Skip to main content
mSphere logoLink to mSphere
. 2025 May 21;10(6):e00149-25. doi: 10.1128/msphere.00149-25

Sudapyridine (WX-081) inhibits Mycobacterium tuberculosis by targeting ATP synthase and upregulating host innate immunity

Xinda Li 1,2,#, Xiaoyi Luo 1,2,#, Bin Wang 1,2, Lei Fu 1,2, Xi Chen 1,2, Yu Lu 1,2,
Editor: Christina L Stallings3
PMCID: PMC12188713  PMID: 40396746

ABSTRACT

Drug-resistant tuberculosis (DR-TB) urgently requires safer, more accessible alternatives to bedaquiline (BDQ), which faces critical flaws like cardiotoxicity, high costs, and emerging resistance. WX-081, a promising BDQ alternative, has demonstrated superior anti-TB activity and improved safety in clinical studies. However, its mechanism of action remains unexplored, underscoring the need for further research to optimize its potential in advancing global TB elimination efforts. This study reveals WX-081’s dual mechanisms: targeting atpE to disrupt ATP synthase and proton motive force via resistance screening, gene sequencing, and functional assays while enhancing host immunity through macrophage transcriptomics. Molecular docking confirmed atpE binding sites, and immune activation pathways (NF-κB/MAPK) were identified, positioning WX-081 as a potent, safe anti-DR-TB candidate despite unresolved mechanistic details.

IMPORTANCE

Bedaquiline, a key drug for drug-resistant tuberculosis, is restricted by safety issues impacting its clinical utility. Its next-generation alternative, WX-081, has advanced to Phase III trials but lacks in-depth studies on its mechanism and host immune-modulatory effects, necessitating further research before broad clinical adoption.

KEYWORDS: WX-081, drug-resistant tuberculosis, ATP synthase, immunomodulation

INTRODUCTION

Tuberculosis (TB), a formidable infectious disease caused by Mycobacterium tuberculosis (Mtb), has long been the leading cause of death among infectious pathogens, which imposes a heavy burden on public health worldwide (13). The World Health Organization (WHO) has proposed a strategy to end TB by 2035, which aims to reduce the TB incidence by 90% and TB-related deaths by 95% in 2035 compared to 2015 levels (46). However, the Global Tuberculosis Report 2024 highlighted that an estimated 10.8 million people worldwide contracted TB in 2023, with only an 8.3% reduction in TB incidence between 2015 and 2023. The global number of TB-related deaths in 2023 was about 1.25 million (4, 7, 8). In short, we still have a long way to go to end TB completely.

Drug-resistant tuberculosis (DR-TB) is caused by the mutation of Mtb that leads to resistance to one or more of the standard anti-TB drugs (9, 10). Treating DR-TB requires the use of second-line drugs, which are less effective, more toxic, and costlier than first-line medications. Additionally, the treatment duration can extend to 18–24 months, compared to the 6-month regimen for drug-susceptible TB (1114). The continuous emergence of DR-TB has gradually become a key factor restricting the end of the TB epidemic. For decades after the approval of rifampin in 1962, no new anti-tuberculosis drugs were successfully developed, until bedaquiline (BDQ) was approved by the FDA for the treatment of drug-resistant tuberculosis in 2012 (15). BDQ, a diarylquinoline antibiotic, targets the proton pump of the ATP-synthase enzyme in mycobacteria, resulting in severe impairment of energy synthesis and death (1619). In 2018, BDQ was listed by WHO as the first recommended drug for the treatment of rifampicin-resistant TB and multidrug-resistant TB (MDR-TB). However, the use of BDQ has been severely limited by its toxicity, including unexplained deaths, QTc prolongation, phospholipidosis, and hepatotoxicity (16, 2024). Therefore, there is an urgent need for safer and more potent drugs related to BDQ.

Sudapyridine (WX-081) is a new and excellent diarylquinoline analog, which is currently in Phase III clinical trial (CTR20221162) (25). Compared with BDQ, WX-081 has improved safety, higher pulmonary exposure, and lower risk of QT interval prolongation, while it still retains strong activity similar to bedaquiline against both drug-susceptible and drug-resistant Mtb (26). Besides, WX-081 also showed remarkable activity against non-tuberculous mycobacteria (27). WX-081 is a potential alternative to bedaquiline in the treatment of drug-resistant tuberculosis, but its targeting mechanism on Mtb and its immunomodulatory effects on the host have not been studied.

In this study, we identified that WX-081 inhibits mycobacterial ATP synthesis by targeting ATP synthase and disruption of proton motive force (PMF). WX-081 also activates innate immunity by inducing cytokines and type I interferons in response to infection with WX-081-resistant strains and lipopolysaccharide (LPS) stimulation. Overall, our work provides detailed insights into the mechanisms of action of WX-081, a promising candidate for the treatment of drug-resistant tuberculosis.

RESULTS

Mutations of atpE occur in WX-081 stepwise induction resistant isolates

Mutations in the gene encoding the putative cellular target of the drug confer resistance, thus helping the investigation of the mechanism of action of antimicrobials. To elucidate the putative mechanism of action of WX-081, we performed stepwise induction of WX-081-resistant strains by inoculating H37Rv in logarithmic growth phase onto 7H10 medium containing 1× MIC of WX-081, followed by transferring single colonies onto plates containing twofold serially increasing concentrations of WX-081, up to 16× MIC. Finally, single colonies were collected for Sanger sequencing. In previous studies, BDQ-resistant strains mainly had mutations in three genes, atpE, Rv0678, and pepQ. The mutation of atpE prevents BDQ from binding to the c subunit of ATP synthase, thus impairing the function of the ATP synthase complex (28, 29). Rv0678 and pepQ are both associated with the efflux pump mmpS5-mmpL5, and mutations in Rv0678 and pepQ lead to enhanced drug efflux, but are not specific to BDQ and are also less sensitive to other drugs, indicating that they are not direct targets of BDQ (3032).

A total of 10 resistant strains were obtained by this method, and the atpE, Rv0678, and pepQ of these strains were sequenced. We found that all isolates exhibited dual mutations in atpE and Rv0678. Specifically, four isolates carried Ala63Val, three isolates had Ala63Thr, and three isolates showed Ala63Pro mutations in atpE (Table 1). pepQ was not mutated in any of these 10 strains. The MICs of these resistant strains to BDQ were also examined and showed an 8–32-fold increase.

TABLE 1.

MIC determination and genotypic characterization of drug-resistant induction strains

Gene Missense mutation
(DNA/amino acid) in atpE
Missense mutation
(DNA/amino acid) in Rv0678
No. of isolates MIC (μg/mL)
WX-081 BDQ
atpE + Rv0678 C188T/A63V G71A/G24D 3 2 0.5
G187A/A63T G197A/G66E 1 2 0.5
G187A/A63T G196A/G66E 2 2 0.5
G187C/A63P G74A/G25D 2 2 2
G187C/A63P G196A/G66E 1 2 0.5
C188T/A63V G196A/G66E 1 2 0.5

Spontaneous resistant isolates to WX-081 also harbor the mutations in atpE

In addition, spontaneous resistance mutants to WX-081 were obtained by directly exposing Mtb to 4× or 8× MIC of WX-081. In total, we obtained 20 resistant strains, which were also sequenced. Sequencing information showed that a total of 17 strains had mutations in RV0678, of which three strains had mutations in the atpE gene, and the other three strains had no mutations in the above three genes (Table 2). We also determined the MICs of these resistant strains to BDQ, which showed a decrease in sensitivity and an increase in MIC to 8–16 times that of the wild-type susceptible H37Rv strain.

