.0 | 57.7 |
| AAL_004 | 23,599 | 9205 | 100 | 9052.9 | 22.1 | 57.2 |
| AAL_005 | 16,638 | 9205 | 100 | 6099.0 | 22.1 | 56.8 |
| AAL_006 | 20,142 | 9205 | 100 | 7551.7 | 22.0 | 57.0 |
| AAL_007 | 22,234 | 9205 | 100 | 8647.3 | 22.0 | 57.4 |
| AAL_008 | 16,837 | 9205 | 100 | 6481.7 | 22.1 | 57.3 |
| AAL_009 | 15,904 | 9205 | 100 | 6308.2 | 22.1 | 57.6 |
| AAL_010 | 28,687 | 9205 | 100 | 11,359.4 | 22.0 | 57.5 |
| AAL_011 | 17,733 | 9205 | 100 | 7007.3 | 22.0 | 57.6 |
| AAL_012 | 23,436 | 9205 | 100 | 8977.5 | 22.0 | 57.3 |
| AAL_013 | 22,075 | 9205 | 100 | 8485.7 | 22.1 | 57.4 |
| AAL_014 | 14,652 | 9205 | 100 | 5441.8 | 22.1 | 57.1 |
| AAL_015 | 959 | 9205 | 100 | 124.5 | 25.1 | 56.4 |
| AAL_016 | 12,778 | 9205 | 100 | 5331.4 | 22.1 | 58.1 |
| AAL_017 | 12,300 | 9205 | 100 | 4816.6 | 22.1 | 57.6 |
| AAL_018 | 17,996 | 9205 | 100 | 6711.0 | 22.0 | 57.0 |
| AAL_019 | 13,268 | 9205 | 100 | 4773.3 | 22.1 | 56.6 |
| AAL_020 | 18,266 | 9205 | 100 | 6898.5 | 22.1 | 57.0 |
| AAL_021 | 19,634 | 9205 | 100 | 7119.7 | 22.1 | 56.9 |
| AAL_022 | 28,553 | 9205 | 100 | 9765.9 | 21.7 | 55.5 |
| AAL_023 | 15,437 | 9205 | 100 | 5277.1 | 21.8 | 55.7 |
| AAL_024 | 32,325 | 9205 | 100 | 12,116.8 | 21.6 | 56.6 |
| AAL_025 | 8396 | 9205 | 100 | 3088.3 | 21.8 | 56.7 |
| AAL_026 | 4636 | 9205 | 100 | 1863.8 | 21.3 | 57.4 |
| AAL_027 | 20,344 | 9205 | 100 | 7815.8 | 21.8 | 57.3 |
| AAL_028 | 5813 | 9205 | 100 | 2208.7 | 21.8 | 57.5 |
| AAL_029 | 8871 | 9205 | 100 | 3263.2 | 21.8 | 56.4 |
| AAL_030 | 9389 | 9205 | 100 | 3878.1 | 21.5 | 58.2 |
| AAL_031 | 2485 | 9205 | 100 | 919.9 | 21.9 | 56.8 |
| AAL_032 | 21,467 | 9205 | 100 | 7669.9 | 21.7 | 56.2 |
| AAL_033 | 12,652 | 9205 | 100 | 4889.0 | 21.6 | 57.2 |
| AAL_034 | 19,684 | 9205 | 100 | 6996.1 | 21.8 | 56.4 |
| AAL_035 | 13,979 | 9205 | 100 | 4622.2 | 21.7 | 55.4 |
| AAL_036 | 9218 | 9205 | 100 | 3519.4 | 21.2 | 57.1 |
| AAL_037 | 22,106 | 9205 | 100 | 7934.2 | 21.8 | 56.2 |
| AAL_038 | 5233 | 9205 | 100 | 2073.6 | 21.3 | 57.5 |
| AAL_039 | 4855 | 9205 | 100 | 1942.7 | 21.2 | 57.4 |
| AAL_040 | 16,552 | 9205 | 100 | 5708.3 | 21.7 | 56.2 |
| AAL_041 | 23,091 | 9205 | 100 | 7703.8 | 21.8 | 55.6 |
| AAL_042 | 19,641 | 9205 | 100 | 7708.9 | 21.7 | 57.4 |
| AAL_043 | 4841 | 9205 | 100 | 1929.4 | 21.3 | 57.5 |
| AAL_044 | 12,689 | 9205 | 100 | 5033.5 | 22.1 | 57.3 |
Genetic variations in the CD177 gene
