Skip to main content
BMC Infectious Diseases logoLink to BMC Infectious Diseases
. 2025 Jun 26;25:807. doi: 10.1186/s12879-025-11203-y

Prevalence of foodborne parasitic infections in market-sold aquatic products and high-risk populations in Shanghai, China: surveillance between 2022 and 2024

Simin Dai 1,#, Jun Feng 1,#, Min Chen 1, Huanyu Wu 1, Yujuan Shen 2,, Qing Yu 1,, Jian Chen 1,3,
PMCID: PMC12199485  PMID: 40571940

Abstract

Background

Substantial achievements have been made in preventing and treating human parasitic diseases in China over the past six decades. However, with the recent progression of economic globalization and food diversification, foodborne parasitic diseases have become a significant public health challenge. Here, we investigated and analyzed the characteristics of foodborne parasitic infections arising from market-sold aquatic food products and in key populations.

Methods

Freshwater, seawater, and pickled products were randomly obtained from agricultural trade markets, restaurants, supermarkets, and retail stores in four districts of Shanghai from 2022 to 2024. Parasite metacercariae or larvae were subsequently detected in these aquatic products via artificial digestion or dissection methods. Fecal samples from 698 diarrhea outpatients from the intestinal clinics of hospitals were analyzed via molecular methods.

Results

Of the 1,914 aquatic samples, 163 (8.52%) tested positive for parasites. Nine out of 1,086 freshwater products tested positive for parasites, including Clonorchis sinensis (7; 0.64%) and Gnathosotoma spinigerum (2; 0.18%). Anisakis was detected only in 7 of 27 seawater fish species, with contamination rates ranging from 6.00 to 100.00%. Echinostoma metacercariae was found only in marinated mud snails (20.43%). The prevalence of Clonorchis sinensis metacercariae in freshwater fish was highest in the second quarter (April–June), and catering samples presented the highest contamination rate, at 12.96%. In the sequence analysis, only one outpatient sample tested positive for parasitic infection, identified as Cryptosporidium meleagridis. No Giardia lamblia was found in the participants.

Conclusions

Foodborne parasite contamination occurs in market-sold aquatic food products in Shanghai Municipality, although the incidence of parasite infection was low in the key populations tested. Further studies are needed to establish more comprehensive information that could improve public health and human food safety awareness.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12879-025-11203-y.

Keywords: Foodborne parasite, Market-sold aquatic product, Prevalence, Contamination, Shanghai municipality

Background

Foodborne parasites (FBPs) are increasingly recognized as a cause of serious economic and public health problems worldwide, particularly in East Asia and South America [1]. In 2012, the Food and Agriculture Organization (FAO) of the United Nations and the World Health Organization (WHO) identified over 20 high-priority FBPs, including Clonorchis sinensis, Ascaris spp., and Cryptosporidium spp., many of which are endemic to East Asia [2]. Humans acquire parasitic infections by consuming contaminated food or water containing parasite eggs, larvae (nematodes, trematodes, and cestodes), or protozoan oocysts/cysts [3]. There are six categories of FBP disease, classified by the source of food: meat-borne, fish-borne, plant-borne, water-borne, mollusk-borne, and freshwater crustacean-borne [4]. Diseases caused by FBPs encompass various conditions, such as clonorchiasis, cysticercosis, paragonimiasis, toxoplasmosis, giardiasis, and cryptosporidiosis [3, 5]. A systematic review and meta-analysis from a Global Burden of Disease Study demonstrated that approximately 56.2 million people were infected with foodborne trematodes in 2005 [6].

Despite China’s remarkable progress in controlling parasitic diseases, such as the elimination of filariasis (2007) and malaria (2021) [79], FBP diseases remain a persistent and underprioritized challenge. National surveillance data indicate that diseases such as clonorchiasis are spreading in certain provinces, with an estimated 643,000 disability-adjusted life years (DALYs) lost annually [10]. However, current monitoring efforts are fragmented: while human population surveillance for parasitic diseases has been ongoing since 1990 [11], only clonorchiasis has been consistently tracked, and food contamination monitoring remains sporadic and inconsistent due to shifting annual priorities.

Of particular concern are protozoan parasites such as Cryptosporidium spp. and Giardia duodenalis, which are major causative agents of water- and food-borne diarrheal diseases worldwide [12]. These pathogens are frequently linked to outbreaks originating in contaminated fresh produce, drinking water, and improperly handled food [13]. Cryptosporidium and Giardia infections are often underdiagnosed in clinical settings in China, as routine stool examinations frequently miss these pathogens without specialized testing. Given that diarrheal diseases contribute substantially to the burden of FBP disease, particularly in children and immunocompromised individuals, including these protozoa in surveillance is critical for accurate risk assessment and public health intervention [14].

