Abstract
The gut serves not only as digestive but also as critical immune organ, playing a vital role in maintaining the growth performance and immune function of poultry. Atractylodes macrocephala Koidz (AMK) is known for its antioxidant, anti-inflammatory and immunomodulatory properties. This study utilized a Cyclophosphamide (CTX)-induced gut injury model to explore the effects of Polysaccharide of Atractylodes macrocephala Koidz (PAMK) and the Jiawei Si-jun-zi Decoction (JSD) on alleviating gut injury and modulating immune function. The experimental results demonstrated that CTX significantly reduced the average daily gain (ADG) and antioxidant capacity of broiler chicks, disrupted intestinal barrier function, and induced gut microbiota dysbiosis. However, supplementation with PAMK and JSD significantly improved ADG, enhanced antioxidant enzyme activity, alleviated oxidative stress, and upregulated the expression of barrier-related genes such as ZO-1 and Occludin. Additionally, PAMK and JSD significantly increased anti-inflammatory cytokines, including IL-10 and TGF-β, improved gut microbiota diversity, enriched beneficial microbial populations, and restored the microbiota balance disrupted by CTX. These findings suggest that PAMK and JSD effectively mitigate CTX-induced intestinal injury by regulating the antioxidant system, strengthening intestinal barrier function, and restoring gut microbiota structure. This study provides a scientific basis for the development of safe and effective feed additives and proposes a novel strategy to reduce antibiotic use in poultry farming.
Keywords: Polysaccharide of Atractylodes macrocephala Koidz, Jiawei Si-jun-zi Decoction, Cyclophosphamide, Immunomodulation, Gut microbiota
Introduction
The avian gut functions not only as a digestive organ but also as the largest immune organ in the body. The gut immune system comprises the intestinal mucosa, epithelial cells, commensal microorganisms, and immune cells, with microorganisms playing a pivotal role in initiating immune responses. Intestinal microbiota actively participates in the digestive processes and immune responses of poultry. Maintaining the balance of gut microbiota is crucial for promoting the development of the immune system, regulating immune responses, and preventing immune-related diseases (Ye et al., 2024). The gut microbiome supports intestinal homeostasis and suppresses inflammation by modulating the development and function of the host immune system (Tomasello and Bedoui, 2013; Shi et al., 2017).
In modern animal husbandry, maintaining animal health and production efficiency is critical for sustainable development. This necessity has driven the search for safer and more effective alternatives to enhance animal health and immune functions (Roth et al., 2019). CTX, a chemotherapeutic alkylating agent, induces a variety of side effects, including antitumor, immunosuppressive, and anti-inflammatory effects. Its primary mechanism involves reacting with guanine and cytosine in DNA to form highly reactive aziridinium ions, which subsequently create interstrand and intrastrand crosslinks, leading to immunosuppression (Ahlmann and Hempel, 2016). Studies have shown that CTX can induce immunosuppression models in mice, significantly reducing the number of immune cells and the levels of related cytokines, thereby suppressing immune function (You et al., 2023). Researchers found that CTX can induce intestinal inflammation, disrupt the gut microbiota, and suppress the host immune system (Khan et al., 2022). Another study found that CTX induces structural damage to the intestinal mucosa, impairs intestinal barrier function, and disrupts the balance of the gut microbiota (Cui et al., 2022). Furthermore, CTX has been reported to decrease immunoglobulin levels, impair immune responses, and induce oxidative stress while reducing antioxidant enzyme activity (Han et al., 2022). CTX inhibits the growth of broiler chickens and reduces feed efficiency, which is associated with oxidative stress (Shan and Miao, 2022). Additionally, it suppresses the development of immune organs, decreases immune cell activity, and disrupts the balance of intestinal microbiota, resulting in negative impacts on the health of broiler chickens (Xu et al., 2025). Developing safe and low-side-effect immunomodulators to alleviate the adverse effects caused by cyclophosphamide has become a pressing issue that requires urgent attention.
Traditional Chinese medicine (TCM), as a conventional therapeutic approach, has gained increasing attention due to its natural origin, low toxicity, and minimal residues. TCM can maintain intestinal homeostasis by regulating gut microbiota balance, thereby supporting physiological functions of the gut. Additionally, the effects of TCM on gut microbiota are closely related to disease prevention and treatment (Che et al., 2022). Studies have demonstrated that herbal components exhibit antioxidative, anti-inflammatory, and antibacterial properties, which can promote the abundance of probiotics in the gut, enhance immunity, and inhibit the growth of pathogenic bacteria (Wang et al., 2024). Another study reported that polysaccharide components extracted from plants can alleviate the reduction in immune organ indices induced by CTX, preserve intestinal morphology, and modulate the gut microbiota (Chen et al., 2021). Moreover, compound small peptides of Chinese medicine have been shown to alleviate CTX-induced immunosuppression by modulating Th17/Treg balance and jejunal microbiota, highlighting their potential as therapeutic agents (Cui et al., 2023). AMK is an herbaceous plant rich in bioactive components, particularly polysaccharides and lactones, which have been widely reported to possess antioxidative, anti-inflammatory, and immunomodulatory properties (Li et al., 2014; Liu et al., 2022). Previous research has indicated that PAMK can mitigate DSS-induced intestinal immune suppression by inhibiting inflammatory responses, enhancing intestinal barrier function, and modulating gut microbiota. Thus, PAMK has emerged as a promising candidate for the treatment of gut immune-related diseases as a novel intestinal barrier regulator (Kai et al., 2022).
Si-Jun-Zi Decoction (SJZD), originating from the Song Dynasty's Taiping Huimin Hejiju Fang, is composed of Atractylodes macrocephala, Panax ginseng (commonly substituted with Codonopsis pilosula), Poria cocos, and Glycyrrhiza uralensis. As a tonic formula, it is primarily used to replenish and invigorate qi and strengthen the spleen. Jiawei Si-jun-zi Decoction (JSD) is a modified version of SJZD, incorporating additional medicinal ingredients to expand its therapeutic range. Beyond tonifying the spleen and replenishing qi, JSD addresses specific symptoms more effectively. Previous studies have shown that SJZD can improve intestinal mucosa in mice and upregulate the mRNA expression of intestinal tight junction proteins such as ZO-1 and Occludin (Qu et al., 2020). Moreover, previous studies have indicated that SJZD can regulate immune function (Wang et al., 2020). AMK, one of its key components, has been shown to possess anti-inflammatory, anticancer, and immunomodulatory properties. The JSD also exhibits anti-inflammatory effects, immune-enhancing capabilities, and beneficial effects on intestinal health.
This study aims to explore the effects of PAMK and JSD on CTX-treated chicks. It aims to evaluate the regulatory effects of AMK additives on growth performance, antioxidative capacity, immune function, and gut microbiota composition in chicks, providing scientific evidence for the development of novel, safe feed additives.
Materials and methods
Reagents
PAMK was purchased from Yangling Ciyuan Biotechnology Co., Ltd., with concentrations of 30 % and 95 %. JSD was purchased from Guangzhou Panzhongming Pharmacy. CTX was purchased from Baxter (catalog number: 21570A). The 2 × RealStar Fast qPCR Pre-Mix (Low ROX), protein markers, and 8 % and 12 % protein gel pre-mix kits were purchased from GenStar Biotechnology Co., Ltd., China. Reverse transcription reagents were purchased from TaKaRa (Japan). Antibodies for GAPDH, FOXP3 (catalog number: 22228-1-AP), and secondary antibodies were obtained from Wuhan Sanying Biotechnology Co., Ltd. Antibodies for IL-10 (catalog number: PU136319S) were purchased from Abmart. Antibodies for TGF-β (catalog number: MAB1835-SP) were purchased from R&D Systems, Inc. The BCA protein quantification assay kit (catalog number: G2026-1000T), malondialdehyde (MDA) assay kit (catalog number: G4300-96T), and catalase (CAT) assay kit (catalog number: G4307) were purchased from Servicebio, China. The total superoxide dismutase (SOD) assay kit (catalog number: A001-1), glutathione peroxidase (GSH-PX) assay kit (catalog number: A005), and total antioxidant capacity (T-AOC) assay kit (catalog number: A015-3) were purchased from Nanjing Jiancheng Bioengineering Institute. ELISA kits for IL-10 (catalog number: ml023394B), TGF-β (catalog number: ml061010B), IL-22 (catalog number: ml583937B), and IL-27 (catalog number: ml573463B) were obtained from Shanghai Enzyme-linked Biotechnology Co., Ltd.