TABLE 2.

Genotypic characterization of spontaneous resistance isolates to WX-081

Gene Missense mutation
(DNA/amino acid) in atpE
Missense mutation
(DNA/amino acid) in Rv0678b
No. of isolates
Rv0678 C466T/R155a 4
T80del 1
C467 ins 2
GGA165 ins 1
G74A/G25D 1
C296T/A99V 1
G417T/M139I 1
G281T/R94L 1
G198 del 1
G398 del 1
Rv0678 + atpE G187C/A63P A444C/N148H 1
G187C/A63P G84T/E28a 1
G187C/A63P G417T/M139I 1
None Wild type Wild type 3
a

Stop codon.

b

del, deletion; ins, insertion.

To verify the cross-resistance between WX-081 and BDQ, we detected the MICs of WX-081 against BDQ-resistant strains using the microplate alamar blue assay (MABA) method. As shown in Table 3, the MIC values for WX-081 against the two BDQ-resistant strains with specific atpE missense mutations were 2 µg/mL, which was 16-fold higher than MIC against susceptible strains, indicating cross-resistance between BDQ and WX-081. BDQ also had an MIC of 2 µg/mL against all these resistant strains, suggesting that WX-081 also shares similar mechanisms of action with BDQ. Taken together, these data indicate that the target of WX-081 most likely remains the atpE gene of ATP synthase.

TABLE 3.

Determination of cross-resistance between WX-081 and BDQa

Strain Mutation MIC (μg/mL)
Rv0678 atpE WX-081 BDQ CFZ RFP
H37Rv 0.125 0.06 0.25 0.03
BDQ 1000-0.125B A193 ins A83G 2 2 0.125 0.015
BDQ 1000-1B G193 ins A83G 2 2 0.125 0.015
a

ins, insertion; CFZ, clofazimine; RFP, rifampicin.

WX-081 interferes with mycobacterial energy metabolism by blocking atpE synthase

Given the above findings, WX-081 may block atpE as its main target. To further clarify the mechanism of action of WX-081, we first examined the effect of WX-081 on ATP production. To this end, Mtb was treated with different concentrations of WX-081 for 24 h, and the cellular ATP levels were detected. The results showed that WX-081 with concentrations from 1/16× MIC to 8× MIC, as well as BDQ, all could dramatically inhibit the synthesis of ATP of H37Rv and showed a dose-dependent decrease (Fig. 1A). ATP synthase activity was completely blocked by the specific inhibitor N,N′-dicyclohexylcarbodiimide (DCCD), as a positive control. In contrast, no significant inhibition was observed in BDQ-resistant strains (atpED28G) treated with WX-081 (Fig. 1B and C).

Fig 1.

Bar graphs present ATP inhibition percentages for H37Rv and BDQ-resistant strains under WX-081, BDQ, and DCCD. Column graph presents fluorescence intensity under various concentrations of WX-081, BDQ, DCCD, and CCCP with highest values under DMSO for IMV.

WX-081 inhibits ATP synthesis via inhibiting ATP synthase and destroying proton motive force. (A–C) Intracellular ATP levels in Mtb after 24 h compound treatment: drug-susceptible H37Rv (A), BDQ-resistant strains BDQ 1000-0.125B (B), and BDQ 1000-1B (C). (D) ATP synthesis inhibition in Mycobacterium smegmatis inverted membrane vesicles (IMVs). (n = 3, means and standard deviation [SD], *P < 0.05, two-sided t-test).

In addition, the inverted membrane vesicles (IMVs) were generated from Mycobacterium smegmatis mc2 155 (ATCC 700084) as described previously (33). We examined the ATP synthesis under WX-081 treatment. In accordance with the changes observed in the cells, WX-081 (0.01–1 μM) and BDQ inhibited ATP levels in the inverted vesicles compared to the dimethyl sulfoxide (DMSO) group. (Fig. 1D). Altogether, these results suggested that WX-081 interferes with mycobacterial energy metabolism, leading to the decrease of ATP abundance.

WX-081 displays protonophore activity to collapse the transmembrane pH gradient

Recently, BDQ was uncovered to be an H+/K+ antiporter (34, 35). Through its protonophore activity, the drug shuttles protons across the lipid bilayer to collapse the transmembrane pH gradient component of the proton motive force. Elimination of the pH gradient disables the link between electron transport and ATP synthesis (3436). BDQ’s uncoupler activity appears to be a second mechanism of action of the drug, contributing to the drug’s bactericidal activity against Mtb (35, 36). To determine whether WX-081 had protonophore activity, we measured the effect of WX-081 on the transmembrane pH gradient of Mycobacterium smegmatis inverted vesicles using the pH-responsive fluorophore 9-amino-6-chloro-2-methoxyacridine (ACMA) as described previously (36). NADH was used as an electron donor to energize the vesicles. The addition of 5 mM NADH resulted in quenching of ACMA fluorescence, thus indicating the establishment of the transmembrane pH gradient. WX-081 caused a dose-dependent reduction of ACMA fluorescence quenching. BDQ and uncoupler CCCP were used as positive controls (Fig. 2A).

Fig 2.

Line graphs present normalized and absolute fluorescence intensity responses to BDQ, WX-081, CCCP, DMSO, and SDS after NADH or DiSC3(5) addition, with SDS yielding highest fluorescence.

WX-081 displays protonophore activity to collapse the transmembrane pH gradient. (A and B). WX-081’s impact on transmembrane proton gradient (ΔpH) and membrane potential (Δψ) in IMVs, assessed using pH-sensitive fluorescent dye ACMA (A) and membrane potential probe DiSC3(5) (B), respectively. Positive controls: CCCP (ΔpH collapse) and 1% SDS (Δψ disruption). (n = 3, means and SD, *P < 0.05, two-sided t-test).

PMF is collectively established by two parameters: pH gradient (ΔpH) and membrane potential (Δψ). To investigate the effect of WX-081 on membrane potential (Δψ), the membrane potential-sensitive dye DiSC3(5) was used. WX-081 did not lead to significant changes in Δψ (Fig. 2B), and a similar result was observed with BDQ, which was consistent with previous studies on BDQ and analogs (37). SDS (1%) was used as a positive control and rapidly depolarized the membrane potential of Mtb. Altogether, these results suggested that WX-081 collapses the components of the mycobacterial PMF by eliminating the pH gradient to uncouple electron transport from ATP synthesis.

Molecular docking reveals the binding site between WX-081 and atpE

Genetic analysis of the WX-081 mutant-resistant strains suggests that mutations in the atpE gene, c subunit of ATP synthase, are its main target, similar to BDQ. We also used the docking technique to investigate the potential binding sites between WX-081 and atpE (PDB: 4V1F). In the modeling of WX-081-bound atpE, the interactions that anchor WX-081 are involved with the residues Asp32 and Glu65. Hydrogen bond interactions were observed between atpE Glu65 and WX-081. In addition, residues Asp32 and Glu65 of the atpE protein are involved in ionic interactions with WX-081 (Fig. 3A and B). These results are similar to those observed in modeling of BDQ and analog drugs (38, 39). Therefore, it also indicated that WX-081 targets atpE.