Shanghai, a major economic hub with high consumption of aquatic products, presents a unique paradox: although human parasitic infections are rare, surveillance since 2015 has repeatedly detected parasites in commercially available food, indicating a potential risk for outbreaks [1517]. Given the city’s role as a national food distribution center, contaminated products could facilitate the spread of FBPs beyond endemic areas. However, in recent years, no systematic assessment of FBP contamination in Shanghai’s food supply or high-risk populations (including diarrhea patients) has been conducted.

Here, we aimed to bridge this critical gap by analyzing FBP contamination in food and key population groups in Shanghai from 2022 to 2024. The findings provide evidence-based recommendations for strengthening FBP surveillance strategies and preventive measures for Shanghai and other urban centers facing similar risks. Our results could support national and global efforts to mitigate the hidden burden of foodborne parasitic diseases.

Materials and methods

This study employed a repeated cross-sectional surveillance design and was conducted from 2022 to 2024.

Study area and design

Shanghai Municipality includes 16 administrative districts, among which the Huangpu, Putuo, Minhang, and Qingpu districts have conducted repeated cross-sectional surveys to explore FBP infections in market-sold aquatic products since 2016 as part of the Shanghai Surveillance Program of Key Human Parasitic Helminthic Diseases. The Shanghai Surveillance Program of Common Parasitic Protozoa Diseases was also issued in 2016, in which the Changning, Hongkou, Pudong, Minhang, and Jiading districts were designated protozoan monitoring areas for intestinal outpatients with diarrhea. Each district selected one or two hospitals with enteric disease clinics for diarrhea patients requiring quarantine as monitoring sites. Districts without surveillance plans for diarrhea patients must also take the initiative to report to the Shanghai Municipal Center for Disease Control and Prevention (SCDC) if suspected or confirmed cases are found in the area.

During this study, the SCDC was responsible for supervision, data review, quality control, and polymerase chain reaction (PCR) testing of stool samples from diarrhea patients. Staff members from each district-level Center for Disease Control (CDC) were responsible for the study organization, sample collection, pathogen detection for food samples, and initial data input.

Sample collection (Food and Patients)

From March to November in 2022 through 2024, monthly randomized food sampling was conducted across four Shanghai districts (Huangpu, Putuo, Minhang, and Qingpu), encompassing agricultural markets, restaurants, supermarkets, and retail outlets. During market sampling, 500 g was considered as one sample for small products (such as Rhodeus or Pseudorasbora parva). During catering sampling (mainly in restaurants), individual dishes served to consumers were collected as sampling units. The targeted dishes predominantly comprised raw or minimally processed aquatic products, including salmon (typically served as sashimi), marinated mud snails in yellow wine, crab paste, wine-soaked shrimp, and liquor-saturated crab. Live aquatic products slaughtered and prepared onsite in restaurants were also included in our sample collection protocol.

A total of 698 fecal samples from outpatients with diarrhea were collected for Cryptosporidium and Giardia lamblia detection at the SCDC Parasitological Laboratory from September 2022 to December 2024. Most of the patients in this study were randomly selected from the five monitoring districts; only one patient was reported by another district. All the participants visited hospital enteric disease clinics and experienced three or more loose or liquid stools per day [18].

Parasite detection in aquatic products

All the aquatic products analyzed in this study can be classified into three major categories: freshwater, seawater, and pickled products. Parasitological detection focused on three principal parasitic groups: nematodes (e.g., Anisakis, Gnathostoma), trematodes (e.g., Clonorchis, Paragonimus, Echinostoma), and cestodes (e.g., Diphyllobothrium) (Fig. 1).

Fig. 1.

Fig. 1

Categories of market-sold aquatic products collected from 2022 to 2024 in Shanghai, China. This study analyzed aquatic products across four categories: fish, crustaceans, pickled products, and marine shellfish/mollusks. Parasite screening targeted nematodes (e.g., Anisakis), trematoda (e.g., Clonorchis), and cestodes (e.g., Diphyllobothrium).

Freshwater aquatic products were primarily examined via the artificial digestion method. The fish, shrimp, or crab meat was crushed and placed in a flask to prepare for digestion. Artificial digestive fluid (prepared by mixing hydrochloric acid at a final concentration of 0.5% (w/v) from a 1% stock mixture with pepsin at a final concentration of 1% (w/v) and distilled water) was added, and the mixture was stirred thoroughly and incubated at 36 °C ± 1 °C for approximately 4–16 h or overnight. The supernatant was discarded, and an appropriate amount of distilled water was added. The mixture was then stirred and allowed to stand for 20–30 min. The supernatant was then slowly discarded. This washing process was repeated by adding more distilled water and discarding the supernatant until it was clear. All the sediments were collected and examined under a microscope for parasitic metacercariae. The digestion method was also applied to detect pickled products.

Seawater aquatic products were assessed primarily via the direct dissection method. The abdominal cavity, gastrointestinal mesentery, and muscle tissues of the samples were dissected to check for Anisakis larvae. Then, the larvae were placed in a Petri dish containing 0.85% physiological saline and fixed with 5% formalin or 70% ethanol heated to approximately 70 °C, and their morphology was identified under a dissecting microscope or optical microscope.