Composition and proportions of JSD
Weigh 45 g of stir-fried Atractylodes macrocephala Koidz, 30 g of Codonopsis pilosula, 30 g of Poria cocos, 15 g of honey-fried Glycyrrhiza uralensis, 15 g of Portulaca oleracea, and 15 g of Taraxacum. For mixing with 5 kg of feed, the total amount of herbal ingredients to feed ratio is calculated as 150 g/5 kg = 3 %. Based on this ratio, the required amount of herbal ingredients is determined for any given total feed quantity, and the herbs are then decocted accordingly.
Preparation of JSD
The traditional Chinese herbs are first prepared into powdered form. Weigh the six herbal powders according to the required amount, mix them thoroughly, and place them into a muslin bag. Add an appropriate amount of distilled water to the decoction pot and soak the herbs for 30 min. Decoct the herbs twice: the first decoction for 45 min, followed by filtration using a 100-mesh nylon sieve. The second decoction lasts for 30 min, after which the liquids are filtered and combined. The combined decoction is then concentrated to a final concentration of 1 g/mL and set aside. After the filtrate stands for 5 min, transfer it into a sprayer. The spraying and mixing steps are the same as those for PAMK.
Experimental design
A total of 100 one-day-old female Lingnan Yellow No. 2 chicks, obtained from Guangdong Zhiwei Agricultural Technology Co., Ltd., were randomly assigned to five groups with 20 chicks per group. The experimental grouping and treatments are detailed in Table 1. Based on the grouping, PAMK or the compound herbal formula was added to the feed daily. From days 19 to 21, chicks received intramuscular injections of CTX in the thigh, while the control group was injected with 0.5 mL of physiological saline. During the rearing period, animals had free access to water and lighting. Animals were monitored daily for signs of distress or illness, and appropriate veterinary care was provided as needed. On day 29, the chicks were euthanized by intraperitoneal injection of a lethal dose of sodium pentobarbital (100 mg/kg BW) under deep anesthesia to minimize pain and distress. Serum, cecal contents, and jejunum samples were collected from the chicks. All samples were immediately placed in liquid nitrogen and stored at −80°C for further analysis. The experiment received prior ethical approval in accordance with Zhongkai University of Agriculture and Engineering and under the approved protocol number ZK202310-28.
Table 1.
Experimental groups and treatments.
| Group | PAMK or JSP Dose | Injectable CTX Dose |
|---|---|---|
| Control | —— | —— |
| CTX | —— | 40 mg/kg•BW |
| P30+CTX | 1200 mg/kg 30 % PAMK | 40 mg/kg•BW |
| P95+CTX | 400 mg/kg 95 % PAMK | 40 mg/kg•BW |
| JSD+CTX | 3 % Jiawei Si-jun-zi Decoction | 40 mg/kg•BW |
Note: P30: 30 % Polysaccharides from Atractylodes macrocephala; P95: 95 % Polysaccharides from Atractylodes macrocephala; JSD: 3 % Jiawei Si-jun-zi Decoction; CTX: Cyclophosphamide.
Composition of the basal diet
The 191 Yellow Chick Feed (Days 1-15) and 192 Yellow Middle Chick Feed (Days 15-40) were purchased from Foshan Guangmuxing Feed Co., Ltd. Ingredients: The feed consisted of corn, soybean meal, fish meal, corn gluten meal, wheat bran, dicalcium phosphate, limestone, trace minerals, multivitamins, and amino acids (nutritional composition as shown in Table 2). The feed also contained anticoccidial medication, with 60 mg of methyl salinomycin per kilogram of feed.
Table 2.
Nutritional composition of the two feed types.
| Nutritional Composition | Early-Stage Feed (Days 1–15) | Middle-Stage Feed (Days 15–40) |
|---|---|---|
| Crude protein | ≥20.0 % | ≥17.0 % |
| Crude fiber | ≤8.6 % | ≤8.0 % |
| Crude ash | ≤10.0 % | ≤10.0 % |
| Calcium | 0.8∼1.2 % | 0.5∼1.2 % |
| Total phosphorus | 0.4∼0.9 % | 0.4∼0.9 % |
| Sodium chloride | 0.2∼0.8 % | 0.2∼0.8 % |
| Lysine | ≥0.80 % | ≥0.65 % |
| Moisture | ≤ 12.9 % | ≤ 12.9 % |
Note:This table summarizes the main nutritional components of the basal diet used for early and middle-stage chick feeding.
Component analysis of JSD
The 50 g solid JSD sample was sent to the Guangzhou Huibiao Testing Technology Center for component analysis using instruments such as an electric heating forced air drying oven, ultraviolet-visible spectrophotometer, and Kjeldahl nitrogen analyzer.
Accurately weigh 10-100 mg of the compound herbal sample and place it in a 2.0 mL screw-cap tube. Add 700 μL of 80 % ethanol solution and shake the mixture at 50°C for 2 h. Add 700 μL of water to dilute the solution. Centrifuge at 10,000 rpm for 3 min, and transfer the supernatant to a new centrifuge tube. The sugar components were analyzed using the Thermo ICS 5000+ ion chromatography system (Thermo Fisher Scientific, USA), with an electrochemical detector. A CarboPac™ PA1 (250 × 4.0 mm) liquid chromatography column was used for detection, and JSD soluble sugar determination is obtained. The analysis is assisted by Jiangsu SanShu Bio-Tech Co., Ltd.
Measurement of average daily gain
Randomly select 10 chicks from each group, assign them identification numbers, and record their body weights. At the start of the experiment or breeding period, weigh the animals in a fasting state and record their initial body weight. This weighing procedure is repeated daily until the chicks reach 28 days of age. The ADG is calculated using the following formula: ADG = (Final Weight - Initial Weight) / (End Day - Start Day).
Measurement of jejunal antioxidant indicators
The activity of SOD, GSH-PX, T-AOC, and the levels of MDA and CAT in the jejunum of chicks were measured using kits from Nanjing Jiancheng Bioengineering Institute and Servicebio. Measurements were performed using a multifunctional microplate reader, following the instructions provided in the kit manuals. The procedure was assisted by Guangzhou Dianli Biotechnology Co., Ltd.
Measurement of jejunal cytokines
0.1 g of jejunal was weighed and added an appropriate amount of physiological saline, followed by homogenization using a tissue homogenizer. The mixture was then centrifuged at 1,000 × g for 10 min at 4°C, and the supernatant was collected. Cytokine levels were measured following the instructions provided in the ELISA kit manual.
Real-time quantitative PCR
Gene sequences were obtained from the National Center for Biotechnology Information website, and primers were designed and synthesized by Guangzhou Youkang Biotechnology Co., Ltd. The primer sequences used in this study are listed in Table 3. Real-time quantitative PCR was performed using a QuantStudio 7 fluorescence quantitative PCR system. The relative mRNA expression levels of target genes were calculated using the 2-ΔΔCt method.
Table 3.