Fig 3.

Protein-ligand binding interaction presents helical structure with ligand docked near ASP32 and GLU65, accompanied by 2D schematic diagram with hydrophobic, hydrogen bond, and halogen contacts involving surrounding residues.

Interactions between Mtb ATP synthase atpE and WX-081. (A) Molecular interactions between WX-081 and atpE (ATP synthase subunit c) at predicted binding sites. (B) Two-dimensional interaction map of WX-081 with atpE. The atpE protein is depicted as a slate-colored cartoon model, while WX-081 (cyan stick) binds to critical residues (magenta sticks) within the subunit. Nonpolar hydrogen atoms are omitted for clarity. Hydrogen bonds and ionic interactions are highlighted by yellow and magenta dashed lines, respectively.

WX-081 promotes innate immune signaling pathways

The host immune system plays an important role in the clearance of Mtb and tissue damage repair. In recent years, more and more studies have found that antibiotics used in the treatment of tuberculosis not only have their own antibacterial effects but also have different regulatory effects on the immunity of the host, which may affect their efficacy. To assess whether WX-081 influences host innate immunity, we utilized the NF-κB and MAPK dual luciferase reporter system for an initial evaluation. HEK293T cells were transfected with NF-κB and MAPK dual luciferase reporter plasmids and treated with WX-081. The cells were harvested for the assay of luciferase activity. We found that WX-081 significantly activated both NF-κB and MAPK signaling pathways. In addition, we also found for the first time that BDQ also exerted a strong activation effect on innate immunity (Fig. 4A through C).

Fig 4.

Bar graphs present relative luciferase activity for NF-κB, Elk, and AP-1 pathways under DMSO, WX-081, BDQ, and specific inhibitors, with highest activity under WX-081 for all pathways.

WX-081 promotes the activation of innate immune signaling pathways. (A–C) Luciferase assays of HEK293T cells transfected with plasmids encoding NF-κB (A), JNK (B), or ERK (C) luciferase reporters, and treated with WX-081. The ERK pathway was activated by co-expression of constitutively active RasV12. The JNK and p38 MAPK pathways were activated by co-expression of constitutively active RacL61. The NF-κB pathway was stimulated by TNF treatment. BAY-117082, U0126, and SP600125 were used as positive controls. (n = 3, means and SD, *P < 0.05, **P < 0.01, two-sided t-test).

WX-081 increases the expression of cytokines and type I interferon

Macrophages are the main survival site of the host after Mtb infection. As an important member of the innate immune system, macrophages are also the main source of cytokines and play an important role in the activation of other immune cells and adaptive immunity. To identify the effect of WX-081 on cytokine production, J774A.1 macrophages were stimulated with LPS and incubated with WX-081 or BDQ for 24 h, first. The expression of inflammatory cytokines and type I interferon was analyzed through Real-time quantitative polymerase chain reaction (RT-qPCR). Under LPS stimulation, the results showed that WX-081 significantly promoted the levels of interleukin-6 (IL-6), interleukin-12 (IL-12), interleukin-2 (IL-2), interleukin-5 (IL-5), and tumor necrosis factor-α (TNF-α) mRNA expression relative to DMSO control, as well as IFNα and IFNβ, while decreasing the level of IL-10, a key immunosuppressive factor (Fig. 5A).

Fig 5.

Bar graphs present relative RNA levels of cytokines and interferons under DMSO, WX-081, and BDQ with LPS or H37Rv stimulation, with IL6, IL12, IFNα, and IFNγ highest under WX-081.

WX-081 improves the expression of cytokines and type I interferon. (A) Quantitative PCR analysis of cytokines and type I interferon mRNA expression in J774A.1 macrophages pretreated with WX-081 or BDQ for 12 h and stimulated with LPS (100 ng/mL) for another 12 h. (B) RNA levels in J774A.1 macrophages infected with H37Rv (multiplicity of infection [MOI] = 5) for 4 h and treated with WX-081 or DMSO for another 24 h. (n = 3, means and SD, *P < 0.05, two-sided t-test).

In addition, J774A.1 macrophages were infected with H37Rv (multiplicity of infection [MOI] = 5), and the mRNA expression of cytokines TNF-α, IL-2, IL-12, and IFNγ was detected, which was consistent with the results of LPS treatment. WX-081 promoted the expression of TNF-α, IL-2, IL-12, and IFNγ in comparison to the DMSO control (Fig. 5B). We also infected cells with a resistant strain of WX-081 (WX-081r-Mtb), and WX-081 treatment also led to the upregulation of the cytokines IL-6 and IL-1β (Fig. 6A). In conclusion, WX-081 enhances host innate immunity during Mtb infection, causing upregulation of cytokines and type I interferon expression.

Fig 6.

Bar graphs present IL1β and IL6 RNA levels under DMSO and WX-081 with IL1β highest under WX-081, and CFU per mL decreasing under increasing WX-081 concentrations compared to DMSO.

WX-081 inhibits the intracellular growth of WX-081r-Mtb. (A) RNA levels in J774A.1 macrophages infected with WX-081r-Mtb (MOI = 5) for 4 h and treated with WX-081 or DMSO for another 24 h. (B) Intracellular colony-forming units (CFUs) assay in mouse macrophage J774A.1 infected with WX-081r-Mtb (MOI = 5) for 4 h and treated with WX-081 or BDQ for another 48 h. (n = 3, means and SD, *P < 0.05, two-sided t-test).

The immune activation of WX-081 enhances its intracellular bactericidal activity

To determine whether innate immunity was involved in this antibacterial activity, we thus asked whether WX-081 conferred protection against bacterial infections naturally resistant to WX-081. J774A.1 cells were infected with WX-081r-Mtb for 4 h and then incubated with WX-081 for 48 h. We quantified bacterial colony-forming units (CFUs) in the different treatment groups and found that the bacterial load in cells infected with WX-081r-Mtb was significantly reduced when treated with WX-081 (Fig. 6B). Therefore, these data revealed that WX-081 activates macrophage bactericidal functions through upregulating antibacterial immunity.

RNA sequencing indicates that WX-081 promotes innate immunity

To further investigate the effect of WX-081 on the activation of innate immunity in J774A.1 macrophages, RNA deep sequencing was performed. Macrophages were infected with WX-081r-Mtb at an MOI of 5 for 4 h. Subsequently, either 0.5 µg/mL or 1 µg/mL WX-081 was added to the culture, followed by another 24 h of incubation. Differentially expressed genes (DEGs) with false discovery rate (FDR) corrected P value (padj) ≤ 0.05 were identified among all group comparisons. The differential genes of all treatment groups are presented in the heatmap (Fig. 7A). We performed Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG), and Reactome enrichment analysis for DEGs. According to KEGG analysis, WX-081 upregulated genes were enriched in many innate immune pathways, including the HIF-1 signaling pathway, reactive oxygen species (ROS) production, and glycolysis/gluconeogenesis (Fig. 7B). mTOR was enriched in the downregulated signaling pathways (Fig. 7C). Intracellular ROS are important intracellular bactericidal mediators. HIF1 plays an important role in regulating the production of cytokines and IFNγ. It also mediates the immunometabolic reprogramming and induces the increase of glycolysis during Mtb infection. In the WX-081 treatment group, genes associated with the NF-κB and MAPK innate immune signaling pathways exhibited significant upregulation, including Stk4, Mapk14, Tnfrsf11a, RIPK1, and Tnfsf14.