Molecular detection in stool samples

Sufficient fecal samples (n = 698) were collected for DNA extraction and purification via the QIAamp DNA Fast Stool Mini Kit (Qiagen, Germany). The extracted DNA was stored at − 20 °C for PCR analysis. The small subunit (SSU) rRNA gene of Cryptosporidium and the triose phosphate isomerase (TPI) gene of G. lamblia were identified via nested PCR [19, 20]. All primers used in the study are listed in Table 1. Premix Taq™ (Ex Taq™ Version 2.0 plus dye) was used to identify the gene. Each 25 µl reaction mixture contained 12.5 µl of Taq mix, 1 µl of 10 µM sense and antisense primers each, 1 µl of DNA template, and 9.5 µl of nuclease-free water.

Table 1.

Primers used for Cryptosporidium and Giardia lamblia gene amplification

Genus Gene Sequence of primers (5’–3’) Amplicon size (bp)
Cryptosporidium Small subunit (SSU) rRNA CryF1: TTCTAGAGCTAATACATGCG ~ 1325
CryR1: CCCATTTCCTTCGAAACAGGA
CryF2: GGAAGGGTTGTATTTATTAGATAAAG 826–864
CryR2: AAGGAGTAAGGAACAACCTCCA
Giardia lamblia Triose phosphate isomerase (TPI) TPIF1: AAATIATGCCTGCTCGTCG ~ 605
TPIR1: CAAACCTTITCCGCAAACC
TPIF2: CCCTTCATCGGIGGTAACTT ~ 530
TPIR2: GTGGCCACCACICCCGTGCC

The positive control DNA for Cryptosporidium was obtained from archived review samples at the SCDC and was verified by sequencing. The negative control samples were obtained from healthy people.

The thermal program used for Cryptosporidium PCR was as follows: 94 °C for 3 min; 35 cycles of 94 °C for 45 s, 55 °C for 45 s, and 72 °C for 1 min; and 72 °C for 7 min, with a hold step at 4 °C. For G. lamblia, the cycling conditions were as follows: 94 °C for 1 min; 35 cycles of 94 °C for 50 s, 57.5 °C for 30 s, and 72 °C for 1 min; and 72 °C for 10 min, with termination at 4 °C. A second reaction was conducted for both parasites following the same protocol. Each sample was analyzed at least three times via PCR with positive and negative controls included per run. The secondary PCR products were sequenced by a commercial company (Sangon Biotech, Shanghai, China). The sequence accuracy was confirmed by two-directional sequencing.

Phylogenetic analysis

A phylogenetic analysis was performed to elucidate the evolutionary relationships and validate the taxonomic identity of the obtained sequences. All sequences were processed and assembled via BioEdit software (version 7.2.5). Edited sequences were compared against the GenBank database via the NCBI Basic Local Alignment Search Tool (BLAST), with a minimum query coverage threshold of 50% for homology screening. The SSU rRNA gene sequence of Cryptosporidium meleagridis identified in this study was aligned with homologous sequences retrieved from GenBank via ClustalW (version 2.0) (http://www.clustal.org/). Phylogenetic trees were constructed in MEGA 7 via the neighbor‒joining (NJ) method [2124] with 1,000 bootstrap replicates to assess node reliability.

Statistical analysis

Epi-Info 3.1 software was used to record surveillance data and laboratory examination findings. Double entry and recheck steps were used to ensure data accuracy. All the statistical analyses were performed via SAS Version 9.4 (SAS Institute, Cary, NC, USA). Pearson’s chi-square test was used to investigate associations among qualitative categorical variables, and a p value < 0.05 was considered to indicate significance. The Bonferroni correction was used for each pairwise comparison.

Ethical considerations

The study protocol was reviewed and approved by the Human Research Ethics Committee of the Shanghai Municipal Center for Disease Control and Prevention (reference number 2022-55) in accordance with the tenets of the Declaration of Helsinki and the International Ethical Guidelines for Health-related Research Involving Humans.

Results

Parasite contamination in market-sold aquatic products

During the 2022–2024 surveillance period, 1,914 food samples were collected from Shanghai, revealing an overall FBP prevalence of 8.52% (163/1,914). Analysis by product category revealed distinct contamination patterns: freshwater products presented the highest infection rate (17.43%, 88/505), followed by pickled products (20.43%, 66/323). Seawater products presented significantly lower contamination rates (0.83%, 9/1,086) (χ2 = 192.710, p = 0.000, p < 0.0167). Four parasite species were detected in the samples: Clonorchis sinensis, Echinostoma, Gnathosotoma spinigerum, and Anisakis.