A total of 14 SNPs across seven exons of CD177 were identified in the 44 test samples, as presented in Table 3. The presence of SNPs in the 22 CD177 null samples and the 22 CD177 positive samples is visualized in Tables 4 and 5. Twenty‐two samples were homozygous for the c.787A>T SNP, leading to a stop codon, corresponding to the 22 samples found to be CD177 null (AAL_023 to AAL_044). The c.787A>T SNP was in complete linkage disequilibrium (LD) with c.782G>A, c.786A>C, c.790G>A and c.799A>C, but LD was not observed among the other SNPs. Eight of the 17 (AAL_023 to AAL_030) samples positive and with a normal expression pattern for HNA‐2 were heterozygous for c.787A>T, and the remaining nine (AAL_031 to AAL_039) did not have the polymorphism. The influence of c.787A>T on expression patterns in positive samples is illustrated in the boxplot in Figure 4. The boxplot shows that c.787A>T heterozygosity affects gene expression, and the two groups were significantly different (p = 0.005). In the nine samples with c.787A/A, the percentage of positive neutrophils ranged from 39% to 85%, whereas in the samples with c.787A/T, the percentage ranged from 18% to 60%. All five positive samples with atypical expression (AAL_040 to AAL_044) were found to be heterozygous for the c.1291G>A polymorphism. This polymorphism was not detected in any of the other samples.
TABLE 3.
Human neutrophil antigen 2 mutations found with nanopore sequencing in all 44 tested samples.
| Region | Position (Hg38) Chr19 | Rs no. | Variant | Amino acid change | Gene consequence | Prevalence, n = 44 (%) | ||
|---|---|---|---|---|---|---|---|---|
| Wildtype | Heterozygote | Homozygote | ||||||
| Exon 1 | 43,353,721 | rs45441892 | c.7G>C | p.A3P | Missense | 16 (36.4) | 18 (40.9) | 10 (22.7) |
| Exon 2 | 43,353,892 | rs45553433 | c.92A>T | p.H31L | Missense | 43 (97.7) | 1 (2.3) | 0 (0.0) |
| 43,353,914 | rs45571738 | c.114G>A | p.L38L | Synonymous | 31 (70.5) | 12 (27.3) | 1 (2.3) | |
| Exon 5 | 43,356,040 | rs12981714 | c.551T>G | p.V184G | Missense | 39 (88.6) | 4 (9.1) | 1 (2.3) |
| 43,356,099 | rs12980412 | c.610G>A | p.D204N | Missense | 34 (77.3) | 5 (11.4) | 0 (0.0) | |
| 43,356,103 | rs12981771 | c.614T>G | p.M205R | Missense | 38 (86.4) | 5 (11.4) | 1 (2.3) | |
| Exon 6 | 43,360,396 | rs10425835 | c.751C>A | p.L251I | Missense | 31 (70.5) | 11 (25.0) | 2 (4.5) |
| Exon 7 | 43,361,164 | rs200660811 | c.782G>A | p.G261A | Missense | 14 (31.8) | 8 (18.2) | 22 (50.0) |
| 43,361,168 | rs587670082 | c.786A>C | p.T262T | Synonymous | 14 (31.8) | 8 (18.2) | 22 (50.0) | |
| 43,361,169 | rs201821720 | c.787A>T | p.K263X | Stop | 14 (31.8) | 8 (18.2) | 22 (50.0) | |
| 43,361,172 | rs200145410 | c.790G>A | p.G264S | Missense | 14 (31.8) | 8 (18.2) | 22 (50.0) | |
| 43,361,181 | rs12978146 | c.799A>C | p.T267A | Missense | 14 (31.8) | 8 (18.2) | 22 (50.0) | |
| Exon 8 | 43,361,540 | rs17856829 | c.1042G>A | p.A348T | Missense | 14 (31.8) | 8 (18.2) | 22 (50.0) |
| Exon 9 | 43,362,297 | rs78718189 | c.1291G>A | p.G431R | Missense | 39 (88.6) | 5 (11.4) | 0 (0.0) |
TABLE 4.