Primers sequence.
| Gene | Accession number | Forward primer | Reverse primer |
|---|---|---|---|
| GAPDH | NM_204305.2 | TCGGAGTCAACGGATTTGGC | TTCCCGTTCTCAGCCTTGAC |
| ZO-1 | XM_040680626.2 | GGAGTACGAGCAGTCAACATAC | GAGGCGCACGATCTTCATAA |
| occludin | XM_046904539.1 | CACCTACCTCAACCAGTACATC | GATCTTACTGCGCGTCTTCT |
| FOXP3 | XM_046926432.1 | AACATACAGACCAGCCACAC | CCCATGGAAGCAGTAGTGTATAG |
| TNF-α | XM_046927265.1 | CCATCTGCACCACCTTCATA | GGTTCATTCCCTTCCCATCT |
| TGF-β | NM_001318456.1 | ACCTCGACACCGACTACT | CACTTCCACTGCAGATCCTT |
| TLR4 | NM_001030693.2 | CAGGTACAGATGCAGGAGTTT | CAGGTCCACCAACCGAATAG |
Western blot
Total protein was extracted from the jejunal, and the target proteins were separated using SDS-PAGE. The separated proteins were transferred to a membrane using the wet transfer method. The membrane was blocked with 5 % non-fat milk for 2 h. Primary antibodies for GAPDH (1:10,000), FOXP3 (1:1,000), TGF-β (1:800), and IL-10 (1:8,000) were prepared, and the membrane was incubated overnight at 4°C. The membrane was washed three times with TBST buffer for 5-10 min each. The membrane was then incubated with secondary antibodies at room temperature for 1 h, followed by three washes with TBST buffer for 5-10 min each. Finally, the membrane was developed using the appropriate chemiluminescence substrate, and images were captured. The protein band intensity was analyzed using ImageJ 1.5.2 software, with GAPDH used as the internal control. The relative expression level of the target protein was calculated as the ratio of the target protein band intensity to the internal control protein band intensity.
16S rDNA sequencing
Cecal contents were collected for total DNA extraction. PCR amplification of the V3-V4 variable region was performed using the forward primer F (5′-ACTCCTACGGGAGGCAGCA) and the reverse primer R (5′-GGACTACHVGGGTWTCTAAT). The sequencing library was prepared using the Illumina TruSeq Nano DNA LT Library Prep Kit, and high-throughput sequencing was conducted.
Data processing and statistical analysis
Data were analyzed using SPSS 27.0 software for one-way analysis of variance (ANOVA). Data are expressed as the mean ± standard deviation. Protein band intensities were analyzed using ImageJ 1.5.2 software. GraphPad Prism 9.5.1 was used for data visualization. A p-value of < 0.05 was considered statistically significant.
Results
Analysis of Jiawei-Si-jun-zi decoction
JSD is a traditional Chinese herbal formula composed of multiple ingredients, including Fried Atractylodes macrocephala Koidz., Codonopsis Radix, Poria cocos, Radix Glycyrrhizae Preparata, Portulaca oleracea L., and Taraxacum officinale. The major constituents of JSD were analyzed using ultraviolet-visible (UV-Vis) spectrophotometry and the Kjeldahl nitrogen determination method. The analytical results are summarized in Table 4 and were provided by the Guangzhou Huibiao Testing Technology Center.
Table 4.
The composition of the ingredients in JSD.
| Ingredients | Content |
|---|---|
| Moisture | 8.5 % |
| Crude Protein | 10.52 % |
| Calcium | 0.687 % |
| Total Phosphorus | 0.23 % |
| Polysaccharides | 8.21 g/100g |
Carbohydrates are organic compounds composed of carbon, hydrogen, and oxygen, typically classified as polyhydroxy aldehydes or ketones and their hydrolysis products. Soluble sugars, including glucose, fructose, and sucrose, are primarily composed of monosaccharides and oligosaccharides and play important roles in plant physiological processes. The composition of monosaccharides in the compound herbal formula is presented in Table 5. Fig. 1A shows the chromatogram of the monosaccharide standards, while Fig. 1B displays the chromatogram of the JSD sample.
Table 5.
Analysis of monosaccharide components in the JSD.
| Igredient | Abbreviation | Content(%) |
|---|---|---|
| Trehalose | Tre | 1.80 |
| Fucose | Fuc | 0.03 |
| Arabinose | Ara | 0.15 |
| Galactose | Gal | 0.49 |
| Glucose | Glc | 16.13 |
| Mannose | Man | 0.47 |
| Fructose | Fru | 28.03 |
| Sucrose | Suc | 50.34 |
| Raffinose | Raf | 0.32 |
| Maltose | Mal | 2.24 |
Fig. 1.
The chromatographic analysis of JSD soluble sugars. (A) Chromatogram of the standard. (B) Chromatogram of the sample. The x-axis represents retention time (min), and the y-axis represents the ion detection response (Response, nC).
Effect of PAMK and JSD on ADG of CTX-treated chicks
As shown in Table 6, there were no significant differences in ADG among the groups during Day 1–Day 15 and Day 15–Day 22. However, from Day 22 to Day 28, the CTX group exhibited a significant decrease in ADG compared with the P95+CTX group (P < 0.05). This reduction was likely due to the administration of cyclophosphamide from Day 19 to Day 21. Dietary supplementation with different concentrations of PAMK or JSD effectively attenuated the decline in ADG, suggesting a protective effect on intestinal health.
Table 6.
Effect of PAMK and JSD on ADG in CTX-treated chicks.
| Group | Day1-Day15 (g) | Day15-Day22 (g) | Day22-Day28 (g) |
|---|---|---|---|
| Control | 18.4 ± 0.14 | 35.06 ± 1.13 | 29.07ab ± 0.80 |
| CTX | 18.1 ± 0.16 | 35.78 ± 1.29 | 26.19b ± 0.31 |
| P30+CTX | 18.3 ± 0.17 | 34.86 ± 0.96 | 31.87ab ± 0.77 |
| P95+CTX | 18.3 ± 0.10 | 33.31 ± 0.95 | 38.08a ± 0.86 |
| JSD+CTX | 18.2 ± 0.23 | 32.66 ± 1.22 | 34.87ab ± 0.92 |
Note: Different letters (a, b) indicate significant differences (P < 0.05).
Effect of PAMK and JSD on antioxidant capacity and cytokines in CTX-treated chicks
CTX generates free radicals and reactive oxygen species (ROS) during its metabolism, leading to oxidative damage to cellular components such as membranes, proteins, and DNA. To evaluate whether traditional Chinese medicine could mitigate CTX-induced oxidative stress, antioxidant indices in the jejunum of chicks were measured. As shown in Fig. 2A, compared with the control group, the CTX group exhibited a significant reduction in GSH-PX activity (P < 0.05), along with a decreasing trend in SOD, CAT, and T-AOC levels, although these changes were not statistically significant (P > 0.05). MDA levels also showed an increasing trend in the CTX group (P > 0.05). Dietary supplementation with different concentrations of PAMK and JSD alleviated the oxidative stress induced by CTX, as indicated by an overall improvement in antioxidant parameters compared with the CTX group.
Fig. 2.
Effect of PAMK and JSD on antioxidant capacity and cytokines in CTX-treated chicks. (A) Assessment of antioxidant parameters in jejunal. (B) ELISA analysis of jejunal. Different letters indicate significant differences (P < 0.05), while the same letters indicate no significant difference (P > 0.05).
To investigate the effects of CTX on intestinal immune function, the concentrations of IL-10, TGF-β, IL-22, and IL-27 in the jejunum were determined using ELISA, as shown in Fig. 2B. Compared with the control group, the CTX group exhibited downward trends in all four cytokines, although the differences were not statistically significant (P > 0.05). In contrast, the P95+CTX group showed significantly higher levels of IL-10, IL-27, and TGF-β than the CTX group (P < 0.05). The P30+CTX group exhibited significantly increased levels of IL-10 and IL-27 (P < 0.05), while the JSD+CTX group showed significant upregulation of IL-10 and IL-22 (P < 0.05). These results suggest that dietary supplementation with PAMK and JSD can modulate cytokines associated with intestinal immunity and may contribute to improved immune responses in CTX-treated chicks.
Effect of PAMK and JSD on intestinal immune function
As shown in Fig. 3A, the relative mRNA expression levels of ZO-1, Occludin, TGF-β, and TLR4 were significantly downregulated in the CTX group compared to the control group (P < 0.05). Additionally, the relative mRNA expression level of TNF-α was significantly decreased in the P95+CTX group (P < 0.05). Although no statistically significant changes were observed, an upward trend in the mRNA expression of ZO-1, Occludin, FOXP3, and TGF-β was noted across all groups except for the CTX group. These findings suggest that CTX may disrupt intestinal immune function and, consequently, impair intestinal barrier integrity.
Fig. 3.