Fig 7.

Heatmaps and dot plots present differential gene expression, pathway enrichment in disease and metabolic processes, and NF-κB and MAPK gene patterns across DMSO and WX-081 groups with clustering, gene ratios, descriptions, and counts across conditions.

RNA deep sequencing reveals that WX-081 upregulates host innate immunity against Mtb. (A) The DEGs in J774A.1 cells infected with WX-081r-Mtb (MOI = 5) and treated with WX-081 (0.5 µg/mL), WX-081 (1 mg/mL), or DMSO were analyzed by RNA-seq. The heat map shows the differentially expressed genes in all groups (B and C) The KEGG analysis of WX-081 compared with DMSO groups. Shown are the signal pathways enriched by upregulated genes (B) or downregulated genes. (D) Heat maps showing transcripts with differential expression in macrophages treated with WX-081 or DMSO under infection with WX-081r-Mtb, associated with NF-κB/MAPK signaling pathways.

In the infected WX-081r-Mtb group, the expression of genes such as Mapk14 was significantly increased in the WX-081 group compared to the DMSO group, and it has been shown that the activation of MAPK was associated with the activation and differentiation of Th1 cells, leading to the production of intrinsic immune system cytokines such as TNF, IL-6, IL-12, IL-1β essential for defense against Mycobacterium tuberculosis, which is consistent with our results (40). Compared to the DMSO group, the WX-081-treated group significantly upregulated the Tnfrsf11a gene which encodes a protein that is a member of the TNF receptor superfamily, through which activation of NF-κB and MAPK/JNK is induced (Fig. 7D). TNF cytokine is one of the cytokines that are closely associated with Mtb and are essential for controlling infection (41).

In summary, we have identified two mechanisms of action for WX-081. First, it targets atpE, disrupting the PMF and thereby affecting the operation of ATP synthase. Second, it indirectly upregulates the host’s innate immune response, enhancing intracellular bactericidal activity.

DISCUSSION

DR-TB poses a significant challenge to global health due to its complexity and difficulty in treatment (42, 43). Current therapies, including the use of BDQ, a relatively recent addition to the DR-TB arsenal, are fraught with limitations. While BDQ has shown promise in treating MDR-TB, its use is constrained by significant drawbacks, such as potential cardiac toxicity, QTc prolongation, phospholipidosis, hepatotoxicity, and high costs (44). These challenges underscore the critical need for alternative treatments that are safer and more affordable. WX-081 is a novel drug against DR-TB currently in Phase III clinical trials. Compared to BDQ, WX-081 retains similar anti-tuberculosis activity while demonstrating a superior safety profile, positioning it as a promising replacement for BDQ. However, despite its potential, the mechanism of action of WX-081 has not yet been systematically studied. This lack of detailed understanding highlights the need for further research to elucidate how WX-081 exerts its therapeutic effects, which could optimize its use and contribute to more effective DR-TB treatment strategies in the future. In this study, we discovered that WX-081 exerts its antibacterial effects by targeting the c subunit of ATP synthase, atpE, and disrupting the PMF, leading to the collapse of the bacterial energy metabolism.

To determine the molecular mechanisms of WX-081, resistant strains are generated, the isolates obtained with G187C and C188T mutations in atpE, which have also been previously reported in clinical BDQ-resistant strains (45), and atpE mutations are associated with high-level resistance (WX-081 MIC of >1 µg/mL) compared to Rv0678 mutations. Our findings indicate that Rv0678 mutations might represent an initial, transient phase in the development of low-level resistance, potentially progressing to high-level resistance consequent to stable atpE mutations (46). Furthermore, WX-081 also displays protonophore activity. As shown above, the uncoupling effect of Mtb by WX-081 is electroneutral, collapsing the pH gradient but not the membrane potential. This further substantiates the notion that diarylquinoline compounds appear to transport ions across the lipid bilayer in mycobacterial inner membrane vesicles to uncouple the PMF (35).

Host immune modulation enhances pathogen killing while attenuating pathological damage to the host, which is important for combating Mtb infections, particularly against drug-resistant Mtb (47). Here, we investigated the effect of WX-081 on host innate immunity and found that WX-081 promotes the expression of cytokines and type I interferon in macrophages stimulated with LPS, H37Rv, and WX-081r-Mtb, such as TNF-α, IL-2, IL-12, and IFNγ, a similar effect to that of BDQ. Previous studies have reported that BDQ enhances autophagy by upregulating the autophagy-related transcription factor, TFEB (48). In this study, we also observed that WX-081 induces the downregulation of the mTOR signaling pathway, which is typically an inhibitor of autophagy. Additionally, we discovered that BDQ significantly upregulates and activates the host’s innate immune response, enhancing the expression of cytokines. This finding has not been reported before and represents a novel discovery in our research. The immune-activating properties of WX-081 significantly enhance its intracellular antibacterial activity. Furthermore, treatment with WX-081 also suppresses the growth of drug-resistant strains through its immunomodulatory effects. This dual mechanism—directly targeting the bacteria while simultaneously leveraging the host immune system—underscores the potential of WX-081 as a powerful therapeutic agent against both drug-sensitive and drug-resistant tuberculosis.

MATERIALS AND METHODS

Chemicals

Clofazimine (CFZ), rifampicin (RFP), and isoniazid (INH) were purchased from Sigma-Aldrich (Missouri, USA). Bedaquiline was purchased from Biochempartner (Shanghai, China). Sudapyridine (WX-081) was provided by Shanghai Jiatan Pharmaceutical Technology. BAY11-7082 (M2040), SP600125 (M2076), and U0126 (M1977) were purchased from AbMole (Guangzhou, China).

Bacterial strains and culture medium

Mycobacterium tuberculosis H37Rv (ATCC 27294) and BDQ-resistant strains (atpED28G) for this study were obtained from the National Clinical Laboratory on Tuberculosis in Beijing Chest Hospital (49). All strains were grown in Middlebrook 7H9 broth (BD, USA) supplemented with 10% (vol/vol) oleic acid-albumin-dextrose-catalase (OADC) (Becton, Dickinson, USA), 0.2% (vol/vol) glycerol, and 0.05% Tween 80.

Cell lines and plasmids

HEK293T (ATCC CRL-3216, RRID: CVCL_0063) and J774A.1 (ATCC TIB-67, RRID: CVCL_0358) were obtained from the American Type Culture Collection (ATCC). HEK293T cells and J774A.1 cells were maintained in Dulbecco’s modified Eagle’s medium (Gibco, USA) supplemented with 10% fetal bovine serum (FBS) (Gibco, USA). All cells were incubated at 37°C in a humidified 5% CO2 atmosphere.

Luciferase reporter assay plasmids for pRL-TK, Gal4-Elk, Gal4-Luc, pFA-cJun, RacL61, pNF-κB-luc, and RasV12 were kindly provided by Cuihua Liu (Institute of Microbiology, Chinese Academy of Sciences).

Minimum inhibitory concentration

The MABA method was used to determine the MICs of WX-081 and BDQ against the M. tuberculosis H37Rv strain and drug-resistant isolates. According to the MABA (50), serial twofold dilutions of the test compounds were added to each well of a 96-well microplate, followed by the bacterial suspension containing 2 × 105 CFU. The plate was incubated at 37°C in 5% CO2 for 7 days. A mixture of alamarBlue (Bio-Rad) was added to each culture well, after incubation at 37°C for a further 24 h. A change from blue to pink or purple indicated bacterial growth (51). The MIC value was determined as the lowest drug concentration of antibiotic that prevented a color change from blue to pink.