Genetic variants present in the 22 human neutrophil antigen 2 null samples with long‐read nanopore sequencing.
| HNA‐2 null | Exon 1 | Exon 2 | Exon 5 | Exon 6 | Exon 7 | Exon 8 | Exon 9 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| c.7G>C | c.92A>T | c.114G>A | c.551G>T | c.610A>G | c.614G>T | c.751C>A | c.782G>A | c.786A>C | c.787A>T | c.790G>A | c.799A>C | c.1042G>A | c.1291G>A | |||
| ID | HNA‐2 (%) | p.A3P | p.H31L | p.L38L | p.V184G | p.D204N | p.M205R | p.L251I | p.G261A | p.T262T | p.K263X | p.G264S | p.T267A | p.A348T | p.G431R | |
| AAL_001 | 0 | G/G | A/A | G/G | G/G | A/A | G/G | C/C | A/A | C/C | T/T | A/A | C/C | G/G | G/G | |
| AAL_002 | 0 | G/G | A/A | G/A | G/G | A/A | G/G | C/C | A/A | C/C | T/T | A/A | C/C | G/G | G/G | |
| AAL_003 | 0 | G/G | A/A | G/A | G/G | A/A | G/G | C/C | A/A | C/C | T/T | A/A | C/C | G/G | G/G | |
| AAL_004 | 0 | G/C | A/A | G/A | G/G | A/A | G/G | C/C | A/A | C/C | T/T | A/A | C/C | G/G | G/G | |
| AAL_005 | 0 | G/C | A/A | G/A | G/G | A/A | G/G | C/C | A/A | C/C | T/T | A/A | C/C | G/G | G/G | |
| AAL_006 | 0 | C/C | A/A | G/G | G/G | A/A | G/G | C/C | A/A | C/C | T/T | A/A | C/C | G/G | G/G | |
| AAL_007 | 0 | G/C | A/A | G/G | G/T | A/G | G/T | C/C | A/A | C/C | T/T | A/A | C/C | G/G | G/G | |
| AAL_008 | 0 | G/C | A/A | G/A | G/G | A/A | G/G | C/C | A/A | C/C | T/T | A/A | C/C | G/G | G/G | |
| AAL_009 | 0 | C/C | A/A | G/G | G/G | A/A | G/G | C/C | A/A | C/C | T/T | A/A | C/C | G/G | G/G | |
| AAL_010 | 0 | G/C | A/A | G/G | G/G | A/A | G/G | C/C | A/A | C/C | T/T | A/A | C/C | G/G | G/G | |
| AAL_011 | 0 | G/G | A/A | G/G | T/T | G/G | T/T | C/C | A/A | C/C | T/T | A/A | C/C | G/G | G/G | |
| AAL_012 | 0 | G/C | A/A | G/G | G/G | A/A | G/G | C/C | A/A | C/C | T/T | A/A | C/C | G/G | G/G | |
| AAL_013 | 0 | C/C | A/A | G/A | G/G | A/A | G/G | C/C | A/A | C/C | T/T | A/A | C/C | G/G | G/G | |
| AAL_014 | 0 | C/C | A/A | G/A | G/G | A/A | G/G | C/C | A/A | C/C | T/T | A/A | C/C | G/G | G/G | |
| AAL_015 | 0 | C/C | A/A | G/G | G/G | A/A | G/G | C/C | A/A | C/C | T/T | A/A | C/C | G/G | G/G | |
| AAL_016 | 0 | C/C | A/A | G/G | G/G | A/A | G/G | C/C | A/A | C/C | T/T | A/A | C/C | G/G | G/G | |
| AAL_017 | 0 | G/G | A/A | G/G | G/G | A/A | G/G | C/C | A/A | C/C | T/T | A/A | C/C | G/G | G/G | |
| AAL_018 | 0 | G/C | A/A | G/G | G/G | A/A | G/G | C/C | A/A | C/C | T/T | A/A | C/C | G/G | G/G | |
| AAL_019 | 0 | G/C | A/A | G/G | G/G | A/A | G/G | C/C | A/A | C/C | T/T | A/A | C/C | G/G | G/G | |
| AAL_020 | 0 | G/C | A/A | G/A | G/G | A/G | G/T | C/C | A/A | C/C | T/T | A/A | C/C | G/G | G/G | |
| AAL_021 | 0 | G/C | A/A | G/A | T/G | A/A | G/G | C/C | A/A | C/C | T/T | A/A | C/C | G/G | G/G | |
| AAL_022 | 0 | C/C | A/A | G/G | G/G | A/A | G/G | C/C | A/A | C/C | T/T | A/A | C/C | G/G | G/G | |
Note: Colours: wildtype = green; heterozygotes = yellow; homozygote = red.
