Skip to main content
Parasite Epidemiology and Control logoLink to Parasite Epidemiology and Control
. 2025 Jun 11;30:e00440. doi: 10.1016/j.parepi.2025.e00440

High efficacy of camphene and metronidazole combination therapy against Giardia lamblia infection in mice

Marwa Sami Alwan 1, Hussam Saeed Al-Aredhi 1, Ikhlas Abbas Marhoon 1,
PMCID: PMC12205813  PMID: 40585948

Abstract

Although synthetic antigiardial medications frequently exhibit efficacy, they may also result in negative side effects. Furthermore, issues related to drug resistance and the potential for mutagenic effects have been highlighted. The current research seeks to assess the combined anti-giardial efficacy of camphene (CP) both independently and in conjunction with metronidazole (MNZ) in the context of Giardia lamblia infection. The in vitro effectiveness of CP, both as alone treatment and in conjunction with MNZ, was assessed for its anti-giardial properties against both cysts and trophozoites of G. lamblia using a cell viability assay. Additionally, the effects of CP (100 mg/kg and 200 mg/kg), both alone and in combination with MNZ (5 mg/kg), were investigated. This assessment focused on the load and viability of cysts, serum electrolyte levels, adaptive-response cytokines (Interleukin-1 (IL-1) and IFN-γ), as well as the expression levels of apoptosis-related genes encoding the enzymes caspase-3, −8, and − 9. Both CP and the combination of CP with MNZ markedly increased the mortality of cyst and trophozoites (p < 0.001); indicating the existence of synergistic interactions when CP is co-administered with MNZ. CP alone and in the combination with MNZ significantly enhanced reactive oxygen species (ROS) production, while, downregulated the expression of the nicotinamide adenine dinucleotide oxidase (NADH), peroxiredoxin1a (PXR1a), and superoxide reductase (SOR) genes in G. lamblia trophozoites following (p < 0.001). By in vivo, the load and the viability of G. lamblia cysts excreted from the feces of infected mice, significantly modulated the serum electrolytes (p < 0.001), increased the serum levels of the cytokines IL-17 and IFN-γ (p < 0.001), and reduced the caspase-3, −8, and − 9 gene expression following a seven-day treatment with CP and CP + MNZ. Recent research has revealed hopeful effects of CP alone, particularly its synergistic interactions with MNZ against G. lamblia infection. Nevertheless, additional investigation is necessary to make clear the specific mechanisms and to evaluate its effectiveness in clinical trials, which could enhance the application of CP in the treatment and management of giardiasis.

Keywords: Giardiasis, Monoterpenes, Combination therapy, Natural product, Camphene

1. Introduction

Giardia lamblia is a protozoan parasite that inhabits the small intestine of humans. It exhibits a global prevalence of 1–25 % in various regions of the world, with approximately 280 million new cases reported annually (Adam, 2021). The Giardia transmission to humans, primarily happens via the ingestion of infectious forms found in contaminated food and water sources (Laishram et al., 2012). The clinical manifestations associated with G. lamblia infection encompass gastrointestinal complications, including diarrhea, malodorous and fatty stools, nausea or stomach upset, malabsorption, and bloating (Laishram et al., 2012). In light of the lack of a reliable and safe vaccine, the current consensus is that the most effective strategy for managing giardiasis is through other therapeutic approaches (Watkins and Eckmann, 2014). In the absence of a reliable and safe vaccine, the prevailing consensus indicates that pharmacological intervention (e.g., metronidazole and furazolidone) is the best helpful approach for the management of giardiasis. (Vivancos et al., 2018). Although these agents frequently demonstrate efficacy, they may also result in negative side effects, including gastrointestinal issues and neurological complications (Vivancos et al., 2018). Consequently, there is a pressing need to discover a pharmaceutical agent that demonstrates a lower incidence of adverse effects.

Herbs and their derivatives are increasingly recognized as significant sources of a diverse array of valuable therapeutic compounds. This acknowledgment stems from their high availability, cost-effectiveness, low toxicity, and substantial efficacy (Cheraghipour et al., 2021). Monoterpenes, characterized by their hydrocarbon structures, they constitute the most extensive category of herb metabolites and are primarily located within essential oils (Zielińska-Błajet and Feder-Kubis, 2020). Camphene (CP, C10H16), a monoterpene hydrocarbon, is present in numerous plant species, particularly those belonging to the genera Curcuma, Nigella, Salvia, and Piper (Hachlafi et al., 2023). Research in the biological sciences has revealed that CP possesses a broad spectrum of pharmacological advantages, encompassing anti-inflammatory, antioxidant, anticancer, antidiabetic, and antimicrobial effects (Sokolova et al., 2021). In recent years, a considerable body of research has investigated the potential antigiardial effects of a range of herbal substances. From the genus of Curcuma, Allium, Artemisia, and Mentha both in vitro and in vivo (Alnomasy et al., 2021). However, the clinical applicability of these phytotherapeutic agents remains unsubstantiated; this is largely attributable to the variability in research findings and concerns regarding their possible toxic effects (Alnomasy et al., 2021). Consequently, researchers are compelled to investigate and assess the efficacy of alternative herbs that may offer enhanced therapeutic benefits with reduced toxicity. Recent investigations have highlighted the development of synergistic combinations of synthetic compounds and medicinal herbs, in conjunction with existing pharmaceuticals, which have resulted in enhanced efficacy and diminished toxicity compared to the use of individual drugs (Malongane et al., 2017). The current research seeks to assess the combined anti-giardial efficacy of CP both independently and in conjunction with MNZ in the context of G. lamblia infection.

2. Materials and methods

2.1. Chemicals

CP, exhibiting a purity of 95 % (CAT, 820254), MTT powder, along with CP with a minimum purity of 98 %, TYI-S-33 medium, fetal calf serum (FCS), and bovine bile were procured from Merck, Germany.