Isolation of spontaneous mutants

H37Rv was cultured in Middlebrook 7H9 broth with glycerol and OADC supplementation at an initial density of 1  ×  104 CFU/mL, and cultures were then incubated with shaking for a further 3 weeks to log phase (52). A total of 108 CFU bacteria were plated on selective agar containing the test compound at 4× MIC or 8× MIC. Four weeks after inoculation, resistant strains growing on drug-containing plates were harvested, and the MICs for all strains were determined.

Mutant selection under different concentrations of WX-081

Cultures containing approximately 108 CFU/mL were exposed to WX-081 at 0.125 µg/mL (1× MIC) in solid agar plates for 3–4 weeks at 37°C. Clones grown on the drug-containing plates were transferred to a 7H10 medium containing 0.3 µg/mL (2× MIC) drug. Using this method, the highly resistant strains capable of survival were selected, and isolation clones were then grown in 7H9 broth for MIC determination as described above.

PCR and DNA sequencing

Genomic DNA of the resistant mutants to WX-081 was isolated as previously described (53). PCR amplification of genes of all the mutants was performed using the following primers: atpE forward primer (5′-CCATCAAGGAGGATAAGGAAA-3′) and reverse primer (5′-CGAAAGTGCCAATGACAGC-3′); Rv0678 forward primers (5′-CGGCTATTTCGAGTCCAGG-3′) and reverse primers (5′-GCAACCGCAT CAACAAGG-3′); pepQ forward primer (5′-ctgccacgcgttgatcaat-3′) and reverse primer (5′-cttgaagtcagcagtggtcg-3′). Genome sequencing analysis was performed by Beijing ReboXingke Biotechnology. The sequences of these genes of all clones were compared with those of the wild-type strain to identify mutations.

Cellular ATP assay

Cultures of wild-type or mutant M. tuberculosis (about 106 CFU/mL) were incubated for 24 h with different concentrations of WX-081, 0.03 µg/mL BDQ (1/2× MIC), or 100 μM DCCD. The mixture was lysed on ice for 10 min, and cells were then removed by centrifugation. Total ATP was determined using an ATP assay kit (Beyotime, China) based on a bioluminescence technique according to the instructions.

Preparation of M. smegmatis inverted membrane vesicles

IMVs were prepared according to a previously described method. Briefly, about 5 g (wet weight) of M. smegmatis was resuspended in 20 mL of 50 mM 3-(N-morpholino)propanesulfonic acid (MOPS) buffer (pH 7.5) containing 2 mM MgCl2 and protease inhibitors (Beyotime, China). Lysozyme was added to a final concentration of 1.2 µg/mL, and the suspension was stirred for 45 min at room temperature and additionally supplemented with 300 µL 1 M MgCl2 and 50 µL DNase I (Thermo Fisher), then continued stirring for another 15 min at room temperature. All subsequent steps were performed at 4°C unless otherwise stated. The cells were broken by three passages through a pre-cooled French pressure cell at 20,000 psi (Thermo Electron, 40K). The lysate was centrifuged at 5,000 × g for 20 min to remove unbroken cells. The cell-free supernatant was centrifuged at 45,000 × g for 1 h to harvest membrane vesicles. The reversed membrane fraction is resuspended in an appropriate volume of 50 mM MOPS buffer (pH 7.5) containing 2 mM MgCl2.

ATP synthesis assay

The ATP synthesis activity was determined as previously described (54). Briefly, IMVs were diluted to a concentration of 50 µg protein/mL with 50 mM MOPS (pH 7.5 with 10 mM MgCl2). Membrane vesicles were pre-incubated with WX-081 or control inhibitors under stirring conditions at room temperature for 10 min. Subsequently, 2.5 mM NADH was added and further incubated with vigorous shaking for 1 min. The reaction was started by adding 1 mM ADP and 10 mM potassium phosphate. A volume of 50 µL of this mixture was added to a 96-well plate. After the addition of 50 µL luciferase reagent, the ATP level was measured as described above.

Determination of ΔpH collapse with IMVs

Collapse of ΔpH was determined in M. smegmatis IMVs as previously described (36). The pH-sensitive, fluorescent dye ACMA was purchased from Aladdin (Shanghai, China). IMVs were diluted to 0.1125 mg/mL in 10 mM HEPES (pH 7.5), 100 mM KCl, 5 mM MgCl2 and added to a black-wall, 96-well plate (Corning). IMVs were pre-incubated with 2 µM ACMA at 37°C for 30 min, and the baseline 410 nm excitation/460 nm emission fluorescence was measured using a Biotek Synergy HT multi-mode plate reader. IMVs were energized with 5 mM NADH and incubated until ACMA fluorescence was quenched due to the generation of ΔpH. Thereafter, IMVs were treated with DMSO, 15 µM WX-081, 15 µM BDQ, and 15 µM CCCP and monitored to test for fluorescence reversal if ΔpH collapsed.

Determination of Δψ collapse by DisC3(5)

Bacterial cells were collected and resuspended with PBS (pH 7.4, plus 5 mM glucose) to obtain an optical density at 600 nm (OD600) of 0.5. Membrane potential sensitive probe 3,3′-dipropylthiodicarbocyanine iodide [DiSC3(5), Aladdin, Shanghai, China] was diluted to 0.5 µM and then added to the culture. After 30 min, once fluorescence was quenched, the bacteria were treated with DMSO, 15 µM WX-081, 1 µM WX-081, 15 µM BDQ, or 1 µM BDQ, while 1% SDS was used as a positive control. Fluorescence intensity was monitored for 60 min at an excitation wavelength of 622 nm and an emission wavelength of 670 nm in the presence of both drugs.

Protein ligand docking

Molecular docking studies were carried out to determine the interaction between the atpE and the selected ligands using the AutoDock 4.2 tool. The crystal structure of ATP synthase was obtained from the RCSB database using source code 4V1F. The receptor protein was kept rigid for docking, while the pharmacological component consisted of a flexible molecule. The docking grid documents were generated by AutoGrid of sitemap, and AutoDock Vina (1.2.0) was used for docking simulation (55). To represent the interaction between the ligand and the protein, BIOVIA Discovery Studio software was used to select the position with the lowest binding energy (56). Finally, the root mean square deviation (RMSD) was calculated, and the protein-ligand complex was analyzed using Pymol.

Dual luciferase reporter assays

Activation of the NF-κB, AP-1, and ELK promoters was detected using the luciferase reporting assay kit (Promega, USA). HEK293T cells were seeded into 24-well plates and incubated for 12 h before being transfected with the appropriate plasmids. To assess NF-κB activity, pNF-κB-Luc (0.5 µg) and pRL-TK (25 ng) were transfected for 6 h, then the medium was replaced with Dulbecco’ s modified Eagle’ s medium (DMEM) containing 10% FBS, along with either drugs or DMSO. After a further 18 h, 20 ng/mL TNF-α (Sigma) was added for a further 6 h. For analysis of AP-1 activity, cells were transfected with Gal4-luc (0.45 µg), pFA-cJun (0.15 µg), RacL61 (0.25 µg), and pRL-TK (25 ng) for 6 h, after which the medium was replaced with a solution containing 5 µg/mL of drugs or DMSO. For the detection of Elk, the cells were transfected with Gal4-luc (0.3 µg), Gal4-Elk (0.3 µg), pRL-TK (25 ng), and RasV12 (5 ng) as described above.