Abbreviation: HNA‐2, human neutrophil antigen 2.
TABLE 5.
Genetic variants present in the 22 human neutrophil antigen 2 positive samples with long‐read nanopore sequencing.
| HNA‐2 positive | Exon 1 | Exon 2 | Exon 5 | Exon 6 | Exon 7 | Exon 8 | Exon 9 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| c.7G>C | c.92A>T | c.114G>A | c.551G>T | c.610A>G | c.614G>T | c.751C> A | c.782G>A | c.786A>C | c.787A>T | c.790G>A | c.799A>C | c.1042G>A | c.1291G>A | |||
| ID | HNA‐2 (%) | p.A3P | p.H31L | p.L38L | p.V184G | p.D204N | p.M205R | p.L251I | p.G261A | p.T262T | p.K263X | p.G264S | p.T267A | p.A348T | p.G431R | |
| AAL_023 | 18 | G/G | A/A | G/A | G/G | A/A | G/G | C/A | G/A | A/C | A/T | G/A | A/C | G/G | G/G | |
| AAL_024 | 22 | G/C | A/A | G/G | G/G | G/A | G/T | C/C | G/A | A/C | A/T | G/A | A/C | G/G | G/G | |
| AAL_025 | 25 | G/G | A/A | G/G | G/G | A/A | G/G | C/C | G/A | A/C | A/T | G/A | A/C | G/A | G/G | |
| AAL_026 | 31 | G/G | A/A | G/G | G/G | A/A | G/G | C/C | G/A | A/C | A/T | G/A | A/C | G/A | G/G | |
| AAL_027 | 40 | G/C | A/A | G/G | G/G | A/A | G/G | C/A | G/A | A/C | A/T | G/A | A/C | G/G | G/G | |
| AAL_028 | 44 | G/C | A/A | G/G | G/T | G/A | G/T | C/A | G/A | A/C | A/T | G/A | A/C | G/G | G/G | |
| AAL_029 | 46 | C/C | A/A | G/G | G/T | G/A | G/T | C/A | G/A | A/C | A/T | G/A | A/C | G/G | G/G | |
| AAL_030 | 60 | C/C | A/A | G/G | G/G | A/A | G/G | C/C | G/A | A/C | A/T | G/A | A/C | G/A | G/G | |
| AAL_031 | 39 | G/G | A/A | A/A | G/G | A/A | G/G | C/C | G/G | A/A | A/A | G/G | A/A | A/A | G/G | |
| AAL_032 | 42 | G/G | A/A | G/G | G/G | A/A | G/G | C/A | G/G | A/A | A/A | G/G | A/A | G/A | G/G | |
| AAL_033 | 50 | G/G | A/A | G/G | G/G | A/A | G/G | C/A | G/G | A/A | A/A | G/G | A/A | G/A | G/G | |
| AAL_034 | 50 | G/G | A/A | G/G | G/G | A/A | G/G | A/A | G/G | A/A | A/A | G/G | A/A | G/G | G/G | |
| AAL_035 | 53 | C/C | A/A | G/G | G/G | A/A | G/G | C/C | G/G | A/A | A/A | G/G | A/A | A/A | G/G | |
| AAL_036 | 75 | G/G | A/A | G/G | G/G | A/A | G/G | C/A | G/G | A/A | A/A | G/G | A/A | G/A | G/G | |
| AAL_037 | 79 | C/C | A/A | G/G | G/G | A/A | G/G | C/C | G/G | A/A | A/A | G/G | A/A | G/A | G/G | |
| AAL_038 | 84 | G/G | A/A | G/G | G/G | A/A | G/G | A/A | G/G | A/A | A/A | G/G | A/A | G/G | G/G | |
| AAL_039 | 85 | G/C | A/A | G/G | G/G | A/A | G/G | C/A | G/G | A/A | A/A | G/G | A/A | G/G | G/G | |
| AAL_040 | 27/65 | G/C | A/A | G/A | G/G | A/A | G/G | A/A | G/G | A/A | A/A | G/G | A/A | G/G | G/A | |
| AAL_041 | 28/35 | G/C | A/A | G/G | G/G | A/A | G/G | C/A | G/G | A/A | A/A | G/G | A/A | G/A | G/A | |
| AAL_042 | 30/42 | G/C | A/A | G/G | G/G | A/A | G/G | C/A | G/G | A/A | A/A | G/G | A/A | G/A | G/A | |
| AAL_043 | 39/14 | G/G | A/A | G/G | G/G | A/A | G/G | C/A | G/G | A/A | A/A | G/G | A/A | G/A | G/A | |
| AAL_044 | 40/30 | G/G | A/T | G/A | G/G | A/A | G/G | A/A | G/G | A/A | A/A | G/G | A/A | G/G | G/A | |
Note: Colours: wildtype = green; heterozygote = yellow; homozygote = red.
Abbreviation: HNA‐2, human neutrophil antigen 2.
FIGURE 4.

Comparison of the effect of c.787A>T on CD177 expression pattern in 17 samples. Blue: c.787A/A, n = 9 (AAL_031 to AAL_039) (min = 39; median = 35.5; max = 85). Red: c.787A/T, n = 8 (AAL_023 to AAL_030) (min = 18; median = 53; max = 60). *Significant statistical difference.
DISCUSSION
