Generation and characterization of two iPSC lines derived from subjects with Free Sialic Acid Storage Disorder (FSASD)

Abstract

Free sialic acid storage disorder (FSASD) is a rare, autosomal recessive, neurodegenerative disorder caused by biallelic mutations in SLC17A5, encoding the lysosomal transmembrane sialic acid exporter, SLC17A5. Defects in SLC17A5 lead to lysosomal accumulation of free sialic acid and other acid hexoses. The clinical spectrum of FSASD ranges from mild (Salla disease) to severe infantile forms. The pathobiology underlying FSASD remains elusive. In this study, two induced pluripotent stem cell (iPSC) lines were generated from a mild and an intermediate FSASD patient and characterized to provide much-needed additional models for basic and translational studies.

Resource Table

Unique stem cell lines identifier	1) NHGRIi001-A: https://hpscreg.eu/cell-line/NHGRIi001-A
	2) NHGRIi002-A: https://hpscreg.eu/cell-line/NHGRIi002-A
Alternative name(s) of stem cell lines	1) iPSC-1: FISAL04_Sia80 2) iPSC-2: CDG.1121_Sia74
Institution	National Institutes of Health (NIH), National Human Genome Research Institute (NHGRI)
Contact information of distributor	May Christine V. Malicdan, MD, PhD; maychristine.malicdan@nih.gov
Type of cell lines	iPSC
Origin	Human
Additional origin info required	iPSC-1: 4-year-old male of Caucasian/Finnish ancestry iPSC-2: 16-month-old female of Hispanic/Dominican ancestry
Cell Source	Patient-derived fibroblasts
Clonality	Clonal
Method of reprogramming	Episomal vectors
Genetic Modification	Yes
Type of Genetic Modification	Spontaneous mutation
Evidence of the reprogramming transgene loss (including genomic copy if applicable)	RT-PCR
Associated disease	Free sialic acid storage disorder (FSASD)
Gene/locus	SLC17A5 gene, 6q13
Date archived/stock date	April 2022
Cell line repository/bank	N/A
Ethical approval	iPSC-1: Fibroblasts were obtained from a Finnish Salla patient and curated by the Biobank Unit of the Finnish Institute for Health and Welfare (THL), Helsinki, Finland, and approved by the THL Institutional Review Board. The fibroblasts were transferred to NIH under a Material Transfer Agreement. iPSC-2: This patient was enrolled on protocol 14-HG-0071 (ClinicalTrials.gov Identifier: NCT02089789) “Clinical and Basic Investigations into Known and Suspected Congenital Disorders of Glycosylation” approved by the NHGRI Institutional Review Board at the National Institutes of Health.

1. Resource utility

Disease-relevant models for studying FSASD are limited (Huizing et al., 2021). The availability of two FSASD iPSC models with different SLC17A5 mutations is valuable for investigating molecular and cellular mechanisms and serving as a platform for screening pharmacologic therapies. Prospective utility also includes differentiation into specialized cell types and organoids.

2. Resource details

Free sialic acid storage disorder (FSASD; MIM#604369 and #269920) is a rare autosomal recessive, neurodegenerative, multi-system disorder caused by biallelic mutations in the SLC17A5 gene (MIM#604322), encoding the lysosomal transmembrane exporter, SLC17A5 (sialin) (Huizing et al., 2021; Verheijen et al., 1999). Sialin, a 12-transmembrane domain lysosomal, proton-coupled cotransporter, exports sialic acid and other acidic hexoses from the lysosomal compartment into the cytosol. Defective sialin results in abnormal accumulation of free sialic acid within lysosomes (Huizing et al., 2021; Zielonka et al., 2019). Since its initial characterization, FSASD has been classified into three entities based on clinical severity: infantile free sialic acid storage disease (ISSD or severe FSASD); intermediate severe Salla disease (intermediate FSASD); and the mildest form, Salla disease (mild FSASD) (Adams and Wasserstein, 2003; Barmherzig et al., 2017). Severe FSASD patients present at birth with severe developmental delay, coarse facial features, hepatosplenomegaly and cardiomegaly; they succumb to death in early childhood. On the mild end of the spectrum, patients have a normal appearance at birth, followed by slowly progressive neurologic deterioration resulting in mild-to-moderate psychomotor delays, spasticity, athetosis, and epileptic seizures. Worldwide, 246 individuals with FSASD have been reported with biallelic SLC17A5 variants; 185 (75 %) carry the Finnish founder missense variant, c.115C > T; p.Arg39Cys (p.R39C) in the homozygous or compound heterozygous state. The type of SLC17A5 variant and the effects of SLC17A5 variants on sialic acid transport activity, sialin intracellular localization, and amount of stored free sialic acid have been directly correlated with clinical severity and survival (Adams and Wasserstein, 2003; Zielonka et al., 2019; Barmherzig et al., 2017). Skin fibroblasts and lymphoblasts/leukocytes have been used as disease models in scarcely reported FSASD studies, with some limitations (Huizing et al., 2021). The lack of disease-relevant cell and animal models for FSASD has posed challenges to the study of the pathobiology and, importantly, treatment strategies for this devastating neurodegenerative disorder.

To facilitate a cell-based platform for disease modeling and high-throughput evaluation of drug libraries, two induced pluripotent stem cell (iPSC) lines were generated from patients’ fibroblasts (Table 1) using episomal reprogramming and characterized accordingly (Table 2). These iPSC lines were verified to contain the SLC17A5 mutations present in the parental cell lines (Supplementary Fig. 1A) and had similar short tandem repeat profiling of the parental somatic cells (Supplemental STR Table), confirming cell identity. These lines displayed typical embryonic stem cell-like morphology (Fig. 1A), a normal karyotype (Fig. 1C), and tested negative for mycoplasma contamination (Supplementary Fig. 1B). Pluripotency status in these lines was established by quantifying the expression of the markers NANOG and OCT4 via qRT-PCR, relative to an iPSC control line and parental fibroblasts, demonstrating positive expression in the iPSC lines (Fig. 1B), and immunofluorescence staining for SOX2, OCT4A, NANOG, SSEA4, TRA-1–60 and TRA-1–81 (Fig. 1D). These iPSC lines have the capacity to differentiate into the three germ layers, as shown by immunostaining using two representative proteins per germ layer, i.e., PAX6 and Nestin for ectoderm, Actin and Brachyury for mesoderm, and FOXA2 and SOX17 for endoderm (Fig. 1E). Plasmids used for reprogramming were absent from the iPSC lines screened at passage 6/7 (Supplementary Fig. 1C). Free sialic acid levels are elevated in both FSASD iPSC lines (Supplementary Fig. 1D).

Table 1.

Summary of lines.

iPSC line	Sex	Age of patient at sample collection	Disease	Race/Ethnicity	SLC17A5 genotype1 (allele 1/allele 2)
iPSC-1	M	4 years	Mild FSASD (Salla disease)	Caucasian/Finnish	c.115C > T; p. Arg39Cys/c.115C > T; p. Arg39Cys
iPSC-2	F	16 months	Intermediate FSASD	Hispanic/Dominican	c.406A > G; p. Lys136Glu/c.533delC; p. Thr178Asnfs*34

Table 2.

Characterization and validation.

Classification	Test	Result	Data
Morphology	Photography (bright field)	Normal (20x images)	Fig. 1A
Phenotype	Quantitative analysis (qRT-PCR)	Positive expression of NANOG and OCT4A markers	Fig. 1B
	Qualitative analysis (IF)	Expression of pluripotency markers: SOX2, OCT4A, NANOG, SSEA4, TRA-1–60, and TRA-1–81	Fig. 1D
Genotype	Karyotype (DAPI banding)	Normal	Fig. 1C
Differentiation potential	Trilineage formation	Ectoderm: PAX6, NES Mesoderm: ACTA2, TBXT Endoderm: FOXA2, SOX17	Fig. 1E
Mutation analysis	Sanger sequencing	Genotyping correctly identified biallelic SLC17A5 (NM_012434) mutations in each cell line	Supplementary Fig. 1A
Microbiology and virology	Mycoplasma	Negative	Supplementary Fig. 1B
Transgene clearance	PCR	iPSC lines are negative for integration of plasmids	Supplementary Fig. 1C
Free sialic acid quantification	Quantification of free sialic acid levels via UPLC-MS/MS	Elevated in both FSASD iPSC lines compared to control group	Supplementary Fig. 1D
Identity	STR analysis	15 loci tested, matched between parental and iPSC lines	Supplemental STR Table
Donor screening	HIV 1 + 2 Hepatitis B, Hepatitis C	N/A	N/A
Genotype additional	Blood group genotyping	N/A	N/A
info	HLA tissue typing	N/A	N/A

Fig. 1.

Characterization of two FSASD iPSC lines (iPSC-1, iPSC-2).

3. Materials and methods

3.1. Generation and culturing of iPSC lines

Patient-derived fibroblasts were reprogrammed and clonally selected using episomal plasmids to induce ectopic expression of OCT4, SOX2, KLF4, L-MYC and Lin28 genes (ALSTEM, Inc.). Cells were passaged with Accutase (Stemcell Technologies, cat#07920) and plated on Matrigel (Corning, cat#354277)-coated plates in mTeSR^™1 basal media (Stemcell Technologies, cat#85850) containing Y-27632 (Stemcell Technologies, cat#72302). The plates were incubated at 37 °C/5% CO₂.

3.2. Expression of pluripotent markers

The expression of endogenous pluripotency markers was examined via qRT-PCR and indirect immunofluorescence (IF).

For qRT-PCR, total RNA was isolated from iPSCs (passage 6 for iPSC-1 and passage 7 for iPSC-2) using the RNeasy mini kit (Qiagen, cat#74106) and transcribed into cDNA (High-Capacity RNA-to-cDNA^™ kit; Applied Biosystems, cat#4388950). qRT-PCR was performed using the Taqman Fast Advanced Master Mix (cat#4444557) and Taqman gene expression assays for NANOG (Hs02387400_g1), POU5F1/OCT4 (Hs04260367_gH), and GAPDH (Hs02786624_g1). Analyses were based on the delta Ct method with GAPDH as an internal control.

For the IF studies, iPSCs (passage 6) were fixed with 4% (v/v) paraformaldehyde (Electron Microscopy Sciences, cat#15710) for 10 min, permeabilized on ice with 0.1% Triton X-100 for 10 min, blocked for 1 hr at room temperature in a solution containing 1% (v/v) donkey serum (Equitech-Bio, cat#SD30), 0.1% (v/v) saponin and 0.075% (w/v) glycine, and incubated with primary antibodies (Table 3) overnight at 4°C in 0.1% (v/v) BSA and 0.1% (v/v) saponin solution. After PBS washes, cells were incubated with secondary antibodies (Table 3) for 1 hr at room temperature, washed and stained with 300nM DAPI (Invitrogen, cat#MP01306) for 5–10 min at room temperature. Confocal images were captured on a Zeiss LSM 880 microscope and Z-stack images were processed on ZEN2.1 SP3. The Z-stack images were collapsed (Extended Depth of Focus) with the ZEN2.3 system.

Table 3.

Details of reagents used in this study.

	Antibodies used for immunocytochemistry
	Antibody	Dilution	Company Cat#	RRID
Pluripotency markers (IF)	Rabbit anti- SOX2	1:200	Cell Signaling, cat#3579	AB_2195767
	Rabbit anti-OCT4A	1:200	Cell Signaling, cat#2840	AB_2167691
	Rabbit anti-NANOG	1:200	Cell Signaling, cat#4903	AB_10559205
	Mouse anti-SSEA4	1:200	Cell Signaling, cat#4755	AB_1264259
	Mouse anti-TRA-1–60(S)	1:200	Cell Signaling, cat#4746	AB_2119059
	Mouse anti-TRA-1–81	1:200	Cell Signaling, cat#4745	AB_2119060
Differentiation markers (IF)	Rabbit anti-PAX6	1:100	Biolegend, cat#901301	AB_2565003
	Mouse anti-Nestin (NES)	1:250	Stemcell Technologies, cat#60091	AB_2650581
	Rabbit anti-α-smooth muscle actin (ACTA2)	1:100	Abcam, cat#ab5694	AB_2223021
	Goat anti-Brachyury (TBXT)	1:20	R&D Systems, cat#AF2085	AB_2200235
	Mouse anti-FOXA2	1:1000	Novus Biologicals, cat#H00003170-M12	AB_669213
	Goat anti-SOX17	1:20	R&D Systems, cat#AF1924	AB_355060
Secondary antibodies (IF)	Donkey anti-Mouse IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488	1:500	Invitrogen, cat#A-21202	AB_141607
	Donkey anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 555	1:500	Invitrogen, cat#A-31572	AB_162543
	Donkey anti-Goat IgG (H + L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488	1:500	Invitrogen, cat#A-11055	AB_2534102
	Donkey anti-Mouse IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 555	1:500	Invitrogen, cat#A-31570	AB_2536180
	Primers
	Target	Size of band	Forward/Reverse primer (5′−3′)
Transgene clearance	OCT4	124 bp	CATTCAAACTGAGGTAAGGG/TAGCGTAAAAGGAGCAACATAG
	KLF4	156 bp	CCACCTCGCCTTACACATGAAGA/TAGCGTAAAAGGAGCAACATAG
	SOX2	111 bp	TTCACATGTCCCAGCACTACCAGA/TTTGTTTGACAGGAGCGACAAT
	L-MYC	122 bp	GGCTGAGAAGAGGATGGCTAC/TTTGTTTGACAGGAGCGACAAT
	Lin28	251 bp	AGCCATATGGTAGCCTCATGTCCGC/
			TAGCGTAAAAGGAGCAACATAG
	EBNA-1	130 bp	GGGTGATAACCATGGACGAGG/ACTTGGACGTTTTTGGGGTCT
House-keeping gene (RT-PCR)	GAPDH	127 bp	CTGAGCTCATTTCCTGGTATGA/CTTCCTCTTGTGCTCTTGCTG
Targeted mutation analysis of	0c.115C > T; p.Arg39Cys	510 bp	ATGGTGGCCAATGCCTATAA/CCAATCAGTTCCTGGGAAAA
SLC17A5	0c.406A > G; p.Lys136Glu	572 bp	GTTTGCATGTTCTTCAGTCCAA/AATTTCGGGGTGCTCCTACT
	0c.533delC; p.Thr178Asnfs*34	523 bp	TCCATGAATCTTTGGGGAGT/CAACATTGCATCGTTCTGGT

3.3. Karyotyping

The iPSC lines were treated with KaryoMAX^™ Colcemid^™ Solution in PBS (ThermoFisher Scientific, cat#15212012) and fixed in Carnoy’s fixative (3:1, methanol: acetic acid) and cell spreads were prepared by dropping cell suspensions onto slides for DAPI banding analysis. 20 cells were analyzed for iPSC-1 and 25 cells were examined for iPSC-2.

3.4. Trilineage differentiation

STEMDiff^™ Trilineage Differentiation Kit (Stemcell Technologies, cat#05230) was used per the manufacturer’s instructions and markers specified in Table 3 were detected using immunofluorescence.

3.5. Mutational analysis

Genomic DNA was extracted using the Wizard^® Genomic DNA Purification Kit (Promega, cat#A1120), amplified as detailed (Table 3), and Sanger sequenced (Psomagen, Inc.). Analysis was performed using the Sequencer software (version 5.4.6).

3.6. Short tandem repeat profiling

Cell line identity of the parental fibroblast lines and corresponding iPSCs was verified using the PowerPlex^® 16 multiplex STR system (Promega, cat#DC6531; service performed by Cell Line Genetics, Inc.). This kit detects fifteen STR loci (vWA, D8S1179, TPOX, FGA, D3S1358, TH01, D21S11, D18S51, Penta E, D5S818, D13S317, D7S820, D16S539, CSF1PO, Penta D) and a gender identification marker, Amelogenin.

3.7. Mycoplasma detection

The Universal Mycoplasma Detection Kit (ATCC, cat#30–1012K) was employed to detect mycoplasma according to the manufacturer’s procedures.

3.8. Transgene clearance

Total RNA was isolated (passage 6 for iPSC-1 and passage 7 for iPSC-2) and cDNA was transcribed as noted above in section 3.2. PCR was performed using a master mix including AmpliTaq^™ DNA Polymerase with Buffer II (Applied Biosystems, cat#N8080153), premixed dNTP solution (Biosearch Technologies, cat#D59104), and primers to detect the episomal plasmids (see Table 3 for primer sequences); GAPDH was used as an internal control. The RF2002 plasmid DNA was used as a positive control.

3.9. Free sialic acid quantification

Free sialic acid levels in whole-cell lysates containing at least 1 × 10⁶ cells were quantified as previously described (Harb et al., 2023).

Supplementary Material

Appendix A. Supplementary data

Supplementary data to this article can be found online at https://doi.org/10.1016/j.scr.2024.103600.