2.2. Parasite strain

Trophozoites of the G. lamblia WB strain (ATCC 30957, Washington D.C., U.S.A.) were cultured for a duration of 72 h in standard TYI-S-33 medium, supplemented with 0.5 mg/ml of bovine bile and antibiotic (pen/strp) and maintained at a pH of 7.1. Subsequently, the cultures were transferred to an encystation medium containing 10 mg/ml of bovine bile at a pH of 7.8. Samples of the encysting cells were collected at various time intervals by chilling on ice followed by centrifugation (Kane et al., 1991). Cell viability was assessed utilizing the trypan blue exclusion method by mixing equal volumes of cells and trypan blue dye (4 g/L, Sigma-Aldrich, Germany). Subsequently, a uniform aliquot of this mixture was transferred to a Neubauer chamber for the enumeration of total cells. The calculation of viability was conducted using the formula NV/(NV + ND), where NV denotes the number of viable cells and ND indicates the number of non-viable cells. The resulting viability value was expressed as a percentage. The total count of cysts was determined microscopically using a haemocytometer (Neubauer cell-counting chamber) and subsequently adjusted to achieve an inoculum of 1 × 106 parasites.

2.3. In vitro antigiardial activity of CP on trophozoite and cysts

Initially, cysts and trophozoites (1 × 105 parasites) at the volume 0.1 mL were dispensed into a 96-well plate. Subsequently, varying concentrations of CP (0.1 mL, ranging from 10 to 200 μg/mL), MNZ (10 to 200 μg/mL), and MNZ (10 to 200 μg/mL) + CP (at IC50 concentration) were kept 24 h at 24 °C. After that, 20 μL of MTT at 500 μg/mL was added and the incubation continued for an additional four hours under the same conditions. After this period, dimethylsulfoxide was introduced, and the absorbance was rated at a wavelength of 570 nm utilizing a microplate ELISA reader (STAT-FAX-3200, USA) (Masoori et al., 2024). All in vitro experiments were performed in triplicate. The half maximal inhibitory concentration (IC50) values was finally obtained by Probit test.

2.3.1. Assessment of synergistic effects

The synergistic effects of CP and MNZ was estimated via the fractional inhibitory concentration index (FICI) utilizing as (Odds, 2003):

FICI = (IC50 in combination) / (IC50 of the drug combination) / (IC50 of the individual drug). FICI values of ≤0.5 indicate the presence of synergistic effects, while values ranging from 0.5 to 1 (0.5 < FICI <1) suggest additive effects. Additionally, values below 1 < FICI <4) are indicative of antagonistic effects.

2.3.2. Assessment of reactive oxygen species (ROS) generation

Trophozoite forms (1 × 105 cells), were initially inoculated into each well of a culture plate and incubated overnight at 37 °C. Subsequently, the trophozoites were subjected to treatment with CP for a duration of 3 h at varying concentrations: 1/4 IC50, 1/3 IC50, 1/2 IC50, and IC50. Additionally, MNZ was administered at the same concentrations, and a combination treatment of MNZ (at 1/4 IC50, 1/3 IC50, 1/2 IC50, and IC50) with CP (at IC50 concentration) was also applied. Following treatment, the parasites were detached and exposed to 10 μM DCFH-DA (2′, 7′-dichlorofluoresceindiacetate, Sigma-Aldrich, Germany) at 37 °C for 30 min. The treated cells were then washed twice with PBS to eliminate any extracellular compounds. The fluorescence intensity was subsequently quantified at an excitation/emission wavelength of 488/525 nm using a flow cytometry (BD FACSCalibur, USA) (Shakibaie et al., 2022).

2.3.3. Gene expression level of antioxidant enzymes in G. lamblia trophozoites

To analyze the influence of CP (at 1/3 IC50, ½ IC50, and IC50), MNZ (at 1/3 IC50, ½ IC50, and IC50), and MNZ (at 1/3 IC50, ½ IC50, and IC50) + CP (at IC50 concentration) on the expression of genes associated with antioxidant activity (nicotinamide adenine dinucleotide oxidase (NADH), peroxiredoxin1a (PXR1a), and superoxide reductase (SOR) in G. lamblia trophozoites (Argüello-García et al., 2015), total RNA was extracted from samples following their treatment to CP and CP + MNZ, utilizing the Cinagene kit RNX-plus, Iran. Subsequently, complementary DNA (cDNA) synthesis was conducted using the cDNA synthesis kit from Parstous Biotechnology, Iran, adhering to the company's protocol. The primers employed in this study are detailed in Table 1. The amplification of gene fragments from the cDNA was executed under the following PCR conditions: early denaturation 6 min at 95 °C, followed by thirty cycles, each comprising a duration of 30 s at 95 °C. and 60 s at 62 °C, concluding with a final expansion of 7 min at 73 °C, utilizing the StepOneTM Real-Time PCR System (Applied Biosystems, USA). The quantification of mRNA gene expression was assessed employing the 2-ΔΔCt approach, with beta-actin serving as the control housekeeping gene.

Table 1.

The sequence of the used primers for real-time PCR.

Amplicon Sequence (5′–3′)
NADHox Forward: GCACCATATGGCTTCAACGG
Reverse: CAGGCCTGTCCGTGTCATTA
PXR1a Forward: AGAAGACCATGGATGCCCGTCCCC
Reverse: ATCTCTTCTCCATGGTCTTCTTGAACGTCT
SOR Forward: CTTTGGCATCACTAAGGAGCT
Reverse: AGAGCTCCATGTAGTTCTC
Caspase-3 Forward: GAAATTGTGGAATTGATGCGTGA
Reverse: CTACAACGATCCCCTCTGAAAAA
Caspase-8 Forward: TTTCTGCCTACAGGGTCATGC
Reverse: TGTCCAACTTTCCTTCTCCCA
Caspase-9 Forward: CCTGCTTAGAGGACACAGGC
Reverse: TGGTCTGAGAACCTCTGGCT
β-actin F: GTGACGTTGACATCCGTAAAGA
R: GCCGGACTCATCGTACTCC

2.4. Efficacy of RP on G. lamblia infection in mice

2.4.1. Mice and ethics

In this investigation, a total of seventy-two NMRI mice (6 to 8 weeks) exhibiting a weight between 20 and 25 g, were employed. The subjects were maintained at 24 ± 1 °C, under a 12/12 h light/dark cycle, with humidity levels regulated between 40 % and 70 %, and were provided access to resources ad libitum. The experimental protocol was formulated and then approval was obtained from the Animal Ethics Committee at the University of Al-Qadisiyah/Iraq (IQ-AQ-20024).