The assay designed for long‐read sequencing was able to successfully produce amplification products in all 44 test samples. Despite an amplification time of ~6 h, this approach demands minimal hands‐on time for both amplification and preparation for sequencing. There is also a lower risk of contamination than when two rounds of PCR are performed, and the sequencing time can be as low as 1–2 h per sample, depending on the state of the flowcell and the desired coverage. The number of reads obtained in a sample ranged from 959 to 32,325, with a mean depth of coverage ranging from 125× to 12,117×. Even with a lower number of reads, the high mean baseQ was >21 (a quality score of 20 [Q20] represents an error rate of 1 in 100 [meaning every 100 bp sequencing read may contain an error], with a corresponding call accuracy of 99%) and the mapQ was >55 (mapping quality ranges from 0 to 60 and a score of 50 is equal to an expected error of 1 in 100,000, or a mapping accuracy of 99.999%). We did not establish a minimum acceptable read depth, but we can conclude that we were able to obtain high‐quality data among all tested samples.
This is to our knowledge the first study of this size in which all tested CD177 null samples had the same genetic explanation; homozygosity for c.787T in CD177, which results in a premature stop codon (p.Lys263Ter). This mutation has previously been shown either in combination with c.997delG (compound heterozygote) or alone (homozygote) to be responsible for the absence of CD177 in HNA‐2 null individuals [5, 14, 15]. None of the 44 samples tested in this study had the c.997delG mutation, and all the samples that were heterozygous for c.787A>T were CD177 positive. A British study with approximately the same sample size as this study tested 21 CD177 null samples and reported that only 16/21 (76%) were c.787T homozygotes [35]. Additionally, they reported two other SNPs responsible for stop codons, c.1021C>T;p.Arg341Ter (rs201040394) and c.1254G>A;p.Trp418Ter (rs188387562), but the causative mutation/polymorphism for the remaining 5/21 samples could not be elucidated from the exon and adjacent intronic sequences. Their results were in agreement with a larger multi‐centre study combining 54 HNA‐2 null individuals of European origin that identified c.787T homozygosity in 43/54 (80%) [5]. Further studies are needed to determine whether the uniformity of the causative SNP in the CD177 null individuals in this study is a result of testing techniques or a small study population. A larger study is also needed to elucidate the percentage of CD177 null individuals and the frequency of SNPs in CD177 among the Danish population. The CD177 c.787A>T substitution has not only been associated with CD177 null but has also been shown to affect the distribution of CD177‐positive and CD177 null neutrophils in individuals with a bimodal expression pattern. Consistent with previous findings [5, 15], even though our study was based on a low number of samples, we observed that heterozygosity for the mutation was statistically significantly associated with a lower number of CD177‐positive neutrophils. However, the wide ranges (39%–85% for c.787AA and 18%–60% for c.787AT) indicate that other factors could also be involved. Importantly, we selected samples for the study cohort with the highest possible ranges of CD177 expression, and the distribution is therefore not representative of the Danish population.