Effect of PAMK and JSD on Intestinal Immune Function. (A) mRNA Expression of Related Genes in Jejunal. (B) Protein Expression in Jejunal.
To further evaluate the impact of CTX on intestinal immune function, we examined intestinal immune-related proteins. As depicted in Fig. 3B, the protein levels of FOXP3, IL-10, and TGF-β showed a downward trend in the CTX group, although these changes were not statistically significant (P > 0.05). In contrast, the P30+CTX and P95+CTX groups demonstrated an upward trend in FOXP3 and TGF-β protein levels, though these changes were not statistically significant either (P > 0.05). The JSD+CTX group exhibited a significant increase in IL-10 protein levels (P < 0.05). These results suggest that PAMK and the compound herbal formula may regulate intestinal immune function and protect the intestinal barrier from CTX-induced damage.
PAMK regulates the overall structure of gut microbiota in CTX-treated chicks
For 16S rDNA sequencing analysis, group names were standardized as follows: Control (control), CTX (ctx), P30+CTX (PAMK30), P95+CTX (PAMK95), and JSD+CTX (FP). Cecal content samples were collected, and total DNA was extracted for gut microbiota profiling. Alpha diversity analysis was performed to evaluate microbial richness, diversity, and evenness within each group.
As shown in Table 7 and Fig. 4A, the Chao1 and Observed Species indices reflected microbial richness, while the Shannon index represented community diversity. Compared with the CTX group, the PAMK95 group showed significantly higher Chao1 and Observed Species indices (P < 0.05), whereas the PAMK30 group exhibited a non-significant increasing trend (P > 0.05). The CTX group demonstrated a decreasing trend in Chao1, Observed Species, Faith_pd, and Shannon indices relative to the control group (P > 0.05). Interestingly, the FP group showed a significant reduction in Shannon and Observed Species indices (P < 0.05), possibly due to the complex composition of the herbal formula, which may limit absorption and thus affect microbial richness.
Table 7.
Results of alpha diversity analysis.
| Group | chao1 | Observed_species | shannon |
|---|---|---|---|
| control | 1141.2 ± 148.83ab | 1096.14 ± 154.41ab | 7.51 ± 0.20a |
| ctx | 979.59 ± 150.28bc | 937.22 ± 154.84bc | 7.13 ± 0.11ab |
| PAMK30 | 1173.34 ± 149.68ab | 1142.60 ± 158.16ab | 7.30 ± 0.25a |
| PAMK95 | 1326.23 ± 111.42a | 1287.64 ± 108.14a | 7.47 ± 0.34a |
| FP | 835.18 ± 55.60c | 812.22 ± 60.40c | 6.67 ± 0.24b |
Note: Chao1 and Observed Species reflect the richness of the microbiota, while Shannon indicates the diversity of the microbiota.
Fig. 4.
Analysis of microbial richness and diversity in CTX-Treated Chicks with PAMK and compound herbal formula (A) AlpHA DIVERSITY ANALysis; (B) PCA analysis; (C) PCoA analysis.
Beta diversity was analyzed using PCA and PCoA to explore differences in microbial community structure. As shown in Fig. 4B, the first two PCA components (PC1 and PC2) accounted for 33.2 % and 24.5 % of the total variation, respectively. The CTX group clustered away from the control group, whereas the PAMK30 and PAMK95 groups clustered closer to the control group, indicating similar community compositions. The FP group showed a broader distribution range. Similar clustering patterns were observed in the PCoA plot (Fig. 4C). Collectively, these results suggest that PAMK supplementation may improve the richness and diversity of the cecal microbiota in CTX-treated chicks.
Effect of PAMK and JSD on microbial community composition
To further investigate the composition and potential functionality of the gut microbiota, we analyzed the taxonomic profiles of each group. The relative abundance at the phylum level is shown in Fig. 5A, highlighting the top 20 taxa based on richness. The cecal microbiota in all groups was primarily composed of Firmicutes, Bacteroidetes, Proteobacteria, Tenericutes, and Actinobacteria. Among these, Firmicutes and Bacteroidetes were the dominant phyla, accounting for more than 90 % of the total microbial population. Compared with the Control group, the CTX group exhibited reduced abundance of Firmicutes and Proteobacteria and an increased abundance of Bacteroidetes. The PAMK30 group maintained the abundance of Firmicutes, increased the abundance of Bacteroidetes, and reduced the abundance of Proteobacteria. The PAMK95 and FP groups both showed decreased abundance of Firmicutes and increased abundance of Bacteroidetes.
Fig. 5.
Effect of PAMK and JSD on the gut microbiota composition in CTX-Treated Chicks. (A) Phylum level analysis; (B) Genus level analysis; (C) LEfSe analysis.
At the genus level, as shown in Fig. 5B, the predominant genera included Ruminococcus (Family Erysipelotrichaceae), Parabacteroides, Bacteroides, Oscillospira, Blautia, Phascolarctobacterium, Desulfovibrio, Butyricicoccus, and Lactobacillus. Compared with the Control group, the CTX group showed increased relative abundance of Parabacteroides, Bacteroides, Blautia, and Phascolarctobacterium, whereas the abundance of Ruminococcus and Oscillospira was decreased. This microbial imbalance was largely restored in the PAMK95 group, while the PAMK30 and FP groups demonstrated partial recovery. The PAMK30, PAMK95, and FP treatments all increased the relative abundance of Parabacteroides and Bacteroides and decreased the abundance of Oscillospira. Among these, the FP group had the highest level of Parabacteroides, whereas the microbial composition in the PAMK95 group was most similar to that of the Control group. These results suggest that supplementation with herbal ingredients may partially alleviate CTX-induced gut microbiota dysbiosis through different mechanisms of action.
To further identify key microbial features among groups, LEfSe analysis was performed. As shown in Fig. 4C, the Control group was characterized by enrichment of Firmicutes at the phylum level, as well as f_Erysipelotrichaceae, o_Erysipelotrichales, c_Erysipelotrichi, and g_Clostridium. In contrast, the CTX group showed significant enrichment in g_Akkermansia, o_Verrucomicrobiales, p_Verrucomicrobia, and f_Verrucomicrobiaceae. The PAMK30 group was predominantly enriched in p_Bacteroidetes, c_Bacteroidia, and o_Bacteroidales. The enrichment of Bacteroidetes may play an important role in the regulation of gut microbiota and immune function. These findings further support the potential of PAMK in improving the immunomodulatory capacity of the gut microbiota.
Discussion
TCM contains diverse bioactive components, including polysaccharides, flavonoids, and essential oils, which have been reported to regulate immune responses, improve intestinal barrier function, modulate gut microbiota composition, and restore metabolic balance (Zhang et al., 2021). Among these, plant-derived polysaccharides have attracted considerable attention for their immunomodulatory potential in poultry. Previous studies have shown that polysaccharides such as PAMK, Astragalus polysaccharides, and Pinus massoniana pollen polysaccharides can enhance immune function in poultry and may serve as therapeutic agents for immune-related disorders (Zhao et al., 2023). Specifically, PAMK has demonstrated anti-inflammatory, antioxidant, and immunoregulatory effects (Zhu et al., 2018). Similarly, Polygonatum sibiricum polysaccharide has been shown to alleviate CTX-induced immunosuppression in chickens by improving growth performance, enhancing antioxidant status, and modulating cytokine expression in immune organs (Shu et al., 2021). In addition, dietary supplementation with Acanthopanax senticosus polysaccharides was found to improve ADG and ADFI, enhance immune function, and beneficially alter gut microbiota in broilers (Long et al., 2021). Furthermore, recent findings suggest that herbal preparations can increase microbial diversity in the ileum, improve nutrient absorption and metabolic efficiency, support gut–liver axis function, and strengthen host immunity (Liu et al., 2024). These findings collectively support the potential of plant polysaccharides as effective immunonutritional interventions in poultry production systems.
Our results demonstrated that CTX treatment significantly reduced the ADG in chicks, consistent with its well-documented immunosuppressive effects. CTX likely impairs growth performance by inducing DNA damage and suppressing immune function, which may lead to reduced feed intake and compromised intestinal health. However, dietary supplementation with PAMK or JSD effectively mitigated these negative effects. This improvement may be attributed to the ability of plant polysaccharides to enhance intestinal morphology, increase the villus-to-crypt ratio, and improve nutrient digestion and absorption. These findings suggest that herbal additives can promote growth performance in immunocompromised poultry by supporting intestinal structure and function.
Chemical analysis of JSD revealed that its main bioactive component is polysaccharides. Polysaccharides are known to possess various biological functions, including intestinal protection and immune modulation, and may play a key role in alleviating CTX-induced intestinal injury. CTX metabolism generates excessive ROS, which disrupt the intestinal barrier and reduce antioxidant enzyme activity, ultimately triggering oxidative stress (Cao et al., 2021) . Previous studies have shown that dietary supplementation with polyherbal mixtures (PHMs) enhances antioxidant capacity, strengthens the intestinal barrier, and modulates gut microbiota, thereby improving broiler performance (Liu et al., 2023). For example, Abrus cantoniensis has been reported to elevate hepatic T-SOD and GSH-PX levels, reduce hepatic MDA levels, and increase the secretion of cytokines such as TNF-α, IL-6, and IL-1β, counteracting CTX-induced immunosuppression in mice (Qu et al., 2022). Terminalia chebula extract also improved serum T-AOC levels, intestinal mucosal health, and immune responses (Wang et al., 2024). In broilers, dietary mulberry leaf polysaccharides improved growth performance, increased antioxidant enzyme activity, and upregulated cytokines such as IL-10 and TNF-α. They also enhanced expression of tight junction proteins (Claudin-1, ZO-1) and MUC-2, supporting intestinal integrity (Cheng et al., 2024). Our results suggest that PAMK and JSD reduce CTX-induced oxidative stress via multiple mechanisms, including enhancing antioxidant enzyme activity, modulating immune responses, and protecting the intestinal barrier. These effects may be mediated by the Nrf2/HO-1 signaling pathway (Li et al., 2021). In this study, the addition of different concentrations of PAMK and JSD effectively alleviated this oxidative stress condition. Other components in JSD, such as Poria and Codonopsis, may also synergistically exert antioxidant and anti-inflammatory effects. These compounds can activate MAPK signaling, regulate tight junction protein expression, and enhance mucosal barrier function (Hu et al., 2019). Overall, supplementation with PAMK and JSD alleviated CTX-induced oxidative stress through multiple mechanisms, including strengthening the intestinal barrier, boosting antioxidant enzyme activity, and improving immune function. These effects collectively enhanced the antioxidant capacity and intestinal health of CTX-treated chicks.
Our study explored the effects of dietary PAMK and compound traditional Chinese medicine supplementation on intestinal immune function. We assessed cytokine levels, mRNA expression of genes related to the intestinal mucosal barrier, and protein expression of immune markers in the jejunum. Previous studies have shown that PAMK can enhance T lymphocyte proliferation and immune function (Sun et al., 2015), while also alleviating CTX-induced declines in T lymphocyte activation, increasing IL-4 and IL-10 levels, and reducing inflammatory cytokines (Li et al., 2021). Additionally, research has indicated that Gastrodia elata polysaccharides promote the secretion of immune-related cytokines, increase occludin and ZO-1 expression, and improve intestinal barrier function while enhancing gut microbiota abundance (Li et al., 2023). IL-22 plays a crucial role in intestinal epithelial cell regeneration and maintaining the integrity of the intestinal mucosal barrier (Lindemans et al., 2015; Keir et al., 2020), and IL-27 regulates both innate and adaptive immune responses (Povroznik and Robinson, 2020). FOXP3, expressed primarily in regulatory T cells, modulates IL-22 production through its influence on Th17 cells, and IL-27 promotes FOXP3+ Treg cell generation (Cosovanu and Neumann, 2020). Furthermore, polysaccharides from natural products modulate gut microbiota diversity and abundance, enhancing anti-inflammatory cytokine production, reducing pro-inflammatory cytokines, and improving antioxidant capacity and immune function (Zhang et al., 2022).
Our findings show that CTX treatment reduced cytokine levels in the jejunum and downregulated mRNA expression of intestinal barrier-related genes, reflecting the suppressive effects of CTX on intestinal immunity. However, supplementation with 30 % and 95 % PAMK in the diet effectively countered CTX-induced immunosuppression, with 95 % PAMK demonstrating superior efficacy (Chen et al., 2003). Herbal formulations, including those containing Atractylodes macrocephala, have been shown to promote growth and enhance immune function in broiler chicks (Li et al., 2013). Similarly, our results indicate that JSD enhanced immune function, likely through the synergistic action of multiple components, including PAMK. This effect may involve direct antioxidant activity, immune cell activation, and gut microbiota modulation.
The gut microbiota, a dynamic and complex community, is crucial for the growth and health of broilers. It influences immune function through various mechanisms, including immune cell regulation, metabolite production, and competitive interactions (Yang et al., 2022). Polysaccharides, such as PAMK, can repair CTX-induced intestinal damage by modulating gut microbiota, tight junction proteins, and related pathways (Wang et al., 2014). Studies have shown that Poria cocos polysaccharides enhance intestinal immune function, increase ZO-1 and FOXP3 expression, and promote beneficial gut bacteria (Xu et al., 2023). Furthermore, Laminaria japonica fucoidan has been shown to elevate immune cytokines, increase immune organ indices, and promote Lactobacillus growth, thereby boosting beneficial bacteria abundance (Tang et al., 2022). Additionally, American ginseng polysaccharides and ginsenosides have been reported to increase beneficial bacteria like Clostridium and Bifidobacterium, while reducing harmful bacteria (Zhou et al., 2021). Previous studies have also shown that compound small peptides from Chinese medicine can reduce the secretion of IL-2, IL-22, and TNF-α cytokines induced by CTX, while improving gut microbiota balance and enhancing intestinal immune function (Cui et al., 2022). Additionally, Hericium erinaceus polysaccharides have been found to enhance immune organ indices, increase gut microbiota abundance, restore SCFA levels, and alleviate CTX-induced immunosuppression, further supporting the role of natural polysaccharides in enhancing immune function (Tian et al., 2023). In conclusion, our study provides evidence that PAMK and compound TCM formulations, enhance immune function in broiler chicks by modulating gut microbiota, improving intestinal barrier function, and regulating immune responses. The synergistic effects of multiple components in these formulations contribute to their ability to alleviate CTX-induced immunosuppression, supporting their potential use as immune modulators in poultry nutrition.
The 16S rDNA sequencing results revealed that CTX treatment significantly reduced the diversity of the intestinal microbiota in broiler chickens, while supplementation with PAMK and JSD effectively mitigated these changes. α-Diversity analysis, including Chao1, Observed Species, and Shannon indices, showed a marked decline in microbial richness and diversity in the CTX group, with Chao1 and Observed Species indices significantly lower than the control group, indicating severe microbiota dysbiosis. In contrast, the PAMK95 group exhibited significantly higher Chao1 and Observed Species indices compared to the CTX group, suggesting that high-concentration PAMK may help restore gut microbiota homeostasis by promoting the colonization and diversity of beneficial bacteria.
At the phylum level, CTX treatment reduced the relative abundance of Firmicutes and increased that of Bacteroidetes, patterns commonly associated with intestinal dysbiosis and inflammation. Notably, supplementation with PAMK95 reversed these changes, while the PAMK30 and FP groups showed partial improvement. This discrepancy may be due to the more complex composition of 30 % PAMK, which may reduce its bioactive effectiveness compared to 95 % PAMK. JSD, a compound traditional Chinese medicine, contains multiple herbal components, each potentially influencing efficacy through synergistic or antagonistic interactions. JSD likely regulates intestinal microbial balance via various pathways.
Previous studies have shown that compound Chinese herbal medicines can improve chicken growth, immunity, antioxidant levels, and enhance the abundance of beneficial bacteria, maintaining intestinal microbiota balance (Song et al., 2023). At the genus level, the relative abundance of Ruminococcus was significantly reduced in the CTX group, but PAMK95 supplementation partially restored its abundance. Since Ruminococcus contributes to intestinal barrier function through SCFA production, this restoration suggests that PAMK may enhance gut barrier integrity and optimize energy metabolism (Parada et al., 2019). Additionally, PAMK95 significantly increased Lactobacillus abundance, a probiotic known for its immune-modulating, mucosal barrier repair, and anti-inflammatory effects through SCFA metabolism (Wu et al., 2022). These findings suggest that PAMK helps maintain intestinal microbial homeostasis by promoting the proliferation and metabolic activity of beneficial bacteria.
LEfSe analysis revealed significant microbiota shifts among treatment groups. In the CTX group, Akkermansia abundance significantly increased, a genus associated with intestinal mucus layer degradation, indicating CTX-induced intestinal barrier damage (Rodrigues et al., 2022). In contrast, the JSD group showed increased abundances of Lactobacillus and Ruminococcus, probiotics linked to intestinal immune homeostasis. Polysaccharides from Codonopsis pilosula and Portulaca oleracea have been shown to regulate antioxidant levels and maintain intestinal flora balance (Nie et al., 2024; Ning et al., 2024). The PAMK30 group exhibited increased Bacteroidetes abundance, a group closely tied to SCFA metabolism and immune regulation. This further suggests that PAMK may mitigate CTX-induced dysbiosis by enhancing SCFA production and supporting immune homeostasis.
Microbiota structural changes were closely linked to host antioxidant and immune regulation. In the CTX group, antioxidant enzyme activity was significantly reduced, along with decreased expression of anti-inflammatory cytokines IL-10 and TGF-β, indicating that CTX disrupts intestinal homeostasis through oxidative stress and suppression of anti-inflammatory pathways (Esteves-Monteiro et al., 2024). However, PAMK supplementation significantly restored antioxidant enzyme activity and upregulated IL-10 and TGF-β expression, further confirming its protective role in alleviating oxidative stress and maintaining immune homeostasis.
Conclusion
This study provides strong evidence for the role of PAMK and JSD in regulating gut health and immune function. PAMK and JSD enhance antioxidant enzyme activity, improve intestinal barrier function, regulate gut microbiota, and increase anti-inflammatory cytokine levels. These effects effectively improve the ADG of broiler chickens and alleviate intestinal damage and immune suppression induced by CTX. The findings offer scientific support for the development of safe feed additives and the reduction of antibiotic use.
Ethics statement
The experiment received prior ethical approval in accordance with Zhongkai University of Agriculture and Engineering and under the approved protocol number ZK202310-01.
CRediT authorship contribution statement
Baili Lu: Funding acquisition, Writing – original draft, Writing – review & editing. Shirou Pan: Investigation, Writing – original draft, Writing – review & editing. Jiayu He: Investigation, Writing – original draft, Writing – review & editing. Bingxin Li: Data curation, Formal analysis, Funding acquisition, Writing – original draft, Writing – review & editing. Nan Cao: Funding acquisition, Writing – original draft, Writing – review & editing. Xinliang Fu: Formal analysis, Writing – original draft, Writing – review & editing. Wenjun Liu: Conceptualization, Visualization, Data curation, Funding acquisition, Writing – original draft, Writing – review & editing. Yunmao Huang: Formal analysis, Writing – original draft, Writing – review & editing. Yunbo Tian: Conceptualization, Visualization, Writing – original draft, Writing – review & editing. Danning Xu: Conceptualization, Visualization, Funding acquisition, Writing – original draft, Writing – review & editing. Wanyan Li: Conceptualization, Visualization, Data curation, Funding acquisition, Writing – original draft, Writing – review & editing.
Disclosures
All authors declare that they have no conflicts of interest.
Acknowledgments
This research was funded by the National Natural Science Foundation, Grant No's. 32102747 and 32202764; the Science Technology Planning Project of Guangzhou, Grant No's. 2023A04J0741 and 2023E04J0022, Special Projects in Key Areas of General Universities in Guangdong Province, Grant No. 2022ZDZX4022.
Scientific Section: Immunology, Health and Disease
References
- Ahlmann M., Hempel G. The effect of cyclophosphamide on the immune system: implications for clinical cancer therapy. Cancer Chemother. Pharmacol. 2016;78(4):661–671. doi: 10.1007/s00280-016-3152-1. [DOI] [PubMed] [Google Scholar]
- Cao L.P., Du J.L., Jia R., Ding W.D., Xu P., Yin G.J., Zhang T. Effects of cyclophosphamide on antioxidative and immune functions of Nile tilapia (Oreochromis Niloticus) via the TLR-NF-kappaB signaling pathway. Aquat. Toxicol. 2021;239 doi: 10.1016/j.aquatox.2021.105956. [DOI] [PubMed] [Google Scholar]
- Che Q., Luo T., Shi J., He Y., Xu D.L. Mechanisms by which traditional Chinese medicines influence the intestinal flora and intestinal barrier. Front. Cell Infect. Microbiol. 2022;12 doi: 10.3389/fcimb.2022.863779. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen H.L., Li D.F., Chang B.Y., Gong L.M., Dai J.G., Yi G.F. Effects of Chinese herbal polysaccharides on the immunity and growth performance of young broilers. Poult. Sci. 2003;82(3):364–370. doi: 10.1093/ps/82.3.364. [DOI] [PubMed] [Google Scholar]
- Chen X., Sun W., Xu B., Wu E., Cui Y., Hao K., Zhang G., Zhou C., Xu Y., Li J., Si H. Polysaccharides from the roots of Millettia Speciosa champ modulate gut health and ameliorate cyclophosphamide-induced intestinal injury and immunosuppression. Front. Immunol. 2021;12 doi: 10.3389/fimmu.2021.766296. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cheng M., Shi Y., Cheng Y., Hu H., Liu S., Xu Y., He L., Hu S., Lu Y., Chen F., Li J., Si H. Mulberry leaf polysaccharide improves cyclophosphamide-induced growth inhibition and intestinal damage in chicks by modulating intestinal flora, enhancing immune regulation and antioxidant capacity. Front. Microbiol. 2024;15 doi: 10.3389/fmicb.2024.1382639. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cosovanu C., Neumann C. The many functions of Foxp3(+) regulatory T cells in the intestine. Front. Immunol. 2020;11 doi: 10.3389/fimmu.2020.600973. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cui Y., Sun W., Li Q., Wang K., Wang Y., Lv F., Chen X., Peng X., Wang Y., Li J., Si H. Effects of Caulis Spatholobi polysaccharide on immunity, intestinal mucosal barrier function, and intestinal microbiota in cyclophosphamide-induced immunosuppressive chickens. Front. Vet. Sci. 2022;9 doi: 10.3389/fvets.2022.833842. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cui Y., Zhang L., Liu Y., Liu W., Shi W., Bao Y. Compound small peptide of Chinese medicine alleviates cyclophosphamide induced immunosuppression in mice by Th17/Treg and jejunum intestinal flora. Front. Microbiol. 2023;14 doi: 10.3389/fmicb.2023.1039287. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cui Y., Zhang L., Lu C., Dou M., Jiao Y., Bao Y., Shi W. Effects of compound small peptides of Chinese medicine on intestinal immunity and cecal intestinal flora in CTX immunosuppressed mice. Front. Microbiol. 2022;13 doi: 10.3389/fmicb.2022.959726. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Esteves-Monteiro M., Ferreira-Duarte M., Vitorino-Oliveira C., Costa-Pires J., Oliveira S., Matafome P., Morato M., Dias-Pereira P., Costa V.M., Duarte-Araujo M. Oxidative stress and histomorphometric remodeling: two key intestinal features of type 2 diabetes in Goto-Kakizaki rats. Int. J. Mol. Sci. 2024;25(22) doi: 10.3390/ijms252212115. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Han M., Zhang Z., Li X., Tong H., Xu Z., Ding Z., Yang A., Xie M., Wang X. Effects of collagen peptides from Micropterus salmoides skin on oxidative damage induced by cyclophosphamide in mice. Front. Nutr. 2022;9 doi: 10.3389/fnut.2022.1037212. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hu S., Huang J., Pei S., Ouyang Y., Ding Y., Jiang L., Lu J., Kang L., Huang L., Xiang H., Xiao R., Zeng Q., Chen J. Ganoderma lucidum polysaccharide inhibits UVB-induced melanogenesis by antagonizing cAMP/PKA and ROS/MAPK signaling pathways. J. Cell. Physiol. 2019;234(5):7330–7340. doi: 10.1002/jcp.27492. [DOI] [PubMed] [Google Scholar]
- Kai L., Zong X., Jiang Q., Lu Z., Wang F., Wang Y., Wang T., Jin M. Protective effects of polysaccharides from atractylodes macrocephalae koidz. Against dextran sulfate sodium induced intestinal mucosal injury on mice. Int. J. Biol. Macromol. 2022;195:142–151. doi: 10.1016/j.ijbiomac.2021.12.042. [DOI] [PubMed] [Google Scholar]
- Keir M., Yi Y., Lu T., Ghilardi N. The role of IL-22 in intestinal health and disease. J. Exp. Med. 2020;217(3) doi: 10.1084/jem.20192195. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Khan A.I., Rehman A.U., Farooqui N.A., Siddiqui N.Z., Ayub Q., Ramzan M.N., Wang L., Xin Y. Effects of shrimp peptide hydrolysate on intestinal microbiota restoration and immune modulation in cyclophosphamide-treated mice. Molecules. 2022;27(5) doi: 10.3390/molecules27051720. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li C., Duan S., Li Y., Pan X., Han L. Polysaccharides in natural products that repair the damage to intestinal mucosa caused by cyclophosphamide and their mechanisms: a review. Carbohydr. Polym. 2021;261 doi: 10.1016/j.carbpol.2021.117876. [DOI] [PubMed] [Google Scholar]
- Li N., Wang D., Wen X., Chu R., Fan J., Chen Y., Luo Y. Effects of polysaccharides from Gastrodia elata on the immunomodulatory activity and gut microbiota regulation in cyclophosphamide-treated mice. J. Sci. Food Agric. 2023;103(7):3390–3401. doi: 10.1002/jsfa.12491. [DOI] [PubMed] [Google Scholar]
- Li W., Xiang X., Cao N., Chen W., Tian Y., Zhang X., Shen X., Jiang D., Xu D., Xu S. Polysaccharide of atractylodes macrocephala koidz activated T lymphocytes to alleviate cyclophosphamide-induced immunosuppression of geese through novel_mir2/CD28/AP-1 signal pathway. Poult. Sci. 2021;100(7) doi: 10.1016/j.psj.2021.101129. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li X., Liu F., Li Z., Ye N., Huang C., Yuan X. Atractylodes macrocephala polysaccharides induces mitochondrial-mediated apoptosis in glioma C6 cells. Int. J. Biol. Macromol. 2014;66:108–112. doi: 10.1016/j.ijbiomac.2014.02.019. [DOI] [PubMed] [Google Scholar]
- Li X.T., Wang B., Li J.L., Yang R., Li S.C., Zhang M., Huang W., Cao L. Effects of Dangguibuxue Tang, a Chinese herbal medicine, on growth performance and immune responses in broiler chicks. Biol. Res. 2013;46(2):183–188. doi: 10.4067/S0716-97602013000200010. [DOI] [PubMed] [Google Scholar]
- Lindemans C.A., Calafiore M., Mertelsmann A.M., O'Connor M.H., Dudakov J.A., Jenq R.R., Velardi E., Young L.F., Smith O.M., Lawrence G., Ivanov J.A., Fu Y.Y., Takashima S., Hua G., Martin M.L., O'Rourke K.P., Lo Y.H., Mokry M., Romera-Hernandez M., Cupedo T., Dow L., Nieuwenhuis E.E., Shroyer N.F., Liu C., Kolesnick R., van den Brink M., Hanash A.M. Interleukin-22 promotes intestinal-stem-cell-mediated epithelial regeneration. Nature. 2015;528(7583):560–564. doi: 10.1038/nature16460. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu C., Wang S., Xiang Z., Xu T., He M., Xue Q., Song H., Gao P., Cong Z. The chemistry and efficacy benefits of polysaccharides from atractylodes macrocephala koidz. Front. Pharmacol. 2022;13 doi: 10.3389/fphar.2022.952061. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu M., Zhou J., Li Y., Ding Y., Lian J., Dong Q., Qu Q., Lv W., Guo S. Effects of dietary polyherbal mixtures on growth performance, antioxidant capacity, immune function and jejunal health of yellow-feathered broilers. Poult. Sci. 2023;102(7) doi: 10.1016/j.psj.2023.102714. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu Z., Wang H., Ma K., Li Q., Wu Y., Qi X., Song J., Wang C., Ma Y., Li T. Supplementation with Chinese herbal preparations protect the gut-liver axis of Hu sheep, promotes gut-liver circulation, regulates intestinal flora and immunity. Front. Immunol. 2024;15 doi: 10.3389/fimmu.2024.1454334. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Long L.N., Zhang H.H., Wang F., Yin Y.X., Yang L.Y., Chen J.S. Research note: effects of polysaccharide-enriched Acanthopanax senticosus extract on growth performance, immune function, antioxidation, and ileal microbial populations in broiler chickens. Poult. Sci. 2021;100(4) doi: 10.1016/j.psj.2021.101028. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nie C., Lan J., Guo H., Ouyang Q., Zhao Y., Wang P., Wang R., Li Y., Wang X., Fang B., Zhan J., Zhu L., Chen C., Zhang W., Liao H., Liu R. Codonopsis pilosula polysaccharides (CPP) intervention alleviates sterigmatocystin (STC)-induced liver injury and gut microbiota dysbiosis. Int. J. Biol. Macromol. 2024;275(Pt 2) doi: 10.1016/j.ijbiomac.2024.133190. [DOI] [PubMed] [Google Scholar]
- Ning K., Shi C., Chi Y.Y., Zhou Y.F., Zheng W., Duan Y., Tong W., Xie Q., Xiang H. Portulaca oleracea L. polysaccharide alleviates dextran sulfate sodium-induced ulcerative colitis by regulating intestinal homeostasis. Int. J. Biol. Macromol. 2024;256(Pt 2) doi: 10.1016/j.ijbiomac.2023.128375. [DOI] [PubMed] [Google Scholar]
- Parada V.D., De la Fuente M.K., Landskron G., Gonzalez M.J., Quera R., Dijkstra G., Harmsen H., Faber K.N., Hermoso M.A. Short chain fatty acids (SCFAs)-mediated gut epithelial and immune regulation and its relevance for inflammatory bowel diseases. Front. Immunol. 2019;10:277. doi: 10.3389/fimmu.2019.00277. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Povroznik J.M., Robinson C.M. IL-27 regulation of innate immunity and control of microbial growth. Future Sci. OA. 2020;6(7):FSO588. doi: 10.2144/fsoa-2020-0032. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Qu D., Hu H., Lian S., Sun W., Si H. The protective effects of three polysaccharides from Abrus cantoniensis against cyclophosphamide-induced immunosuppression and oxidative damage. Front. Vet. Sci. 2022;9 doi: 10.3389/fvets.2022.870042. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Qu L., Tan W., Yang J., Lai L., Liu S., Wu J., Zou W. Combination compositions composed of l-glutamine and Si-Jun-Zi-Tang might Be a preferable choice for 5-fluorouracil-induced intestinal mucositis: an exploration in a mouse model. Front. Pharmacol. 2020;11:918. doi: 10.3389/fphar.2020.00918. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rodrigues V.F., Elias-Oliveira J., Pereira I.S., Pereira J.A., Barbosa S.C., Machado M., Carlos D. Akkermansia muciniphila and gut immune system: a good friendship that attenuates inflammatory bowel disease, obesity, and diabetes. Front. Immunol. 