2.4.2. Induction of G. lamblia infection in mice

Before the inoculation process, 48 mice underwent a four-day treatment regimen with antibiotics, specifically 0.5 mg/ml vancomycin, 1 mg/ml neomycin, and 1 mg/ml ampicillin, administered ad libitum in their drinking water to facilitate parasite colonization (Bartelt et al., 2013; Solaymani-Mohammadi and Singer, 2011). Mice were then subjected to infection with giardiasis through the oral administration of 20,000 cysts. Infection was verified through daily microscopic analysis until the presence of cysts was detected in the stool, utilizing the formalin-ether technique (Albalawi and Alanazi, 2023). Infection in all mice was verified about 3–5 days following the administration of the cysts.

2.4.3. Grouping and treatment

Animals infected with Giardia were randomly allocated into six separate groups, with each group consisting of eight mice (Masoori et al., 2024; Albalawi and Alanazi, 2023) and were subjected to oral administration for seven days and categorized as follows:

  • i.

    Normal saline

  • ii.

    MNZ 10 mg/kg

  • iii.

    CP 100 mg/kg.

  • iv.

    CP 200 mg/kg.

  • v.

    MNZ 5 mg/kg + CP 100 mg/kg.

  • vi.

    MNZ 5 mg/kg + CP 200 mg/kg.

2.4.4. Stool exam and parasite load

Fecal specimens obtained from the murine subjects were subjected to analysis utilizing the formalin-ether method in order to identify and quantify the cysts. Furthermore, the viability of the cysts was assessed using the MTT assay under conditions analogous to those of in vitro experiments (Masoori et al., 2024).

2.4.5. Collecting the blood and tissue samples

The mice were euthanized using ketamine+ xylazine (100/10 mg/kg). Following euthanasia, the blood samples were obtained directly from the cardiac area. In addition, duodenal tissue was harvested and were saved at −80 °C for later testing.

2.4.6. Evaluation of serum electrolyte levels

Initially, serum samples were obtained and collected from all mice. Subsequently, serum electrolyte levels (sodium (Na+) and potassium (K+)) were assessed utilizing Roche, Germany kits, following the provided instructions.

2.4.7. Effect of CP on the adaptive response-related factors against G. lamblia infection

To assess the serum level of IL-17 (Mouse IL-17 ELISA Kit, Abcam, USA), and IFN-γ (Mouse IFN gamma ELISA Kit) was evaluated according to the producer's instructions with the sensitivity of <6 pg/mL. The absorbance of the reactions was rated utilizing an ELISA reader (STAT-FAX-3200, USA) at of 450 nm.

2.4.8. Effects of CP on the apoptosis-related genes

In order to investigate the effects of CP, both independently and in conjunction with MNZ, on the expression of apoptosis genes encoding the enzymes caspase-3, −8, and − 9 in the intestinal tissue of G. lamblia-infected mice, total RNA was extracted from the samples after they were subjected to different concentrations of PR alone and in combination with MNZ. This extraction was performed using the Cinagene RNX-plus kit, Iran. Subsequently, cDNA synthesis was conducted on the extracted RNA using the cDNA synthesis kit from Parstous Biotechnology, Iran, adhering to the company's protocol. The primers employed in this study are detailed in Table 1 (Liu et al., 2020). The amplification of gene fragments from the cDNA was executed under the following PCR conditions: early denaturation 6 min at 95 °C, followed by thirty cycles, each comprising a duration of 30 s at 95 °C. and 60 s at 62 °C, concluding with a final expansion of 7 min at 73 °C, utilizing the StepOneTM Real-Time PCR System (Applied Biosystems, USA). The quantification of mRNA gene expression was assessed employing the 2-ΔΔCt approach, with beta-actin serving as the control housekeeping gene.

2.5. Long-term toxicity evaluation on healthy mice

Twenty-four healthy mice were subjected to three clusters, comprising eight mice each, were included: (Hi) healthy mice treated orally with normal saline for 28 days, and (Hii-Civ) healthy mice treated orally with CP 100 and 200 mg/kg/day for 28 days. Following this, serum samples were examined using commercially available assay Roche, Germany kits to measure the concentrations of renal indicators, specifically blood urea nitrogen (BUN) and creatinine (Cr), in addition to liver indicators, namely alanine aminotransferase (ALT) and aspartate aminotransferase (AST) (Mahmoudvand et al., 2019).

2.6. Statistical analysis

All in vitro experiments were repeated in triplicate. SPSS software version 24.0 employed for data analysis, with a focus on one-way ANOVA. Besides, a post hoc trial was performed to assess the comparative effects. P < 0.05 exhibits the significant variations.

3. Results

3.1. In vitro antigiardial effects on cyst and trophozoites

Fig. 1 illustrates the impacts of CP and CP + MNZ on cysts and trophozoites (p < 0.001). Both CP and the combination of CP with MNZ markedly increased in the mortality of G. lamblia cysts and trophozoites when contrasted with standard saline controls (p < 0.001). Notably, trophozoites were significantly more sensitive to CP, both as an alone treatment and CP + MNZ, in comparison to cysts (P < 0.001). The IC50 values for CP, MNZ, and the CP + MNZ on cysts were defined to be 0.65, 0.44, and 0.17 μmol/mL, respectively; while these values for trophozoites were finalized to be 0.45, 0.24, and 0.09 μmol/mL, respectively.

Fig. 1.

Fig. 1

In vitro scolicidal effects of camphene (CP, 10 to 200 μg/mL), metronidazole (MNZ, 10 to 200 μg/mL), and MNZ (10 to 200 μg/mL) + CP (at IC50 concentration) on Giardia lamblia trophozoite (A) and cysts (B) by eosin cell viability assay. Statistical analysis was performed using one-way ANOVA followed by Tukey's post-hoc test. * p < 0.05, ** p < 0.01; and *** p < 0.001 compared to control normal saline. The data are expressed as Mean ± Standard Deviation (N = 3). The 50 % inhibitory concentration (IC50) Value for CP and MNZ on cysts were defined to be 0.65 and 0.44 μmol/mL, respectively; while these values for trophozoites were finalized to be 0.45 and 0.24 μmol/mL, respectively.