The c.1291G>A polymorphism in exon 9 of the CD177 gene has previously been associated with the absence of CD177 in individuals who are also heterozygous for c.787A>T, but it has also been associated with atypical expression (three peaks: one negative peak and two positive peaks) of CD177 on the neutrophil surface [14]. Among our 22 CD177‐positive samples, 5 presented atypical expression, which could be explained by heterozygosity for c.1291G>A.
In addition to c.787A>T and c.1291G>A, we also found 12 other variants, all of which have also been observed among British blood donors in Browne et al. [35], but their influence on HNA‐2 expression is yet to be determined. However, since these 44 test samples do not represent a normal Danish population but instead have been selected with the sole purpose of testing this assay, the frequencies of the variants are not representative of the frequency in the Danish population. It does, however, show the ability of this assay to find novel variants and the possibility of seeking genetic variants in samples that differ from those described here. Besides being able to allocate all HNA‐2 null non‐expression cases to one single SNP, this study did not identify any new SNPs and repeated already reported results from previous studies using other techniques [15, 16, 25].
Overall, long‐read nanopore sequencing was shown to be a robust technique for CD177 genotyping, and all phenotypical expression patterns found with Flow‐GIFT in the test samples could be explained by genetic variations. With respect to the risk of isoantibodies, the ability to determine CD177 null is of greatest clinical value, and even though all 22 CD177 null samples had the same genetic variation to explain their phenotypic behaviour, this assay has the possibility of identifying other described null genetic variants.
This method can enable a more rapid turnaround time in suspected cases and have the possibility of reducing or negating the need for fresh granulocytes for phenotyping and crossmatch studies. CD177 null identification by genotyping could lessen the inconvenience for patients, their families and clinicians to provide subsequent, time‐sensitive samples while permitting the identification of potential antigenic polymorphisms.
CONFLICT OF INTEREST STATEMENT
The authors declare no conflicts of interest.
ACKNOWLEDGEMENTS
This scientific programme was supported by a grant from the Aalborg Voluntary Blood Donors Foundation (1008/24).
K.K.‐M. and R.S. were involved in all aspects of the study conception, design, analysis, interpretation and report generation. A.‐L.F.B. was involved in analysis and interpretation. T.M.H. was involved in data acquisition, study design and report drafting. All authors critically revised the manuscript and read and approved the final manuscript.
Kløve‐Mogensen K, Haunstrup TM, Bilde A‐LF, Steffensen R. Determination of CD177 (human neutrophil antigen 2) polymorphisms using nanopore sequencing. Vox Sang. 2025;120:605–614.
DATA AVAILABILITY STATEMENT
The data that support the findings of this study are available from the corresponding author upon reasonable request.