2022;13 doi: 10.3389/fimmu.2022.934695. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Roth N., Kasbohrer A., Mayrhofer S., Zitz U., Hofacre C., Domig K.J. The application of antibiotics in broiler production and the resulting antibiotic resistance in Escherichia coli: a global overview. Poult. Sci. 2019;98(4):1791–1804. doi: 10.3382/ps/pey539. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shan C., Miao F. Immunomodulatory and antioxidant effects of hydroxytyrosol in cyclophosphamide-induced immunosuppressed broilers. Poult. Sci. 2022;101(1) doi: 10.1016/j.psj.2021.101516. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shi N., Li N., Duan X., Niu H. Interaction between the gut microbiome and mucosal immune system. Mil. Med. Res. 2017;4:14. doi: 10.1186/s40779-017-0122-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shu G., Xu D., Zhao J., Yin L., Lin J., Fu H., Tang H., Fang J., Peng X., Zhao X. Protective effect of Polygonatum sibiricum polysaccharide on cyclophosphamide-induced immunosuppression in chickens. Res. Vet. Sci. 2021;135:96–105. doi: 10.1016/j.rvsc.2020.12.025. [DOI] [PubMed] [Google Scholar]
- Song W., Zou Z., Chen X., Tan J., Liu L., Wei Q., Xiong P., Song Q., Chen J., Su W., Xu C. Effects of traditional Chinese herbal feed supplement on growth performance, immunity, antioxidant levels, and intestinal health in chickens: a study on Ningdu yellow chickens. Poult. Sci. 2023;102(10) doi: 10.1016/j.psj.2023.102986. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sun W., Meng K., Qi C., Yang X., Wang Y., Fan W., Yan Z., Zhao X., Liu J. Immune-enhancing activity of polysaccharides isolated from atractylodis macrocephalae Koidz. Carbohydr. Polym. 2015;126:91–96. doi: 10.1016/j.carbpol.2015.03.034. [DOI] [PubMed] [Google Scholar]
- Tang Y., Pu Q., Zhao Q., Zhou Y., Jiang X., Han T. Effects of Fucoidan isolated from Laminaria japonica on immune response and gut microbiota in cyclophosphamide-treated mice. Front. Immunol. 2022;13 doi: 10.3389/fimmu.2022.916618. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tian B., Liu R., Xu T., Cai M., Mao R., Huang L., Yang K., Zeng X., Peilong S. Modulating effects of Hericium erinaceus polysaccharides on the immune response by regulating gut microbiota in cyclophosphamide-treated mice. J. Sci. Food Agric. 2023;103(6):3050–3064. doi: 10.1002/jsfa.12404. [DOI] [PubMed] [Google Scholar]
- Tomasello E., Bedoui S. Intestinal innate immune cells in gut homeostasis and immunosurveillance. Immunol. Cell Biol. 2013;91(3):201–203. doi: 10.1038/icb.2012.85. [DOI] [PubMed] [Google Scholar]
- Wang C.H., Chung K.T., Su L.Y., Wu W.J., Wang P.H., Lee M.C., Shen S.C., Wu C.H. Chinese herbal medicines as natural alternative products to antibiotics in weaned piglets through intestinal microbiota regulation. Int. J. Mol. Sci. 2024;25(20) doi: 10.3390/ijms252011034. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang R., Zhou G., Wang M., Peng Y., Li X. The metabolism of polysaccharide from atractylodes macrocephala koidz and its effect on intestinal microflora. Evid. Based Complement. Altern. Med. 2014;2014 doi: 10.1155/2014/926381. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang T., Li Y., Yin L., Chen J., Shi P., Wang F., Wu K., Yao K., Yin Y. Terminalia chebula extract replacing zinc oxide enhances antioxidant and anti-inflammatory capabilities, improves growth performance, and promotes intestinal health in weaned piglets. Antioxidants. 2024;13(9) doi: 10.3390/antiox13091087. (Basel) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang Y.P., Fu X.Q., Yin C.L., Chou J.Y., Liu Y.X., Bai J.X., Chen Y.J., Wu Y., Wu J.Y., Wang X.Q., Liu B., Yu Z.L. A traditional Chinese medicine formula inhibits tumor growth in mice and regulates the miR-34b/c-Met/beta-catenin pathway. J. Ethnopharmacol. 2020;260 doi: 10.1016/j.jep.2020.113065. [DOI] [PubMed] [Google Scholar]
- Wu Y., Jha R., Li A., Liu H., Zhang Z., Zhang C., Zhai Q., Zhang J. Probiotics (Lactobacillus plantarum HNU082) supplementation relieves ulcerative colitis by affecting intestinal barrier functions, immunity-related gene expression, gut microbiota, and metabolic pathways in mice. Microbiol. Spectr. 2022;10(6) doi: 10.1128/spectrum.01651-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xu B., Zhang L., Li J., Xie Z., Li Y., Si H. Selenium broussonetia papyrifera polysaccharide alleviated cyclophosphamide-induced immune suppression, growth inhibition, intestinal damage, and gut microbiota disorder in yellow-feather broilers. Poult. Sci. 2025;104(4) doi: 10.1016/j.psj.2025.104907. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xu H., Wang S., Jiang Y., Wu J., Chen L., Ding Y., Zhou Y., Deng L., Chen X. Poria cocos polysaccharide ameliorated antibiotic-associated diarrhea in mice via regulating the homeostasis of the gut microbiota and intestinal mucosal barrier. Int. J. Mol. Sci. 2023;24(2) doi: 10.3390/ijms24021423. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yang M., Shi L., Ge Y., Leng D., Zeng B., Wang T., Jie H., Li D. Dynamic changes in the gut microbial community and function during broiler growth. Microbiol. Spectr. 2022;10(4) doi: 10.1128/spectrum.01005-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ye W., Shi H., Qian W., Meng L., Wang M., Zhou Y., Wen Z., Han M., Peng Y., Li H., Xu Y. Immunomodulatory effects of a prebiotic formula with 2′-fucosyllactose and galacto- and fructo-oligosaccharides on cyclophosphamide (CTX)-induced immunosuppressed BALB/c mice via the gut-immune axis. Nutrients. 2024;16(20) doi: 10.3390/nu16203552. [DOI] [PMC free article] [PubMed] [Google Scholar]
- You Y., Kim S.H., Kim C.H., Kim I.H., Shin Y., Kim T.R., Sohn M., Park J. Immune-stimulating potential of lacticaseibacillus rhamnosus LM1019 in RAW 264.7 cells and immunosuppressed mice induced by cyclophosphamide. Microorganisms. 2023;11(9) doi: 10.3390/microorganisms11092312. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang D., Liu J., Cheng H., Wang H., Tan Y., Feng W., Peng C. Interactions between polysaccharides and gut microbiota: a metabolomic and microbial review. Food Res. Int. 2022;160 doi: 10.1016/j.foodres.2022.111653. [DOI] [PubMed] [Google Scholar]
- Zhang H.Y., Tian J.X., Lian F.M., Li M., Liu W.K., Zhen Z., Liao J.Q., Tong X.L. Therapeutic mechanisms of traditional Chinese medicine to improve metabolic diseases via the gut microbiota. Biomed. Pharmacother. 2021;133 doi: 10.1016/j.biopha.2020.110857. [DOI] [PubMed] [Google Scholar]
- Zhao R.H., Yang F.X., Bai Y.C., Zhao J.Y., Hu M., Zhang X.Y., Dou T.F., Jia J.J. Research progress on the mechanisms underlying poultry immune regulation by plant polysaccharides. Front. Vet. Sci. 2023;10 doi: 10.3389/fvets.2023.1175848. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhou R., He D., Xie J., Zhou Q., Zeng H., Li H., Huang L. The synergistic effects of polysaccharides and ginsenosides from American ginseng (Panax quinquefolius L.) ameliorating cyclophosphamide-induced intestinal immune disorders and gut barrier dysfunctions based on microbiome-metabolomics analysis. Front. Immunol. 2021;12 doi: 10.3389/fimmu.2021.665901. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhu B., Zhang Q.L., Hua J.W., Cheng W.L., Qin L.P. The traditional uses, phytochemistry, and pharmacology of atractylodes macrocephala koidz : a review. J. Ethnopharmacol. 2018;226:143–167. doi: 10.1016/j.jep.2018.08.023. [DOI] [PubMed] [Google Scholar]