3.2. Synergic effects PR and GCT

The computed FICI for CP and MNZ against cysts were 0.33 and 0.39, respectively; these numbers for CP and MNZ against trophozoites were 0.27 and 0.39, respectively; indicating the existence of synergistic interactions when CP is co-administered with MNZ.

3.3. Impact on ROS generation

The findings of our research indicated that CP and CP + MNZ, evidently increased fluorescent intensity, with the resultant production of ROS exhibiting a dose-dependent relationship. (p < 0.001) (Fig. 2). The maximum fluorescent intensity recorded was 20.7, 31.2, 40.2, and 51.3 arbitrary units (a.u.) following the exposure of infected macrophages to the CP + MNZ treatment at ¼ IC50, 1/3 IC50, ½ IC50, and IC50, respectively.

Fig. 2.

Fig. 2

The effects of camphene (CP), metronidazole (MNZ), and MNZ (at ¼ IC50, 1/3 IC50, ½ IC50, and IC50) + CP (at IC50 concentration) on the generation of reactive oxygen species (ROS) in the Giardia lamblia trophozoite using the dichlorodihydrofluorescein diacetate (DCFH-DA) assay via measuring the fluorescence emitted at 488–525 nm. Statistical analysis was performed using one-way ANOVA followed by Tukey's post-hoc test. The data are expressed as Mean ± Standard Deviation (N = 3). ** p < 0.01; and *** p < 0.001 compared to control normal saline by post hoc analysis. # p < 0.05; ## p < 0.01 significant difference by post hoc analysis. IC50: the 50 % inhibitory concentration.

3.4. Reduced expression of genes associated with antioxidant enzymes in trophozoites

Fig. 3 demonstrates a notable downregulation of the NADHox, PXR1a, and SOR genes in G. lamblia trophozoites subsequent treatment with CP, particularly when administered in combination with MNZ. Specifically, the co-treatment of CP and MNZ at concentrations of CP 1/3 IC50, CP 1/2 IC50, and CP IC50 resulted in the most pronounced reductions in expression levels for the NADHox (2.11-, 1.53-, and 1.09-fold changes), PXR1a (2.48-, 1.73-, and 1.09-fold changes), and SOR (1.96-, 1.35-, and 1.04-fold changes) genes, with statistical significance confirmed at p < 0.001.

Fig. 3.

Fig. 3

The effects of camphene (CP) and MNZ (at 1/3 IC50, ½ IC50, and IC50) + CP (at IC50 concentration) on the expression of genes associated with antioxidant activity (NADHoxidase (NADHox), peroxiredoxin1a (PXR1a), and superoxide reductase (SOR) in G. lamblia trophozoites. Statistical analysis was performed using one-way ANOVA followed by Tukey's post-hoc test. The data are expressed as Mean ± Standard Deviation (N = 3). * p < 0.01; and *** p < 0.001 compared to control normal saline by post hoc analysis. ### p < 0.001 significant difference by post hoc analysis. IC50: the 50 % inhibitory concentration.

3.5. In vivo effects of CP on giardiasis in mice

As indicated in Fig. 4, the mean number and the viability of cysts defaecated from the feces of mice subsequent a seven-day therapy with CP at 100 and 200 mg/kg were markedly reduced (p < 0.001). Notably, no G. lamblia cysts were detected in mice treated with CP in conjunction with MNZ (5 mg/kg) over the same duration. Correspondingly, the cyst viability was condensed by 5.75, 28.25, 11.54, 0.0, and 0.0 % following the treatment with MNZ 10 mg/kg, CP 100 mg/kg, CP 200 mg/kg, CP 100 mg/kg + MNZ 5 mg/kg, and CP 200 mg/kg + MNZ 5 mg/kg, respectively (p < 0.001). Furthermore, subsequent analyses conducted after the fact indicated that CP combined with MNZ demonstrated significantly greater efficacy compared to MNZ alone (p < 0.001). The IC50 value for CP and MNZ on cysts were defined to be 474.8 and 31.17 μmol/kg, respectively.

Fig. 4.

Fig. 4

The in vivo effects of camphene (CP) and metronidazole (MNZ) on the number (A) and viability (B) of G. lamblia cysts excreted from the feces of infected mice following a seven-day treatment. Statistical significance is denoted by **p < 0.01 and ***p < 0.001 when compared to the control group (normal saline) using post hoc analysis. + p < 0.05 in relation to the MNZ treatment by post hoc analysis. The 50 % inhibitory concentration (IC50) value for CP and MNZ on cysts were defined to be 474.8 and 31.17 μmol/kg, respectively.

3.6. Regulating the serum concentration of electrolytes

The biochemical assessment demonstrated a notable decrease in Na and K concentrations in the tested mice (p < 0.001). In contrast, CP, especially when combined with MNZ 5 mg/kg, pointedly improved the serum levels of Na and K in mice (p < 0.001) compared to those receiving normal saline (Fig. 5). Additionally, post hoc analysis revealed that the CP 200 mg/kg + MNZ at 5 mg/kg (Na:159.1 mmol/L, K:13.6 mmol/L) was more effective in modulating serum electrolyte levels than MNZ (Na:132.3 mmol/L, K:10.9 mmol/L) administered alone (p < 0.05).

Fig. 5.

Fig. 5

In vivo effects of camphene (CP) and metronidazole (MNZ) on the serum level of sodium (A) and potassium (P) in the Giardia-infected mice. The data are expressed as Mean ± Standard Deviation. Analyzed by one-way ANOVA followed by Tukey's post-hoc test (n = 8). * p < 0.05; ** p < 0.01 and *** p < 0.001 compared to control normal saline by post hoc analysis. # p < 0.05; ## p < 0.01 significant difference by post hoc analysis.

3.7. Elevation of the serum level of adaptive response-related cytokines

Fig. 6 illustrates a notable strengthen in serum levels of IL-17 and IFN-γ in Giardia-infected mice after administration of CP, remarkably once integrated with MNZ (p < 0.001). Notably, the co-administration of CP and MNZ at both doses tested resulted in the most considerable raise (p < 0.001) in the serum level for the IL-17 (226.5 pg/mL and 301.9 pg/mL) and IFN-γ (146.5 pg/mL and 212.3 pg/mL) in comparison with MNZ (171.2 pg/mL and 93.1 pg/mL) alone by post hoc analysis.

Fig. 6.

Fig. 6

In vivo effects of camphene (CP) and metronidazole (MNZ) on the serum level of IL-17 and IFN-γ in the Giardia-infected mice. The data are expressed as Mean ± Standard Deviation. Analyzed by one-way ANOVA followed by Tukey's post-hoc test (n = 8). * p < 0.05; ** p < 0.01 and *** p < 0.001 compared to control normal saline by post hoc analysis. ## p < 0.01; ### p < 0.001 significant difference by post hoc analysis.

3.8. Downregulation of the expression of the apoptosis genes

The findings displayed a significant elevation in the expression level of apoptosis genes, caspase-3, −8, and − 9, in Giardia-infected mice (p < 0.001). Treatment with CP at both doses tested led to a dose-dependent drop in the expression of caspase-3, −8, and − 9 genes (Fig. 7). Notably, the most pronounced decrease in apoptosis-related genes was recorded following the oral administration of CP at a dosage of 100 (1.21-, 1.19-, and 1.15-fold changes) and 200 (1.13-, 1.06, and 1.04-fold changes) mg/kg along with MNZ (p < 0.05); whereas, showed substantial change with the MNZ, and CP at 100 and 200 mg/kg by post hoc analysis.

Fig. 7.

Fig. 7

In vivo effects of camphene (CP) and metronidazole (MNZ) on the expression level of apoptosis-related genes encoding the enzymes caspase-3, −8, and − 9 in the Giardia-infected mice. The data are expressed as Mean ± Standard Deviation. Analyzed by one-way ANOVA followed by Tukey's post-hoc test (n = 8). *** p < 0.001 compared to control normal saline by post hoc analysis. ## p < 0.01; ### p < 0.001 significant difference by post hoc analysis.

3.9. Long-term toxicity evaluation on healthy mice

The biochemical analyses indicated that, despite the presence of discernible fluctuations in the serum concentrations of biomarkers associated with liver and kidney function after the administration of CP 100 and 200 mg/kg over 28 days, post hoc analysis revealed that these modifications did not achieve statistical significance in comparison to mice that were administered normal saline. (Fig. 8).

Fig. 8.

Fig. 8

Toxic effects of camphene (CP 100 and 200 mg/kg) treatment on the serum level of liver enzymes (A) aspartate aminotransferase (ALT), alanine transferase (AST), alkaline transferase (ALP), as well as kidney functional factors (blood urea nitrogen (BUN) and creatinine (Cr) in the healthy mice. Data are presented as Mean ± SEM. Analyzed by one-way ANOVA followed by Tukey's post-hoc test (n = 8).

4. Discussion

At present, bioactive compounds and plant extracts obtained from natural sources are acknowledged for their significant potential as candidates for antiparasitic pharmacotherapy. Furthermore, phytomedicines are gaining recognition as economical and safe alternatives to traditional treatment modalities (Kim et al., 2016). Although synthetic antigiardial medications frequently exhibit efficacy, they may also result in negative side effects. Furthermore, issues related to drug resistance and the potential for mutagenic effects have been highlighted (Vivancos et al., 2018). Therefore, there is an urgent necessity to identify a pharmaceutical agent that presents a reduced likelihood of adverse effects. Recent investigations have emphasized the development of synergistic combinations of synthetic compounds and medicinal herbs, in conjunction with existing pharmaceuticals, which have resulted in enhanced efficacy and diminished toxicity compared to the use of individual drugs (Malongane et al., 2017). Here, we assessed the combined anti-giardial efficacy of CP both independently and in conjunction with MNZ in the context of G. lamblia infection.

Both CP and the combination of CP with MNZ markedly increased in the mortality of G. lamblia cysts and trophozoites when contrasted with standard saline controls. In addition, the computed FICI values of lower than 0.5 for CP and MNZ against cysts and trophozoites; indicating the existence of synergistic interactions when CP is co-administered with MNZ. By in vivo, the mean number and the viability of cysts defaecated from the feces of mice subsequent a seven-day therapy with CP at 100 and 200 mg/kg were markedly reduced. Notably, no G. lamblia cysts were detected in mice treated with CP + MNZ over the same duration. The results demonstrated a total recovery of the infection in the Giardia-infected mice. Numerous surveys have documented the antimicrobial possessions of CP against a diverse array of bacterial (Staphylococcus spp., Propionibacterium spp., Bacillus spp., and Shigella spp), fungal (Aspergillus spp., Candida spp., Trichophyton spp., and Microsporum spp.), and viral pathogenic strains (SARS-CoV-2, Herpes simplex virus, and Bovine parainfluenza-3) (Hachlafi et al., 2023). With regard to the antiparasitic properties of CP, existing literature has reported evidence of the antiparasitic effects of essential oils that are high in CP, which are derived from various herbal sources such as Rhanterium epapposum, Piper callosum, Curcuma longa, and Nigella sativa, against specific pathogenic parasites. However, there is a notable scarcity of studies that focus exclusively on the antiparasitic effects of CP itself (Hachlafi et al., 2023). Bharate et al. (Bharate and Singh, 2011) displayed that CP reduced the growth rate of Leishmania donovani parasites with the IC50 values of 4.238 μM. Several studies have demonstrated that camphene possesses trypanocidal activity against Trypanosoma cruzi and Trypanosoma brucei brucei TC221, with IC50 of 48.0 and 80.66 μg/mL, respectively (Mulyaningsih et al., 2010; Setzer et al., 2006). Although the precise antimicrobial mechanisms of CP remain incompletely understood; however, researches have concentrated that these compounds possess antimicrobial characteristics by disrupting the lipid composition of microbial plasma membranes (Marchese et al., 2017). This disruption leads to variations in membrane permeability lead to the efflux of intracellular constituents and alterations in pH and ATP concentrations. Additionally, these compounds affect the structural integrity of lipids within bacterial membranes, interfere with DNA, and disrupt cellular motility (Setzer et al., 2006; Marchese et al., 2017). They also promote the generation of ROS, induce apoptotic processes, and influence electron localization (Marchese et al., 2017; Trombetta et al., 2005).

ROS-induced oxidative stress is recognized as a critical factor in host defense mechanisms and inflammatory responses, which are vital for the management and elimination of invading pathogens, including viruses, bacteria, and parasites (Roma et al., 2016). Furthermore, it has been demonstrated that excessive ROS production can induce cell apoptosis via a mitochondria-mediated apoptotic pathway (Pawłowska et al., 2023). Prior research has indicated that Giardia, despite the absence of several traditional ROS detoxification enzymes, including glutathione reductase, superoxide dismutase, and catalase (Brown et al., 1996), is equipped with antioxidant enzymes such as NADHox, PXR1a, and SOR that facilitate the detoxification of ROS generated during episodes of oxidative stress (Argüello-García et al., 2015). Here, we found that CP alone and in the combination with MNZ significantly enhanced fluorescent intensity, with subsequent ROS production being dose-dependent; conversely, a notable downregulation of the NADHox, PXR1a, and SOR genes in G. lamblia trophozoites subsequent treatment with CP, particularly when administered in combination with MNZ was observed. CP administration has been shown to effectively mitigate the production of ROS induced by hydrogen peroxide (H2O2) in zebrafish larvae (Timothy and Kumar, 2024). Furthermore, research indicates that monoterpenoid compounds can compromise membrane integrity, resulting in enhanced permeability to protons and ions (Sikkema et al., 1995). The results of this study align with previously documented antimicrobial mechanisms of action associated with monoterpene compounds. As a result, the initiation of oxidative stress, coupled with the inhibition of antioxidant enzyme activity, may represent significant mechanisms through which CP exerts its inhibitory and regulatory effects on giardiasis.

Todays, it has been proven that giardiasis can lead to diarrhea by impairing the absorption of glucose, potassium, sodium, and water, in addition to diminishing disaccharidase activity (Khlaf, 2022). This condition may be associated with a diminished absorptive surface area of epithelial cells, which in turn may lead to the development of diarrhea (Khlaf, 2022). The present research showed that CP, especially when combined with MNZ 5 mg/kg, pointedly improved the serum levels of Na and K in mice (p < 0.001). The results suggest that CP mainly combined with MNZ may possess the capability to modulate the signs of giardiasis by affecting serum electrolyte levels in infected murine models.

The immune reaction triggered by giardiasis is characterized by a complex interplay between inflammatory and anti-inflammatory mechanisms (Tilahun et al., 2022). The acquired immune reaction to giardisis involves both cellular and humoral components (Sun et al., 2023). Th17 cells facilitate the recruitment of neutrophils and induce epithelial cells of intestine to synthesize antimicrobial peptides via the secretion of IL-17 (Li et al., 2018). This cytokine increases the concentration of antimicrobial peptides within the mucosal environment and facilitates the recruitment of neutrophils, thereby contributing to infection control and the augmentation of IgA antibody responses (Li et al., 2018; Dann et al., 2015). Concurrently, Th1 cells release IFN-γ, which serves to activate macrophages (Dann et al., 2015). The molecular findings indicated a notable raise in the serum levels IL-17 and IFN-γ in Giardia-infected mice after administration of CP, especially when combined with MNZ.

Giardia has the capability to compromise the integrity of intestinal epithelial cells by inducing enterocyte apoptosis (Dann et al., 2015; Dreesen et al., 2012). This process involves the activation of caspases-3, −8, and − 9, as well as the Bcl-2-associated X protein (BAX), simultaneously downregulating the anti-apoptotic genes (Roxstrom-Lindquist et al., 2005; Girola et al., 2015). Here, we demonstrated that treatment with CP at both doses tested led to a dose-dependent drop in the expression of caspase-3, −8, and − 9 genes. Therefore, it is reasonable to propose that the utilization of CP may successfully inhibit Giardia-induced apoptosis, which would aid to inhibit the disruption of the cohesion of intestinal epithelial cells.

Chronic and sub-acute toxicity pertains to significant alterations in health that manifest over an extended period due to exposure to a specific pharmaceutical agent. This classification is utilized to characterize substances that may induce toxic effects over time, even at minimal exposure levels (Fielden and Kolaja, 2008). The evaluation of the toxicological characteristics of novel pharmaceutical therapies constitutes an essential and standardized process that must be undertaken prior to their market introduction. Our findings indicate that despite the presence of discernible fluctuations in the serum concentrations of biomarkers associated with liver and kidney function after the administration of CP 100 and 200 mg/kg over 28 days, post hoc analysis revealed that these modifications did not achieve statistical significance. The recent research has highlighted the potential anti-giardial and synergistic effects of CP when used in conjunction with MNZ. However, it is essential to further explore the pharmacodynamic efficacy of CP on diverse therapeutic goals. Moreover, further research is necessary to assess the absorption and bioavailability, and metabolic pathways of this compound. To validate its therapeutic application, it is strongly recommended that clinical studies be conducted, focusing on assessments of toxicity and therapeutic efficacy to substantiate the legitimacy of this molecule.

5. Conclusion

Recent research has revealed promising in vitro effects of CP alone, particularly its synergistic interactions with MNZ against G. lamblia. Furthermore, the study highlighted the potential of CP as a standalone treatment, emphasizing its synergistic effects in the management of giardiasis in a murine model. This efficacy is attributed to its anti-apoptotic properties, immunomodulatory effects, and its ability to modulate serum electrolytes, all while exhibiting minimal long-term toxicity to the vital organs of the mice. Nevertheless, additional investigation is necessary to make clear the specific mechanisms and to evaluate its effectiveness in clinical trials, which could enhance the application of CP in the treatment and management of giardiasis.

CRediT authorship contribution statement

Marwa Sami Alwan: Writing – review & editing, Validation, Methodology, Investigation. Hussam Saeed Al-Aredhi: Validation, Methodology, Investigation, Formal analysis. Ikhlas Abbas Marhoon: Writing – original draft, Supervision, Conceptualization.

Funding

None.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgments

The study was done in Microbiological laboratory of biology Department, education college, Al-Qadisiyah University.