C. sinensis contamination was primarily concentrated in three fish species, with Pseudorasbora parva showing the highest infection rate (2/2). G. spinigerum infections were exclusively found in Monopterus albus, with an infection rate of 0.65% (2/309). Anisakis was the sole parasite detected in the seawater products, and it was present in 7 of the 27 sampled fish species. Infection rates varied significantly across host species (range: 0.6–100%; χ2 = 63.354, p = 0.000, p < 0.0024) (Fig. 2).

Fig. 2.

Fig. 2

Fish species composition and prevalence. The data show various freshwater and seawater fish species with their respective sample sizes (N), including Cololabis saira (N = 3), Pneumatophorus japonicus (N = 6), Larimichthys crocea (N = 50), and Monopterus albus (N = 309). The prevalence of parasitic infection is provided for selected species, and it ranges from 0–100%.

Among 323 sampled pickled products (186 marinated mud snails, 21 crab paste, 46 wine-soaked shrimp, and 70 liquor-saturated crabs), Echinostoma metacercariae were exclusively detected in marinated mud snails, with a contamination rate of 20.43% (66/323).

Notably, no Diphyllobothrium (120 freshwater/116 seawater fish) or Paragonimus (191 freshwater crabs) were detected.

Temporal and spatial variations in contamination

Seasonal trends

From 2022 to 2024, the FBP positivity rates increased from 7.59% (36/474) to 11.57% (70/605), and the difference was significant (χ2 = 10.820, p = 0.004, p < 0.0167) (Fig. 3). The prevalence of Anisakis, C. sinensis, and Echinostoma peaked in April–June, although only C. sinensis demonstrated a significant difference (p < 0.05) (Fig. 3).

Fig. 3.

Fig. 3

Seasonal patterns of foodborne parasites. The line chart shows the prevalence (%) of four parasites (Anisakis, Clonorchis sinensis, Echinostoma, and Gnathostoma spinigerum) across four quarterly periods (January–March, April–June, July–September, and October–December). Prevalence values range from 0–25%, with distinct seasonal variations observed for each parasite.

Sampling sources

The catering samples demonstrated the highest contamination rate (12.96%, 28/216), followed by the supermarket and retail store samples (9.12%, 63/691); the agricultural trade market samples demonstrated the lowest contamination rate (7.15%, 72/1007), and the difference was significant (χ2 = 10.820, p = 0.016, p < 0.0167) (Table 2).

Table 2.

Distribution of foodborne parasites in market-sold aquatic products collected from shanghai, 2022–2024

2022 2023 2024 Total χ2 p value
No. Positive/No. Examined Positive Rate (%) No. Positive/No. Examined Positive Rate (%) No. Positive/No. Examined Positive Rate (%) No. Positive/No. Examined Positive Rate (%)
Type of Food Product
Seawater Products 26/84 30.95b 28/267 10.49b 34/154 22.08b 88/505 17.43b
Freshwater Products 3/308 0.97a 4/447 0.89a 2/331 0.60a 9/1086 0.83a 192.710 0.000
Pickled Products 7/82 8.54c 25/121 20.66c 34/120 28.33b 66/323 20.43b
χ2 84.641 66.763 88.479
p value 0.000 0.000 0.000
Sampling Process
Catering 0/13 0.00 4/126 3.17a 24/77 31.17a 28/216 12.96a
Supermarket and Retail Store 8/134 5.97 31/316 9.81a 24/241 9.96b 63/691 9.12a, b 8.215 0.016
Agricultural trade market 28/327 8.56 22/393 5.6a 22/287 7.67b 72/1007 7.15b
χ2 2.009 7.997 33.795
p value 0.366 0.018 0.000
Total 36/474 7.59a.b 57/835 6.83b 70/605 11.57a 163/1914 8.52 10.82 0.004

Key: Superscript a/b indicates a significant difference between the two groups

Cryptosporidium and Giardia lamblia infection rates in the participants

In total, 698 outpatients with diarrhea were recruited, including 338 males and 360 females. Their average ages were 50.06 ± 20.623 (SD) and 53.41 ± 20.543 (SD) years, respectively. Among the 698 fecal samples from these participants, only one tested positive for Cryptosporidium after PCR amplification of the SSU rRNA gene. The infection rate of Cryptosporidium was 0.14% (1/698), and G. lamblia was not detected.

Genotypes of Cryptosporidium and phylogenetic analysis

On the basis of sequence analysis of the SSU rRNA gene, one sample was identified as a Cryptosporidium meleagridis isolate. An NJ tree was constructed using published gene sequences from humans and domestic animals. A total of 36 SSU rRNA gene sequences originating from Cryptosporidium (Supplementary File S1) were categorized for further analysis. The set of DNA sequences (Supplementary Files S1), including one positive Cryptosporidium sample in this study(Supplementary Files S2), was used for phylogenetic analysis (Fig. 4). Our results provide genomic confirmation of the DSM Cm as SSU rRNA through high alignment with the SSU rRNA of other Cryptosporidium origins. In addition, the phylogenetic tree revealed that DSM Cm was closely related to PP467579, which was identified from pigeon fecal samples in Colombia.