Quantitative RT-PCR analysis

Total RNA was extracted from cells using TRIzol (Invitrogen, USA) and reverse-transcribed into cDNA, which was then analyzed by quantitative RT-PCR (RT-qPCR) with SYBR Green Real-time PCR Master Mix (Yeasen, China) with specific primers. The primers used were as follows: IL-6-forward: TACCACTCCCAACAGACC reverse: CATTTCCACGATTTCCCAGA; IL-1β-forward: GCCACCTTTTGACAGTG ATG reverse: TGATGTGCTGCTGCGAGA; TNF-α-forward: TCTCATTCCTGCTT GTGG reverse: ACTTGGTGGTTTGCTACGA; GAPDH-forward: CAAATTCAA CGGCACAGTCA reverse: TTAGTGGGGTCTCGCTCC; IFNα-forward: CCTGTGT GATGCAGGAACC reverse: TCACCTCCCAGGCACAGA; IFNβ-forward: ACTAG AGGAAAAGCAAGAGGA reverse: CTGGTAAGTCTTCGAATGATG; IL-12-forward: CTGTGCCTTGGTAGCATCTATG reverse: GCAGAGTCTCGCCATT ATGA TTC.

Infection of macrophages

J774A.1 cells were seeded at 5 × 105 cells/well in a complete medium (10% FBS) in a 24-well plate. Cells were washed three times and infected with WX-081r-Mtb at an MOI of 5 for 4 h at 37°C with 5% CO2. After 4 h, infected cells were washed thoroughly with fresh medium to remove extracellular bacteria, and the medium was replaced with 0.5 µg/mL or 1 µg/mL WX-081 for a further 48 h, a volume of DMSO or BDQ as control. Macrophages were lysed using SDS lysis buffer (Sigma-Aldrich). The number of viable bacteria in lysates was determined by plating 10-fold serial dilutions on MB-7H10 agar at 37°C for 3–4 weeks.

Statistical analysis

All data were presented as the mean ± standard deviation. Statistical analysis was performed using GraphPad Prism 8 software (GraphPad Software, Inc.). The experimental group means were compared to the untreated group by two-sided t-test. P value of 0.05 was considered significant.

ACKNOWLEDGMENTS

This work was supported by the Project of Beijing Tongzhou District Health Development (WS2025072), National Natural Science Foundation of China (82304570), and the Beijing Municipal Administration of Hospitals’ Ascent Plan (DFL20221402).

We are very grateful to Shanghai Jiatan Pharmaceutical Technology Co., Ltd. for providing the drug WX-081.

Y.L., X. Lu, and X. Li conceived the study and designed experiments. X. Lu, X. Li, B.W., L.F., and X.C. developed methodology. X. Lu and X. Li performed the experiments. Y.L., X. Li, and X. Lu wrote the manuscript, and all authors commented on the manuscript, data, and conclusion.

Contributor Information

Yu Lu, Email: luyu4876@hotmail.com.

Christina L. Stallings, Washington University in St. Louis School of Medicine, St. Louis, Missouri, USA

DATA AVAILABILITY

The data presented in this study are available from the corresponding author upon reasonable request.