References

  1. Adam R.D. Giardia duodenalis: biology and pathogenesis. Clin. Microbiol. Rev. 2021 Dec 15;34(4) doi: 10.1128/CMR.00024-19. e00024–19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Albalawi A.E., Alanazi A.D. Chemical composition, in vitro, and in vivo antiparasitic effects of Curcuma zedoaria rhizome essential oil against Giardia lamblia. Pharmacogn. Mag. 2023;19:418–426. doi: 10.1177/09731296231166055. [DOI] [Google Scholar]
  3. Alnomasy S., Al-Awsi G.R., Raziani Y., Albalawi A.E., Alanazi A.D., Niazi M., Mahmoudvand H. Systematic review on medicinal plants used for the treatment of Giardia infection. Saudi J. Biol. Sci. 2021 Sep 1;28(9):5391–5402. doi: 10.1016/j.sjbs.2021.05.069. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Argüello-García R., Cruz-Soto M., González-Trejo R., Paz-Maldonado L.M., Bazán-Tejeda M.L., Mendoza-Hernández G., Ortega-Pierres M.G. An antioxidant response is involved in resistance of Giardia duodenalis to albendazole. Front. Microbiol. 2015 Apr 10;6 doi: 10.3389/fmicb.2015.00286. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bartelt L.A., Roche J., Kolling G., Bolick D., Noronha F., Naylor C., et al. Persistent g. lamblia impairs growth in a murine malnutrition model. J. Clin. Invest. 2013;123:2672–2684. doi: 10.1172/JCI67294. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bharate S.B., Singh I.P. Quantitative structure–activity relationship study of phloroglucinol-terpene adducts as anti-leishmanial agents. Bioorg. Med. Chem. Lett. 2011;21(14):4310–4315. doi: 10.1016/j.bmcl.2011.05.053. [DOI] [PubMed] [Google Scholar]
  7. Brown D.M., Upcroft J.A., Upcroft P. A H2O-producing NADH oxidase from the protozoan parasite Giardia duodenalis. Eur. J. Biochem. 1996 Oct;241(1):155–161. doi: 10.1111/j.1432-1033.1996.0155t.x. [DOI] [PubMed] [Google Scholar]
  8. Cheraghipour K., Masoori L., Ezzatpour B., et al. The experimental role of medicinal plants in treatment of toxoplasma gondii infection: a systematic review. Acta Parasitol. 2021;66:303–328. doi: 10.1007/s11686-020-00300-4. [DOI] [PubMed] [Google Scholar]
  9. Dann S.M., Manthey C.F., Le C., Miyamoto Y., Gima L., Abrahim A., Cao A.T., Hanson E.M., Kolls J.K., Raz E., et al. IL-17A. promotes protective IgA responses and expression of other potential effectors against the lumen-dwelling enteric parasite Giardia. Exp. Parasitol. 2015;156:68–78. doi: 10.1016/j.exppara.2015.06.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Dreesen L., Rinaldi M., Chiers K., Li R., Geurden T., Van den Broeck W., Goddeeris B., Vercruysse J., Claerebout E., Geldhof P. Microarray analysis of the intestinal host response in Giardia duodenalis assemblage E infected calves. PLoS One. 2012;7 doi: 10.1371/journal.pone.0040985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Fielden M.R., Kolaja K.L. The role of early in vivo toxicity testing in drug discovery toxicology. Expert Opin. Drug Saf. 2008;7(2):107–110. doi: 10.1517/14740338.7.2.107. [DOI] [PubMed] [Google Scholar]
  12. Girola N., Figueiredo C.R., Farias C.F., Azevedo R.A., Ferreira A.K., Teixeira S.F., Capello T.M., Martins E.G., Matsuo A.L., Travassos L.R., Lago J.H. Camphene isolated from essential oil of Piper cernuum (Piperaceae) induces intrinsic apoptosis in melanoma cells and displays antitumor activity in vivo. Biochem. Biophys. Res. Commun. 2015 Nov 27;467(4):928–934. doi: 10.1016/j.bbrc.2015.10.041. Epub 2015 Oct 16. PMID: 26471302. [DOI] [PubMed] [Google Scholar]
  13. Hachlafi N.E., Aanniz T., Menyiy N.E., Baaboua A.E., Omari N.E., Balahbib A., Shariati M.A., Zengin G., Fikri-Benbrahim K., Bouyahya A. In vitro and in vivo biological investigations of camphene and its mechanism insights: a review. Food Rev. Int. 2023 May 19;39(4):1799–1826. [Google Scholar]
  14. Kane A.V., Ward H.D., Keusch G.T., Pereira M.E.A. In vitro encystation of Giardia lamblia: large-scale production of in vitro cysts and strain and clone differences in encystation efficiency. J. Parasitol. 1991;77:974–981. [PubMed] [Google Scholar] [PubMed] [Google Scholar]
  15. Khlaf W.M.A. The effect of infection with the parasite Giardia lamblia on some physiological, hormonal and biochemical variables. J. Pharm. Negative Results. 2022;6:2139–2144. [Google Scholar]
  16. Kim K.J., Liu X., Komabayashi T., Jeong S.I., Selli S. Natural products for infectious diseases. Evid. Based Complement. Alternat. Med. 2016;2016 doi: 10.1155/2016/9459047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Laishram S., Kang G., Ajjampur S.S. Giardiasis: a review on assemblage distribution and epidemiology in India. Indian J. Gastroenterol. 2012 Jan;31(1):3–12. doi: 10.1007/s12664-012-0161-9. [DOI] [PubMed] [Google Scholar]
  18. Li J., Casanova J.-L., Puel A. Mucocutaneous IL-17 immunity in mice and humans: host defense vs. excessive inflammation. Mucosal Immunol. 2018;11:581–589. doi: 10.1038/mi.2017.97. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Liu L., Wei Z., Fang R., Li X., Li W. Giardia duodenalis induces extrinsic pathway of apoptosis in intestinal epithelial cells through activation of TNFR1 and K63 de-ubiquitination of RIP1 in vitro. Microb. Pathog. 2020;149 doi: 10.1016/j.micpath.2020.104315. [DOI] [PubMed] [Google Scholar]
  20. Mahmoudvand H., Pakravanan M., Aflatoonian M.R., Khalaf A.K., Niazi M., Mirbadie S.R., Tavakoli Kareshk A., Khatami M. Efficacy and safety of Curcuma longa essential oil to inactivate hydatid cyst protoscoleces. BMC Complement. Altern. Med. 2019;19:187–195. doi: 10.1186/s12906-019-2527-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Malongane F., McGAW L.J., Mudau F.N. The synergistic potential of various teas, herbs and therapeutic drugs in health improvement: a review. J. Sci. Food Agric. 2017 Nov;97(14):4679–4689. doi: 10.1002/jsfa.8472. [DOI] [PubMed] [Google Scholar]
  22. Marchese A., Arciola C.R., Barbieri R., Silva A.S., Nabavi S.F., Tsetegho Sokeng A.J., Izadi M., Jafari N.J., Suntar I., Daglia M., Nabavi S.M. Update on monoterpenes as antimicrobial agents: a particular focus on p-cymene. Materials. 2017 Aug 15;10(8):947. doi: 10.3390/ma10080947. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Masoori L., Khalaf A.K., Ezzatkhah F., Balaña-Fouce R., Mahmoudvand H. Promising effects of 1, 8 cineole to control Giardia lamblia infection: targeting the inflammation, oxidative stress, and infectivity. Acta Trop. 2024 Jul 1;255 doi: 10.1016/j.actatropica.2024.107201. [DOI] [PubMed] [Google Scholar]
  24. Mulyaningsih S., Youns M., El-Readi M.Z., Ashour M.L., Nibret E., Sporer F., Herrmann F., Reichling J., Wink M. Biological activity of the essential oil of Kadsura longipedunculata (Schisandraceae) and its major components. J. Pharm. Pharmacol. 2010 Aug;62(8):1037–1044. doi: 10.1111/j.2042-7158.2010.01119.x. [DOI] [PubMed] [Google Scholar]
  25. Odds F.C. Synergy, antagonism, and what the chequerboard puts between them. J. Antimicrob. Chemother. 2003 Jul 1;52(1):1–6. doi: 10.1093/jac/dkg301. [DOI] [PubMed] [Google Scholar]
  26. Pawłowska M., Mila-Kierzenkowska C., Szczegielniak J., Woźniak A. Oxidative stress in parasitic diseases—reactive oxygen species as mediators of interactions between the host and the parasites. Antioxidants. 2023 Dec 23;13(1):38. doi: 10.3390/antiox13010038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Roma E.H., Macedo J.P., Goes G.R., Gonçalves J.L., Castro W.D., Cisalpino D., Vieira L.Q. Impact of reactive oxygen species (ROS) on the control of parasite loads and inflammation in Leishmania amazonensis infection. Parasit. Vectors. 2016 Dec;9:1–3. doi: 10.1186/s13071-016-1472-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Roxstrom-Lindquist K., Ringqvist E., Palm D., Svard S. Giardia lamblia-induced changes in gene expression in differentiated Caco-2 human intestinal epithelial cells. Infect. Immun. 2005;73:8204–8208. doi: 10.1128/IAI.73.12.8204-8208.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Setzer W.N., Takaku S., Stokes S.L., Penton A.F. Inhibition of cruzain by Ocotea leaf essential oils from Monteverde. Costa Rica. Pharmacologyonline. 2006;3:785–793. [Google Scholar]
  30. Shakibaie M., Khalaf A.K., Rashidipour M., Mahmoudvand H. Effects of green synthesized zinc nanoparticles alone and along with albendazole against hydatid cyst protoscoleces. Ann. Med. Surg. 2022 Jun 1:78. doi: 10.1016/j.amsu.2022.103746. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Sikkema J., de Bont J.A., Poolman B. Mechanisms of membrane toxicity of hydrocarbons. Microbiol. Rev. 1995 Jun;59(2):201–222. doi: 10.1128/mr.59.2.201-222.1995. PMID: 7603409; PMCID: PMC239360. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Sokolova A.S., Putilova V.P., Yarovaya O.I., Zybkina A.V., Mordvinova E.D., Zaykovskaya A.V., Shcherbakov D.N., Orshanskaya I.R., Sinegubova E.O., Esaulkova I.L., Borisevich S.S. Synthesis and antiviral activity of camphene derivatives against different types of viruses. Molecules. 2021 Apr 13;26(8):2235. doi: 10.3390/molecules26082235. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Solaymani-Mohammadi S., Singer S.M. Host immunity and pathogen strain contribute to intestinal disaccharidase impairment following gut infection. J. Immunol. 2011;187(7):3769–3775. doi: 10.4049/jimmunol.1100606. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Sun L., Wang L., Moore B.B., Zhang S., Xiao P., Decker A.M., Wang H.-L. IL-17: balancing protective immunity and pathogenesis. J Immunol Res. 2023;2023:3360310. doi: 10.1155/2023/3360310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Tilahun M., Gedefie A., Belayhun C., Sahle Z., Abera A. Helicobacter pylori Pathogenicity Islands and Giardia lamblia cysteine proteases in role of coinfection and pathogenesis. Infect. Drug Resist. 2022;15:21–34. doi: 10.2147/IDR.S346705. (CrossRef) [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Timothy R., Kumar I.P. E3S Web of Conferences. vol. 477. EDP Sciences; 2024. Comparative estimation of ROS levels using DCFDA in zebrafish larvae model on the treatment of camphene and doxorubicin for antioxidant property; p. 00050. [Google Scholar]
  37. Trombetta D., Castelli F., Sarpietro M.G., Venuti V., Cristani M., Daniele C., Saija A., Mazzanti G., Bisignano G. Mechanisms of antibacterial action of three monoterpenes. Antimicrob. Agents Chemother. 2005 Jun;49(6):2474–2478. doi: 10.1128/AAC.49.6.2474-2478.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Vivancos V., González-Alvarez I., Bermejo M., Gonzalez-Alvarez M. Giardiasis: characteristics, pathogenesis and new insights about treatment. Curr. Top. Med. Chem. 2018 Jun 1;18(15):1287–1303. doi: 10.2174/1568026618666181002095314. [DOI] [PubMed] [Google Scholar]
  39. Watkins R.R., Eckmann L. Treatment of giardiasis: current status and future directions. Curr. Infect. Dis. Rep. 2014 Feb;16:1–8. doi: 10.1007/s11908-014-0396-y. [DOI] [PubMed] [Google Scholar]
  40. Zielińska-Błajet M., Feder-Kubis J. Monoterpenes and their derivatives—recent development in biological and medical applications. Int. J. Mol. Sci. 2020 Sep 25;21(19):7078. doi: 10.3390/ijms21197078. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Parasite Epidemiology and Control are provided here courtesy of Elsevier

RESOURCES