Fig. 4.

Fig. 4

Molecular phylogenetic analysis via the neighbor‒joining method. A total of 36 small subunit (SSU) rRNA gene sequences originating from Cryptosporidium were categorized for further analysis. The set of DNA sequences, including one positive for Cryptosporidium (DSM Cm) in this study, was used for phylogenetic analysis. DSM Cm was closely related to PP467579, which was identified from a pigeon fecal sample in Colombia.

Discussion

With the rapid economic growth and globalization of food trade, Shanghai’s markets have witnessed a diversification of commercially available foods, many of which are perceived as health-enhancing. However, these products may serve as vectors for FBPs when contaminated.

Surveillance data from 2022 to 2024 revealed a rising trend in FBP contamination. The positive infection rate of C. sinensis in freshwater fish sold in Shanghai reached 2.28% (7/307), which was much higher than the survey results from 2015 to 2019 [16]. Anisakis was the main parasite detected in seawater products, and its prevalence, although lower than that in 2015–2019, exceeded the rates observed from 2005 to 2010 [16, 17]. Of particular concern is the detection of third-stage Gnathostoma larvae in Monopterus albus at a 0.65% infection rate (2/309) [2527], despite historically few reports in Shanghai. Bixian et al. [28]. reported that various factors are responsible for the increasing prevalence of FBP diseases. First, the ecological complexity of diverse intermediate and definitive hosts and intensified human mobility complicate disease surveillance and diagnostic accuracy. Second, shifting dietary patterns, the globalization of food sources, and people’s consumption of fresh produce increase the risk of parasite exposure. Third, in China’s multicultural context, certain traditional practices, such as consuming raw Monopterus albus or Misgurnus anguillicaudatus for perceived medicinal benefits, further potentiate the risk of parasitic transmission.

The primary freshwater fish infected with C. sinensis were Pseudorasbora parva and Rhodeus, similar to the results obtained by Wang et al. [16]. According to previous research, this type of small fish is the most vulnerable species to C. sinensis, as it lives in the phreatic layer of water and has a habitat associated with freshwater snails; therefore, it is considered an important second intermediate host [29]. The infected marine fish included seven species, consistent with other reported results [30, 31]. The different prevalence rates among these marine fish might be attributable to the suitability of the in vivo environment for parasite survival, the freshness of the fish collected, the sampling time, and the sampling quantity [30, 3234]. Further in-depth research could be conducted to assess these factors in the future.

Comparative analysis of FBP prevalence across different food processing methods revealed that catering establishments (primarily restaurants) presented the highest contamination rates. This finding may be attributable to the predominant use of nonthermal preparation methods. Pickled products presented the highest Echinostoma metacercariae prevalence among the catering sector samples. Notably, our study detected metacercariae primarily in marinated mud snails, despite National Food Safety Standards (GB10136—2015) [35] prohibiting their presence in ready-to-eat raw aquatic products. Interestingly, the Yangtze River Delta residents, including Shanghai locals, persistently consume alcohol-marinated foods despite public health warnings about alcohol’s inability to kill metacercariae. Furthermore, individuals appear hesistant to change this deeply ingrained dietary practice. Although no C. sinensis-positive samples were detected in this study, this pathogen cannot be overlooked, as it has long been a predominant FBP in China [36]. Generally, freshwater fish such as Pseudorasbora parva, Rhodeus, and Carassius auratus are not consumed raw as “sashimi” or “yusheng” (a special dish, mainly popular in the Guangdong and Guangxi areas of China, with ingredients of raw freshwater fish such as Ctenopharyngodon idella and Lateolabrax japonicus)‌ locally but are commonly found in popular food preparations, including hotpots, barbecues, and deep-fried dishes. High economic development has made it possible for more people to visit restaurants, which undoubtedly increases the risk of clonorchiasis transmission.

Moreover, Liu et al. showed that the eggs of C. sinensis are more likely to hatch into larvae in the first intermediate host (freshwater snails) at temperatures above 20 °C. In addition, the number of cercariae that successfully invade freshwater fish is the highest at temperatures ranging from 20 to 30 °C [36, 37]. Our findings demonstrated that the prevalence of Clonorchis sinensis metacercariae in freshwater fish was the highest in the second quarter, which, to some degree, also reflects the influence of precipitation and temperature on the prevalence of FBPs. However, this study revealed no quarterly differences in Anisakis, G. spinigerum, or Echinostoma infection rates, even though Anisakis demonstrated the highest contamination rate from April to June, consistent with the findings of other studies [31].

Using nested PCR, one Cryptosporidium-positive case was found in this study, and the genotyping results indicated that this positive sample belonged to Cryptosporidium meleagridis, the third most prevalent Cryptosporidium species infecting humans. This species has been recorded previously in diarrheic children in Wuhan, HIV-positive patients in Henan, and pediatric patients in Shanghai [19, 3840]. Phylogenetic analysis of the SSU rRNA sequences revealed high sequence identity in the Cryptosporidium meleagridis strain. This conserved evolutionary pattern across continents indicates minimal geographical restriction in pathogen distribution, underscoring the necessity for international collaboration in establishing cross-border surveillance systems for cryptosporidiosis control. Notably, phylogenetic reconstruction revealed that the DSM Cm strain formed a distinct cluster with another strain (GenBank accession: PP467579.1), which was identified from pigeon fecal samples in Colombia, suggesting potential bird-to-human transmission pathways. Moreover, given that the positive case did not originate from one of our surveillance sites, the current surveillance model has limitations. Currently, the SCDC collects case data at the municipality level from each monitoring site responsible for randomly performing immunological tests for Cryptosporidium and G. lamblia among 300 outpatients with diarrhea annually, which may lead to several missed diagnoses. For example, the 300 cases analyzed may not include all suspected cases. Moreover, the fixed surveillance area leads to missed diagnoses of cases in other districts.

This study has some limitations. First, the identification of metacercariae or nematode larvae relied mainly on parasitic morphology as determined by inspectors and their judgment of the epidemiological probability of the sampled hosts, which may have caused inaccuracies in the prevalence reported in this study. Molecular methods based on parasite-specific nucleotide sequences should be applied, as they have satisfactory sensitivity and specificity. Second, this study included only a single Cryptosporidium case and lacked complementary water quality data, which may have affected the statistical power of our analysis.

Conclusion

This study is of substantial significance in evaluating the prevalence of FBPs among market-sold aquatic food products and key Shanghai Municipality populations in recent years. Even though the incidence of FBP infections in humans is relatively low, the surveillance results revealed an increasing food contamination rate over time and an increased risk of exposure to FBPs in the population. As an international metropolis with a large annual migrant population and numerous food products, various measures need to be implemented in Shanghai, including the establishment of a well-rounded, active surveillance system for both food and water, a focus group integrated into the current monitoring model, environment hygiene improvement, and health and diet safety education. Our findings serve as a scientific basis for local government policy-making and as a baseline for future researchers to explore food safety and public health in depth.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1 (25.2KB, docx)
Supplementary Material 2 (102.6KB, docx)

Acknowledgements

The authors would like to thank the researchers from the Chinese Center for Disease Control and Prevention (Chinese Center for Tropical Diseases Research), National Institute of Parasitic Diseases, for their scientific support. Furthermore, we thank the medical staff from the Centers for Disease Control and Prevention at all levels and other institutes for foodborne parasitic disease management in Shanghai. This study uses data obtained via their kind collaboration.

Abbreviations

FBP

Foodborne parasite

FAO

Food and Agriculture Organization of the United Nations

WHO

World Health Organization

DALY

Disability adjusted life years

SCDC

Shanghai Municipal Center for Disease Control and Prevention

CDC

Centers for Disease Control and Prevention

PCR

Polymerase chain reaction

NCBI

National Center for Biotechnology Information

BLAST

Basic Local Alignment Search Tool

NJ

Neighbor-joining

SD

Standard deviation

Author contributions

SD and JF contributed equally, jointly designed and conducted the study. SD drafted the article. JF performed the statistical analysis. YS, QY, JC, MC and HW revised the manuscript. All authors read and approved the final manuscripts.

Funding

This research was supported partially by the Academic Research Leader of Three-year Action Program of Shanghai Municipality for Strengthening the Construction of Public Health System (2023–2025) (No. GWVI-11.2-XD04); the Key Discipline-Infectious Diseases of Three-year Action Program of Shanghai Municipality for Strengthening the Construction of Public Health System (2023–2025) (No. GWVI-11.1-01); the National Nature Science Foundation of China (Nos. 82372283 and 82072307); and the Three-Year Initiative Plan for Strengthening Public Health System Construction in Shanghai (2023–2025) Key Discipline Project (No. GWVI-11.1-09).

Open Research Projects of the NHC Key Laboratory of Parasitic Pathogen and Vector Biology.

Grant [NHCKFKT2022-01]

Data availability

Data supporting the conclusions of this article are included within the article. The datasets used and/or analysed during the present study are available from the corresponding author upon reasonable request. The unique nucleotide sequences of Cryptosporidium parvum identified in this study were deposited in GenBank under the following accession number: PQ899566.

Declarations

Ethics approval and consent to participate

All included patients provided oral and written informed consent. The study was reviewed and approved by the ethical committee of the Shanghai Municipal Centers for Disease Control & Prevention (reference number 2022-55) in accordance with the tenets of the Declaration of Helsinki and the International Ethical Guidelines for Health-related Research Involving Humans.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Simin Dai and Jun Feng contributed equally to this work.

Change history

7/12/2025

This article has been updated to amend the funding information

Contributor Information

Yujuan Shen, Email: shenyj@nipd.chinacdc.cn.

Qing Yu, Email: yuqing_1@scdc.sh.cn.

Jian Chen, Email: chenjian@scdc.sh.cn.

References

  • 1.Robertson LJ, Sprong H, Ortega YR, VandG, Joke WB, Fayer R. Impacts of globalisation on foodborne parasites. Trends Parasitol. 2014;30(1):37–52. [DOI] [PubMed] [Google Scholar]
  • 2.World Health Organization(WHO). Multicriteria-based ranking for risk management of food-borne parasites. Rome, Italy; 2014.
  • 3.Giessen JVD, Deksne G, Gómez-Morales MA, Troell K, Gomes J, Sotiraki S, et al. Surveillance of foodborne parasitic diseases in Europe in a one health approach. Parasite Epidemiol Control. 2021;13:e00205. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Liu X, Wu M, Liu Y, Li J, Yang D, Jiang L. Foodborne parasites dominate current parasitic infections in Hunan province, China. Front Cell Infect Microbiol. 2021;11:774980. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Torgerson PR, De Silva NR, Fèvre EM, Kasuga F, Rokni MB, Zhou XN, et al. The global burden of foodborne parasitic diseases: an update. Trends Parasitol. 2014;30(1):20–6. [DOI] [PubMed] [Google Scholar]
  • 6.Fürs T, Keiser J, Utzunger J. Global burden of human food-borne trematodiasis: a systematic review and meta-analysis. Lancet Infect Dis. 2012;12(3):210–21. [DOI] [PubMed] [Google Scholar]
  • 7.Sun DJ, Fang Y, Huang Y, Zhang Y. Contributions to the lymphatic filariasis elimination programme and post-elimination surveillance in China by NIPD-CTDR. Adv Parasitol. 2020;110:145–83. [DOI] [PubMed] [Google Scholar]
  • 8.Feng J, Zhang L, Xia Z, Zhou SS, Zhou XN. Malaria-free certification in china: achievements and lessons learned from the National malaria elimination programme. Zoonoses 2021.
  • 9.Wang W, Bergquist R, King CH, Yang K. Elimination of schistosomiasis in china: current status and future prospects. PLos Negl Trop Dis. 2021;15(8):e0009578. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Xie Y, Shi D, Wang X, Guan Y, Wu W, Wang Y. Prevalence trend and burden of neglected parasitic diseases in China from 1990 to 2019: findings from global burden of disease study. Front Public Health. 2023;11:1077723. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Qu SH, Xu LQ, Jiang ZX, Xu SH, Han JJ, Zhu YG et al. Report of the first National survey of human parasite distribution I: regional distribution of insect species. Chi J Parasitol Parasit Dis. 1994.
  • 12.Efstratiou A, Karanis, Panagiotis, Ongerth J et al. Waterborne transmission of protozoan parasites: review of worldwide outbreaks - An update 2011–2016. 2017;114(May 1):14–22. [DOI] [PubMed]
  • 13.Yaoyu F, Lihua XJFM. Mol Epidemiol Cryptosporidiosis China. 2017;8:1701. [Google Scholar]
  • 14.Torgerson PR, Devleesschauwer B, Praet N, Speybroeck N, Willingham AL, Kasuga F et al. World Health Organization Estimates of the Global and Regional Disease Burden of 11 Foodborne Parasitic Diseases, 2010: A Data Synthesis. (1549–1676 (Electronic)). [DOI] [PMC free article] [PubMed]
  • 15.Qu Q, Pan H, Jiang L, Zhu M, Jin YJ, Wang ZY. Potential transmission risk of key parasitic diseases and responses to the risk during the construction of an ecological City in Shanghai municipality. Chin J Schisto Control. 2022;34(5):531–6. [DOI] [PubMed] [Google Scholar]
  • 16.Wang ZY, Wu HY, Jiang L, Ma XJ, Zhang YG, He YY, et al. Surveillance and analysis of parasitic infection in food on market in Shanghai during 2015–2019. Chi J Parasitol Parasit Dis. 2021;39(3):347–52. [Google Scholar]
  • 17.Zhang XP, Jiang SF, Hong GB, Fu YH, He YY, Ma XJ, et al. Investigation on food contamination with parasites in Shanghai market. Chin J Schisto Control. 2012;24(4):404–9. [PubMed] [Google Scholar]
  • 18.World Health Organization(WHO). Diarrhoeal disease. https://www.who.int/news-room/fact-sheets/detail/diarrhoeal-disease. Accessed 15 Feb 2025.
  • 19.Xiao L, Escalante L, Yang C, Sulaiman I, Escalante AA, Montali RJ, et al. Phylogenetic analysis of Cryptosporidium parasites based on the small-subunit rRNA gene locus. Appl Environ Microbiol. 1999;65(4):1578–83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Sulaiman IM, Fayer R, Bern C, Gilman RH, Trount JM, Schantz PM, et al. Triosephosphate isomerase gene characterization and potential zoonotic transmission of Giardia duodenalis. Emerg Infect Dis. 2003;9(11):1444–52. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Kumar S, Stecher G, Tamura K. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Bio Evol. 2016;33(7):1870–4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Saitou N, Nei M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol Bio Evol 1987;4:406–25. [DOI] [PubMed] [Google Scholar]
  • 23.Tamura K, Nei M, Kumar S. Prospects for inferring very large phylogenies by using the neighbor-joining method. Proc Natl Acad Sci (USA). 2004;101:11030–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Kumar S, Stecher G, Tamura K. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol. 2016;33(7):1870–4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Cai WW, Lin CX, Jiang DW. Investigation on the parasitic infection of some market freshwater products in Fujian Province from 2014–2019. J Trop Dis Parasitol. 2021;19(2):74–8. [Google Scholar]
  • 26.Xu CH, Yang LY, Zhang H, Chen SY, Xu JM, Chen HY, et al. Survey on Gnathostoma infection in some aquatic products sold in Guangzhou. J Trop Med. 2019;19(4):489–94. [Google Scholar]
  • 27.Zhang HM, Wu HF, Jiang H, Huang WY, Tan YG, Huang FM, et al. Survey on Gnathostoma infection in water products from free markets in Guangxi. Pract Prev Med. 2012;18(4):193–8. [Google Scholar]
  • 28.Bixian N, Zhang Q, Tang F, Zhang JY, Mao FZ, Liu YB. Risk factors of dood-borne parasitic diseases still remian in china: a wechat-based knowledge, attitudes, and practices study. BMC Public Health. 2024;24(1):2763. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Cheng RX, Xiao QQ, Zhen ZL. Study on the causes of susceptibility of wild wheatspike to clonorchis sinesis ceraria. Chin J Parasit Dis Con. 2005;18(2):155. [Google Scholar]
  • 30.Zhang WQ, Ren XT, Zhao YQ, Gai XX, Zhang YM. Investigation of Anisakis spp. Larva infection in marine fish for sale in Yantai Cit. Chin J Parasitol Parasitic Dis. 2017;35(5):472–8. [Google Scholar]
  • 31.Song YQ, Diao WL, Li S, Cheng YF, Wang KL. Analysis of Anisakis infection in live marine fish in Liaoning Province from 2012 to 2018. Pract Prev Med. 2022;29(4):473–5. [Google Scholar]
  • 32.Tang YZ, Sun QS, Peng P, Wang XL, Liu MY. Research progress of Anisakis disease in China. J Anhui Agric Sci. 2012;40(24):12079–81. [Google Scholar]
  • 33.Sun ZS. Investigation on infection of Anisakis larvae among fish from Bo and South sea in China. Chin J Parasitol Parasitic Dis. 1996;14(3):173–6. [Google Scholar]
  • 34.Aibinu IE, Smooker PM, Lopata AL. Anisakis nematodes in fish and shellfish from infection to allergies. Int J Parasitol Parasites Wildl. 2019;9:384–93. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.National Health and Family Planning Commission of the People’s Republic of China. National standard (Mandatory) of the people’s Republic of china: National food safety standard for aquatic products of animal origin GB 10136– 2015. Beijing: Standards Press of China; 2016. [Google Scholar]
  • 36.Zhang Y, Gong QL, LV QB, Qiu YY, Wang YC, Qiu HY, et al. Prevalence of Clonorchis sinensis infection in fish in South-East asia: A systematic review and meta‐analysis. J Fish Dis. 2020;43(11):1409–18. [DOI] [PubMed] [Google Scholar]
  • 37.Liu YS. Biology and control of. Clonorchis sinensis. 2nd ed. Science; 2012.
  • 38.Wang T, Fan YY, Koehler AV, Ma GX, Li T, Hu M, et al. First survey of cryptosporidium, Giardia and enterocytozoon in diarrhoeic children from wuhan, China. Infect Genet Evol. 2017;51:127–31. [DOI] [PubMed] [Google Scholar]
  • 39.Feng YY, Wang L, Duan LP, Gomez-Puerta LA, Zhang LX, Zhao XK, et al. Extended outbreak of cryptosporidiosis in a pediatric hospital, China. Emerg Infect Dis. 2012;18(2):312–4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Elwin K, Hadfield SJ, Robinson G, Chalmers RM. The epidemiology of sporadic human infections with unusual cryptosporidia detected during routine typing in England and wales, 2000–2008. Epidemiol Infect. 2012;140(4):673–83. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 1 (25.2KB, docx)
Supplementary Material 2 (102.6KB, docx)

Data Availability Statement

Data supporting the conclusions of this article are included within the article. The datasets used and/or analysed during the present study are available from the corresponding author upon reasonable request. The unique nucleotide sequences of Cryptosporidium parvum identified in this study were deposited in GenBank under the following accession number: PQ899566.


Articles from BMC Infectious Diseases are provided here courtesy of BMC

RESOURCES