REFERENCES

  • 1. Chai Q, Lu Z, Liu CH. 2020. Host defense mechanisms against Mycobacterium tuberculosis. Cell Mol Life Sci 77:1859–1878. doi: 10.1007/s00018-019-03353-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Fogel N. 2015. Tuberculosis: a disease without boundaries. Tuberculosis (Edinb) 95:527–531. doi: 10.1016/j.tube.2015.05.017 [DOI] [PubMed] [Google Scholar]
  • 3. Ferluga J, Yasmin H, Al-Ahdal MN, Bhakta S, Kishore U. 2020. Natural and trained innate immunity against Mycobacterium tuberculosis . Immunobiology 225:151951. doi: 10.1016/j.imbio.2020.151951 [DOI] [PubMed] [Google Scholar]
  • 4. Kamarul Zaman MF, Nik Husain NR, Sidek MY, Abu Bakar Z. 2025. Determinants of unfavourable treatment outcomes of drug-resistant tuberculosis cases in Malaysia: a case-control study. BMJ Open 15:e093391. doi: 10.1136/bmjopen-2024-093391 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Malik AA, Sinha S, Ehtesham NZ, Hasnain SE. 2023. End tuberculosis by 2035: challenges ahead. Future Microbiol 18:461–464. doi: 10.2217/fmb-2023-0056 [DOI] [PubMed] [Google Scholar]
  • 6. Zhao Y, Liu J. 2021. Facing the challenge of tuberculosis: towards “End TB in China by 2035”. China CDC Wkly 3:243–246. doi: 10.46234/ccdcw2021.070 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Goletti D, Meintjes G, Andrade BB, Zumla A, Shan Lee S. 2025. Insights from the 2024 WHO global tuberculosis report - more comprehensive action, innovation, and investments required for achieving WHO end TB goals. Int J Infect Dis 150:107325. doi: 10.1016/j.ijid.2024.107325 [DOI] [PubMed] [Google Scholar]
  • 8. Estaji F, Kamali A, Keikha M. 2025. Strengthening the global response to tuberculosis: insights from the 2024 WHO global TB report. J Clin Tuberc Other Mycobact Dis 39:100522. doi: 10.1016/j.jctube.2025.100522 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Murray CJL, Ikuta KS, Sharara F, Swetschinski L, Robles Aguilar G, Gray A, Han C, Bisignano C, Rao P, Wool E, et al. 2022. Global burden of bacterial antimicrobial resistance in 2019: a systematic analysis. The Lancet 399:629–655. doi: 10.1016/S0140-6736(21)02724-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Smith KC, Seaworth BJ. 2005. Drug-resistant tuberculosis: controversies and challenges in pediatrics. Expert Rev Anti Infect Ther 3:995–1010. doi: 10.1586/14787210.3.6.995 [DOI] [PubMed] [Google Scholar]
  • 11. Tiberi S, Utjesanovic N, Galvin J, Centis R, D’Ambrosio L, van den Boom M, Zumla A, Migliori GB. 2022. Drug resistant TB - latest developments in epidemiology, diagnostics and management. Int J Infect Dis 124 Suppl 1:S20–S25. doi: 10.1016/j.ijid.2022.03.026 [DOI] [PubMed] [Google Scholar]
  • 12. Lemos ACM, Matos ED. 2013. Multidrug-resistant tuberculosis. Braz J Infect Dis 17:239–246. doi: 10.1016/j.bjid.2013.01.007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Lange C, Dheda K, Chesov D, Mandalakas AM, Udwadia Z, Horsburgh CR Jr. 2019. Management of drug-resistant tuberculosis. Lancet 394:953–966. doi: 10.1016/S0140-6736(19)31882-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Vanino E, Granozzi B, Akkerman OW, Munoz-Torrico M, Palmieri F, Seaworth B, Tiberi S, Tadolini M. 2023. Update of drug-resistant tuberculosis treatment guidelines: a turning point. Int J Infect Dis 130 Suppl 1:S12–S15. doi: 10.1016/j.ijid.2023.03.013 [DOI] [PubMed] [Google Scholar]
  • 15. Cohen K, Maartens G. 2019. A safety evaluation of bedaquiline for the treatment of multi-drug resistant tuberculosis. Expert Opin Drug Saf 18:875–882. doi: 10.1080/14740338.2019.1648429 [DOI] [PubMed] [Google Scholar]
  • 16. Patel H, Pawara R, Pawara K, Ahmed F, Shirkhedkar A, Surana S. 2019. A structural insight of bedaquiline for the cardiotoxicity and hepatotoxicity. Tuberculosis (Edinb) 117:79–84. doi: 10.1016/j.tube.2019.06.005 [DOI] [PubMed] [Google Scholar]
  • 17. Chan B, Khadem TM, Brown J. 2013. A review of tuberculosis: focus on bedaquiline. Am J Health Syst Pharm 70:1984–1994. doi: 10.2146/ajhp130199 [DOI] [PubMed] [Google Scholar]
  • 18. Anonymous . 2014. Bedaquiline for multidrug-resistant tuberculosis. DTB 52:129–132. doi: 10.1136/dtb.2014.11.0291 [DOI] [PubMed] [Google Scholar]
  • 19. Lakshmanan M, Xavier AS. 2013. Bedaquiline - the first ATP synthase inhibitor against multi drug resistant tuberculosis. J Young Pharm 5:112–115. doi: 10.1016/j.jyp.2013.12.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Huang Z, Luo W, Xu D, Guo F, Yang M, Zhu Y, Shen L, Chen S, Tang D, Li L, Li Y, Wang B, Franzblau SG, Ding CZ. 2022. Discovery and preclinical profile of sudapyridine (WX-081), a novel anti-tuberculosis agent. Bioorg Med Chem Lett 71:128824. doi: 10.1016/j.bmcl.2022.128824 [DOI] [PubMed] [Google Scholar]
  • 21. Collaborative Group for the Meta-Analysis of Individual Patient Data in MDR-TB treatment–2017, Ahmad N, Ahuja SD, Akkerman OW, Alffenaar J-WC, Anderson LF, Baghaei P, Bang D, Barry PM, Bastos ML, et al. 2018. Treatment correlates of successful outcomes in pulmonary multidrug-resistant tuberculosis: an individual patient data meta-analysis. Lancet 392:821–834. doi: 10.1016/S0140-6736(18)31644-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Gao M, Gao J, Xie L, Wu G, Chen W, Chen Y, Pei Y, Li G, Liu Y, Shu W, Fan L, Wu Q, Du J, Chen X, Tang P, Xiong Y, Li M, Cai Q, Jin L, Mei Z, Pang Y, Li L. 2021. Early outcome and safety of bedaquiline-containing regimens for treatment of MDR- and XDR-TB in China: a multicentre study. Clin Microbiol Infect 27:597–602. doi: 10.1016/j.cmi.2020.06.004 [DOI] [PubMed] [Google Scholar]
  • 23. Pym AS, Diacon AH, Tang S-J, Conradie F, Danilovits M, Chuchottaworn C, Vasilyeva I, Andries K, Bakare N, De Marez T, Haxaire-Theeuwes M, Lounis N, Meyvisch P, Van Baelen B, van Heeswijk RPG, Dannemann B, TMC207-C209 Study Group . 2016. Bedaquiline in the treatment of multidrug- and extensively drug-resistant tuberculosis. Eur Respir J 47:564–574. doi: 10.1183/13993003.00724-2015 [DOI] [PubMed] [Google Scholar]
  • 24. Hanumegowda UM, Wenke G, Regueiro-Ren A, Yordanova R, Corradi JP, Adams SP. 2010. Phospholipidosis as a function of basicity, lipophilicity, and volume of distribution of compounds. Chem Res Toxicol 23:749–755. doi: 10.1021/tx9003825 [DOI] [PubMed] [Google Scholar]
  • 25. Xiao H, Yu X, Shang Y, Ren R, Xue Y, Dong L, Zhao L, Jiang G, Huang H. 2023. In vitro and intracellular antibacterial activity of sudapyridine (WX-081) against tuberculosis. Infect Drug Resist 16:217–224. doi: 10.2147/IDR.S390187 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Yao R, Wang B, Fu L, Li L, You K, Li YG, Lu Y. 2022. Sudapyridine (WX-081), a novel compound against Mycobacterium tuberculosis. Microbiol Spectr 10:e02477-21. doi: 10.1128/spectrum.02477-21 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Zheng L, Wang H, Qi X, Zhang W, Wang B, Fu L, Chen X, Chen X, Lu Y. 2024. Sudapyridine (WX-081) antibacterial activity against Mycobacterium avium, Mycobacterium abscessus and Mycobacterium chelonae in vitro and in vivo. mSphere 9:e00518-23. doi: 10.1128/msphere.00518-23 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Koul A, Dendouga N, Vergauwen K, Molenberghs B, Vranckx L, Willebrords R, Ristic Z, Lill H, Dorange I, Guillemont J, Bald D, Andries K. 2007. Diarylquinolines target subunit c of mycobacterial ATP synthase. Nat Chem Biol 3:323–324. doi: 10.1038/nchembio884 [DOI] [PubMed] [Google Scholar]
  • 29. Andries K, Verhasselt P, Guillemont J, Göhlmann HWH, Neefs J-M, Winkler H, Van Gestel J, Timmerman P, Zhu M, Lee E, Williams P, de Chaffoy D, Huitric E, Hoffner S, Cambau E, Truffot-Pernot C, Lounis N, Jarlier V. 2005. A diarylquinoline drug active on the ATP synthase of Mycobacterium tuberculosis. Science 307:223–227. doi: 10.1126/science.1106753 [DOI] [PubMed] [Google Scholar]