REFERENCES
- 1. Kissel K, Santoso S, Hofmann C, Stroncek D, Bux J. Molecular basis of the neutrophil glycoprotein NB1 (CD177) involved in the pathogenesis of immune neutropenias and transfusion reactions. Eur J Immunol. 2001;31:1301–1309. [DOI] [PubMed] [Google Scholar]
- 2. Skubitz KM, Stroncek DF, Sun B. Neutrophil‐specific antigen NB1 is anchored via a glycosyl‐phosphatidylinositol linkage. J Leukoc Biol. 1991;49:163–171. [DOI] [PubMed] [Google Scholar]
- 3. Traum A, Hofmann C, Haas S, Schmidt S, Bein G, Sachs UJ, et al. Characterization of CD177‐reactive iso‐ and auto‐antibodies. Transfusion. 2021;61:1916–1922. [DOI] [PubMed] [Google Scholar]
- 4. Browne T, Dearman RJ, Poles A. Human neutrophil antigens: nature, clinical significance and detection. Int J Immunogenet. 2021;48:145–156. [DOI] [PubMed] [Google Scholar]
- 5. Flesch BK, Reil A, Nogués N, Canals C, Bugert P, Schulze TJ, et al. Multicenter study on differential human neutrophil antigen 2 expression and underlying molecular mechanisms. Transfus Med Hemother. 2020;47:385–395. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Flesch BK, Reil A. Molecular genetics of the human neutrophil antigens. Transfus Med Hemother. 2018;45:300–309. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Wada T, Miyamoto S, Okamoto H, Matsuda Y, Toma T, Imai K, et al. Prolonged neutropenia due to antihuman neutrophil antigen 2 (CD177) antibody after bone marrow transplantation. Pediatr Blood Cancer. 2017;64:e26388c. [DOI] [PubMed] [Google Scholar]
- 8. Lucas G, Culliford S, Bendukidze N, Dahlstrom J, Grandage V, Carpenter B, et al. Late onset cytopenias following haematopoietic stem cell transplant associated with viral infection and cell specific antibodies. Transpl Immunol. 2017;41:32–36. [DOI] [PubMed] [Google Scholar]
- 9. Bux J, Becker F, Seeger W, Kilpatrick D, Chapman J, Waters A. Transfusion‐related acute lung injury due to HLA‐A2‐specific antibodies in recipient and NB1‐specific antibodies in donor blood. Br J Haematol. 1996;93:707–713. [DOI] [PubMed] [Google Scholar]
- 10. Fadeyi EA, De Los Angeles Muniz M, Wayne AS, Klein HG, Leitman SF, Stroncek DF. The transfusion of neutrophil‐specific antibodies causes leukopenia and a broad spectrum of pulmonary reactions. Transfusion. 2007;47:545–550. [DOI] [PubMed] [Google Scholar]
- 11. Leger R, Palm S, Wulf H, Vosberg A, Neppert J. Transfusion‐related lung injury with leukopenic reaction caused by fresh frozen plasma containing anti‐NB1. Anesthesiology. 1999;91:1529–1532. [DOI] [PubMed] [Google Scholar]
- 12. Stroncek DF. Neutrophil‐specific antigen HNA‐2a, NB1 glycoprotein, and CD177. Curr Opin Hematol. 2007;14:688–693. [DOI] [PubMed] [Google Scholar]
- 13. Bux J. Human neutrophil alloantigens. Vox Sang. 2008;94:277–285. [DOI] [PubMed] [Google Scholar]
- 14. Bayat B. Molecular basis of human neutrophil antigen 2 (HNA‐2) expression. ISBT Sci Ser. 2020;15:77–81. [Google Scholar]
- 15. Li Y, Mair DC, Schuller RM, Li L, Wu J. Genetic mechanism of human neutrophil antigen 2 deficiency and expression variations. PLoS Genet. 2015;11:e1005255. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Wu J, Li Y, Schuller RM, Li L, Litmeyer A‐S, Bein G, et al. The nonconservative CD177 single‐nucleotide polymorphism c.1291G>A is a genetic determinant for human neutrophil antigen‐2 atypical/low expression and deficiency. Transfusion. 2019;59:1836–1842. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Jelinek J, Li J, Mnjoyan Z, Issa J‐PJ, Prchal JT, Afshar‐Kharghan V. Epigenetic control of PRV‐1 expression on neutrophils. Exp Hematol. 2007;35:1677–1683. [DOI] [PubMed] [Google Scholar]
- 18. Wolff J, Brendel C, Fink L, Bohle RM, Kissel K, Bux J. Lack of NB1 GP (CD177/HNA‐2a) gene transcription in NB1 GP‐neutrophils from NB1 GP‐expressing individuals and association of low expression with NB1 gene polymorphisms. Blood. 2003;102:731–733. [DOI] [PubMed] [Google Scholar]
- 19. Eulenberg‐Gustavus C, Bähring S, Maass PG, Luft FC, Kettritz R. Gene silencing and a novel monoallelic expression pattern in distinct CD177 neutrophil subsets. J Exp Med. 2017;214:2089–2101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Bayat B, Lowack J, Audrain M, Croisille L, Curtis B, Dangerfield R, et al. World human neutrophil antigens investigation survey. Vox Sang. 2023;118:763–774. [DOI] [PubMed] [Google Scholar]
- 21. Dittmar K, Lim J‐B, Caruccio L, Bettinotti M, Stroncek D. Assessment of the relative number of copies of the gene encoding human neutrophil antigen‐2a (HNA‐2a), CD177, and a homologous pseudogene by quantitative real‐time PCR. Immunohematology. 2003;19:122–126. [PubMed] [Google Scholar]
- 22. Caruccio L, Bettinotti M, Director‐Myska AE, Arthur DC, Stroncek D. The gene overexpressed in polycythemia rubra vera, PRV‐1, and the gene encoding a neutrophil alloantigen, NB1, are alleles of a single gene, CD177, in chromosome band 19q13.31. Transfusion. 2006;46:441–447. [DOI] [PubMed] [Google Scholar]
- 23. Caruccio L, Walkovich K, Bettinotti M, Schuller R, Stroncek D. CD177 polymorphisms: correlation between high‐frequency single nucleotide polymorphisms and neutrophil surface protein expression. Transfusion. 2004;44:77–82. [DOI] [PubMed] [Google Scholar]
- 24. Browne T, Wroe E, Keen L, Poles A. Human neutrophil antigen 2 sequence‐based typing: joining the hunt for the CD177 answer. Vox Sang. 2022;117:431–437. [DOI] [PubMed] [Google Scholar]
- 25. Bayat B, Bein G, Sachs UJ. A sequence‐specific polymerase chain reaction method for HNA‐2 genotyping: homozygous c.843A>T mutation predicts the absence of CD177. Transfusion. 2016;56:2127–2132. [DOI] [PubMed] [Google Scholar]
- 26. Moritz E, Chiba AK, Kimura EY, Albuquerque D, Guirão FP, Yamamoto M, et al. Molecular studies reveal that A134T, G156A and G1333A SNPs in the CD177 gene are associated with atypical expression of human neutrophil antigen‐2. Vox Sang. 2010;98:160–166. [DOI] [PubMed] [Google Scholar]
- 27. Martin FJ, Amode MR, Aneja A, Austine‐Orimoloye O, Azov AG, Barnes I, et al. Ensembl 2023. Nucleic Acids Res. 2023;51:D933–D941. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Li H. New strategies to improve minimap2 alignment accuracy. Bioinformatics. 2021;37:4572–4574. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Li H. Minimap2: pairwise alignment for nucleotide sequences. Bioinformatics. 2018;34:3094–3100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, et al. The sequence alignment/map format and SAMtools. Bioinformatics. 2009;25:2078–2079. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Robinson JT, Thorvaldsdóttir H, Winckler W, Guttman M, Lander ES, Getz G, et al. Integrative genomics viewer. Nat Biotechnol. 2011;29:24–26. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Thorvaldsdóttir H, Robinson JT, Mesirov JP. Integrative genomics viewer (IGV): high‐performance genomics data visualization and exploration. Brief Bioinform. 2013;14:178–192. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Robinson JT, Thorvaldsdóttir H, Wenger AM, Zehir A, Mesirov JP. Variant review with the integrative genomics viewer. Cancer Res. 2017;77:e31–e34. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Robinson JT, Thorvaldsdottir H, Turner D, Mesirov JP. igv.js: an embeddable JavaScript implementation of the integrative genomics viewer (IGV). Bioinformatics. 2023;39:btac830. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Browne T. Human neutrophil antigen allele assignment using next generation sequencing. Manchester: University of Manchester; 2022. p. 83–93. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data that support the findings of this study are available from the corresponding author upon reasonable request.