  • 30. Milano A, Pasca MR, Provvedi R, Lucarelli AP, Manina G, Ribeiro AL de JL, Manganelli R, Riccardi G. 2009. Azole resistance in Mycobacterium tuberculosis is mediated by the MmpS5-MmpL5 efflux system. Tuberculosis (Edinb) 89:84–90. doi: 10.1016/j.tube.2008.08.003 [DOI] [PubMed] [Google Scholar]
  • 31. Almeida D, Ioerger T, Tyagi S, Li SY, Mdluli K, Andries K, Grosset J, Sacchettini J, Nuermberger E. 2016. Mutations in pepQ confer low-level resistance to bedaquiline and clofazimine in Mycobacterium tuberculosis. Antimicrob Agents Chemother 60:4590–4599. doi: 10.1128/AAC.00753-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Chen S, Shang Y, Zheng J, Huo F, Xue Y, Zhao L, Jiang G, Chu N, Huang H. 2025. In vitro monitoring of drug resistance emergence during stepwise induction of bedaquiline and clofazimine, alone and in combination: a phenotypic and genotypic analysis. J Antimicrob Chemother 80:262–269. doi: 10.1093/jac/dkae405 [DOI] [PubMed] [Google Scholar]
  • 33. Kamariah N, Huber RG, Nartey W, Bhushan S, Bond PJ, Grüber G. 2019. Structure and subunit arrangement of mycobacterial F1FO ATP synthase and novel features of the unique mycobacterial subunit δ. J Struct Biol 207:199–208. doi: 10.1016/j.jsb.2019.05.008 [DOI] [PubMed] [Google Scholar]
  • 34. Hards K, McMillan DGG, Schurig-Briccio LA, Gennis RB, Lill H, Bald D, Cook GM. 2018. Ionophoric effects of the antitubercular drug bedaquiline. Proc Natl Acad Sci USA 115:7326–7331. doi: 10.1073/pnas.1803723115 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Sarathy JP, Ragunathan P, Cooper CB, Upton AM, Grüber G, Dick T. 2020. TBAJ-876 displays bedaquiline-like mycobactericidal potency without retaining the parental drug’s uncoupler activity. Antimicrob Agents Chemother 64:e01540-19. doi: 10.1128/AAC.01540-19 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Hards K, Robson JR, Berney M, Shaw L, Bald D, Koul A, Andries K, Cook GM. 2015. Bactericidal mode of action of bedaquiline. J Antimicrob Chemother 70:2028–2037. doi: 10.1093/jac/dkv054 [DOI] [PubMed] [Google Scholar]
  • 37. Lamprecht DA, Finin PM, Rahman MdA, Cumming BM, Russell SL, Jonnala SR, Adamson JH, Steyn AJC. 2016. Turning the respiratory flexibility of Mycobacterium tuberculosis against itself. Nat Commun 7:12393. doi: 10.1038/ncomms12393 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Ahmed S, Prabahar AE, Saxena AK. 2023. Molecular docking-based interaction studies on imidazo[1,2-a] pyridine ethers and squaramides as anti-tubercular agents. SAR QSAR Environ Res 34:435–457. doi: 10.1080/1062936X.2023.2225872 [DOI] [PubMed] [Google Scholar]
  • 39. Kumar S, Mehra R, Sharma S, Bokolia NP, Raina D, Nargotra A, Singh PP, Khan IA. 2018. Screening of antitubercular compound library identifies novel ATP synthase inhibitors of Mycobacterium tuberculosis . Tuberculosis (Edinb) 108:56–63. doi: 10.1016/j.tube.2017.10.008 [DOI] [PubMed] [Google Scholar]
  • 40. Wang L, Liu Z, Wang J, Liu H, Wu J, Tang T, Li H, Yang H, Qin L, Ma D, et al. 2019. Oxidization of TGFβ-activated kinase by MPT53 is required for immunity to Mycobacterium tuberculosis. Nat Microbiol 4:1378–1388. doi: 10.1038/s41564-019-0436-3 [DOI] [PubMed] [Google Scholar]
  • 41. Ravesloot-Chávez MM, Van Dis E, Stanley SA. 2021. The innate immune response to Mycobacterium tuberculosis infection. Annu Rev Immunol 39:611–637. doi: 10.1146/annurev-immunol-093019-010426 [DOI] [PubMed] [Google Scholar]
  • 42. Sulis G, Pai M. 2020. Isoniazid-resistant tuberculosis: a problem we can no longer ignore. PLoS Med 17:e1003023. doi: 10.1371/journal.pmed.1003023 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Singh R, Dwivedi SP, Gaharwar US, Meena R, Rajamani P, Prasad T. 2020. Recent updates on drug resistance in Mycobacterium tuberculosis. J Appl Microbiol 128:1547–1567. doi: 10.1111/jam.14478 [DOI] [PubMed] [Google Scholar]
  • 44. Günther G, Guglielmetti L, Leu C, Lange C, van Leth F, Tuberculosis Network European Trials group . 2023. Availability and costs of medicines for the treatment of tuberculosis in Europe. Clin Microbiol Infect 29:77–84. doi: 10.1016/j.cmi.2022.07.026 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Peretokina IV, Krylova LYu, Antonova OV, Kholina MS, Kulagina EV, Nosova EY, Safonova SG, Borisov SE, Zimenkov DV. 2020. Reduced susceptibility and resistance to bedaquiline in clinical M. tuberculosis isolates. J Infect 80:527–535. doi: 10.1016/j.jinf.2020.01.007 [DOI] [PubMed] [Google Scholar]
  • 46. Ismail N, Ismail NA, Omar SV, Peters RPH. 2019. In vitro study of stepwise acquisition of rv0678 and atpE mutations conferring bedaquiline resistance. Antimicrob Agents Chemother 63:e00292-19. doi: 10.1128/AAC.00292-19 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Guler R, Brombacher F. 2015. Host-directed drug therapy for tuberculosis. Nat Chem Biol 11:748–751. doi: 10.1038/nchembio.1917 [DOI] [PubMed] [Google Scholar]
  • 48. Giraud-Gatineau A, Coya JM, Maure A, Biton A, Thomson M, Bernard EM, Marrec J, Gutierrez MG, Larrouy-Maumus G, Brosch R, Gicquel B, Tailleux L. 2020. The antibiotic bedaquiline activates host macrophage innate immune resistance to bacterial infection. Elife 9:e55692. doi: 10.7554/eLife.55692 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Xu J, Li D, Shi J, Wang B, Ge F, Guo Z, Mu X, Nuermberger E, Lu Y. 2023. Bedquiline resistance mutations: correlations with drug exposures and impact on the proteome in M. tuberculosis. Antimicrob Agents Chemother 67:e01532-22. doi: 10.1128/aac.01532-22 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Collins L, Franzblau SG. 1997. Microplate alamar blue assay versus BACTEC 460 system for high-throughput screening of compounds against Mycobacterium tuberculosis and Mycobacterium avium. Antimicrob Agents Chemother 41:1004–1009. doi: 10.1128/AAC.41.5.1004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Cowman S, Burns K, Benson S, Wilson R, Loebinger MR. 2016. The antimicrobial susceptibility of non-tuberculous mycobacteria. J Infect 72:324–331. doi: 10.1016/j.jinf.2015.12.007 [DOI] [PubMed] [Google Scholar]
  • 52. Guo S, Wang B, Fu L, Chen X, Zhang W, Huang H, Lu Y. 2021. In vitro and in vivo activity of oxazolidinone candidate OTB-658 against Mycobacterium tuberculosis. Antimicrob Agents Chemother 65:e0097421. doi: 10.1128/AAC.00974-21 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Käser M, Ruf MT, Hauser J, Marsollier L, Pluschke G. 2009. Optimized method for preparation of DNA from pathogenic and environmental mycobacteria. Appl Environ Microbiol 75:414–418. doi: 10.1128/AEM.01358-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. Joon S, Ragunathan P, Sundararaman L, Nartey W, Kundu S, Manimekalai MSS, Bogdanović N, Dick T, Grüber G. 2018. The NMR solution structure of Mycobacterium tuberculosis F-ATP synthase subunit ε provides new insight into energy coupling inside the rotary engine. FEBS J 285:1111–1128. doi: 10.1111/febs.14392 [DOI] [PubMed] [Google Scholar]
  • 55. Eberhardt J, Santos-Martins D, Tillack AF, Forli S. 2021. AutoDock vina 1.2.0: new docking methods, expanded force field, and python bindings. J Chem Inf Model 61:3891–3898. doi: 10.1021/acs.jcim.1c00203 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56. Isa MA, Abubakar MB, Mohammed MM, Ibrahim MM, Gubio FA. 2021. Identification of potent inhibitors of ATP synthase subunit c (AtpE) from Mycobacterium tuberculosis using in silico approach. Heliyon 7:e08482. doi: 10.1016/j.heliyon.2021.e08482 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data presented in this study are available from the corresponding author upon reasonable request.


Articles from mSphere are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES