Abstract
Prinsepia utilis Royle (PUR) exhibits moisturizing, antioxidative, and antibacterial properties, supporting skin barrier integrity. Nevertheless, the molecular mechanisms underlying these effects remain unclear. This study investigates the role of polysaccharide from PUR (PUR-P) in keratinocyte differentiation, lipid metabolism, tight junction, and skin barrier repair, focusing on PPARα involvement. Cytotoxicity of PUR-P in keratinocytes was assessed using CCK-8, EdU staining, and flow cytometry. Marker expression associated with differentiation (K1 and K10), proliferation (K16 and K17), sebum synthesis (CERS3, FAS and HMGCS2), and tight junction (ZO-1, Occludin and Claudin-1) were measured via western blot and qRT-PCR. The FulKutis skin model was used to assess the effects of PUR-P and PPARα on the skin barrier. PUR-P induced cytotoxicity in keratinocytes above 10 mg/mL (48 h) and 5 mg/mL (72 h). At 10 mg/mL, PUR-P upregulated K1, K10, CERS3, FAS, ZO-1, Occludin, Claudin-1, PPARα, and PPARβ/δ at both mRNA and protein levels. These effects were mediated by PPARα, as inhibition by Norathyriol or PPARα shRNA lentiviruses reduced PUR-P’s efficacy. In the FulKutis skin model, PUR-P mitigated sodium lauryl sulfate-induced stratum corneum damage, restoring transepithelial electrical resistance, reducing FITC-Dextran permeability, and improving protein expression levels, effects dependent on PPARα. PUR-P enhances skin barrier integrity by promoting keratinocyte differentiation, lipid metabolism, and tight junctions, which is associated with PPARα up-regulated K1, K10, K16, K17, CERS3, FAS, HMGCS2, ZO-1, Occludin, Claudin-1, FLG, INV, and LOR expression. These findings underscore the potential of PUR-P as a therapeutic agent for skin barrier-related disorders.
Supplementary Information
The online version contains supplementary material available at 10.1038/s41598-025-01960-w.
Keywords: Prinsepia utilis Royle, Polysaccharide, Skin barrier, Differentiation, Lipid metabolism, Peroxisome proliferator activated receptor
Introduction
The skin serves as a life-sustaining barrier between the organism and the environment, fulfilling critical protective and defensive functions. This barrier prevents the trans-epidermal water loss (TEWL), electrolytes, and other nutrients while effectively blocking the penetration of external harmful substances1. Structurally, the stratum corneum, the skin’s outermost layer, is often metaphorically described as comprising bricks (keratinocytes), mortar (lipid substances between keratinocytes), and rebar (desmosomes and tight junctions connecting keratinocytes)1,2. Abnormalities and dysfunctions of the skin barrier structure are key mechanisms in the pathogenesis of many dermatologic diseases, including psoriasis3, atopic dermatitis (AD)4, acne5, and autoimmune blistering diseases6. Consequently, advancing therapeutics that target keratinocyte differentiation, lipid metabolism, and tight junctions remains essential for treating diseases associated with skin barrier damage.
Among emerging therapeutic agents, Prinsepia utilis Royle (PUR), a rare perennial woody oilseed plant of the Prinsepia genus in the Rosaceae family, has garnered significant attention7–9. PUR has demonstrated a wide range of pharmacological properties, including antibacterial, immunosuppressive, antioxidant, hypoglycemic, hypotensive, anti-inflammatory, anti-tumor, anti-osteoporosis, and anti-arthritic properties7–9. Of particular relevance to skin health, PUR oil has been extensively studied for its high content of bioactive fatty acids, such as oleic, linoleic, palmitic, and linolenic acids, drawing comparisons with Mediterranean olive oil10. Moreover, PUR oil has demonstrated efficacy in improving inflammatory responses and enhancing skin barrier function in an animal model of allergic contact dermatitis (ACD)11. Beyond its oil fraction, PUR is also rich in polysaccharides, which are increasingly recognized for their role in skin health. Plant-derived polysaccharides exhibit protective effects on skin barrier integrity12,13. Recent studies have highlighted the bioactivity of PUR-derived polysaccharides (PUR-P) in other systems, such as their protective effects on the myocardium in diabetic mice14 and their immunomodulatory activities on erythrocytes and peripheral blood lymphocytes15. Despite these findings, the potential impact of PUR-P on skin barrier function remains unexplored, particularly in comparison to existing therapies targeting skin barrier repair. Unlike synthetic agents or commonly used plant extracts, PUR-P offers a unique combination of bioactivity and low toxicity, which may position it as a promising therapeutic candidate for skin barrier-related disorders.
Peroxisome proliferator-activated receptors (PPARs) belong to the orphan receptor of the nuclear receptor superfamily and are involved in regulating lipid, glucose, and amino acid metabolism, containing three isoforms: PPARα, PPARβ/δ, and PPARγ16–19. All PPAR isoforms are expressed in the human epidermis and regulate inflammation, epidermal differentiation, barrier function and epidermal proliferation during skin homeostasis16–19. Differently, PPARα affects skin ontogenesis, whereas PPARβ/δ and PPARγ have no role or have not been explored19. In addition, it has been shown that activation of PPARα and PPARγ is associated with melanocyte proliferation, pigmentation, and sebaceous gland homeostasis, whereas PPARβ/δ do not appear to have a role17,18. Therefore, the development of PPARs-related agonists is essential for skin homeostasis and the treatment of skin barrier-related diseases.
This study aims to evaluate the effects of PUR-P on the expression of PPARs and keratinocyte differentiation, lipid metabolism and tight junctions in vitro. Additionally, the FulKutis reconstructed human full thickness skin model will be employed to investigate the role of PUR-P in repairing skin barrier damage. By elucidating the molecular mechanisms underlying PUR-P's activity, this work seeks to provide an experimental and therapeutic basis for its application in treating diseases associated with skin barrier damage, potentially offering advantages over existing treatments.
Materials and methods
Primary culture of human keratinocytes and human fibroblasts
Residual skin tissue obtained from circumcision in healthy children. Subjects and guardians agreed to the study and signed an informed consent form, and the study was approved by the Ethics Committee of the First Affiliated Hospital of Kunming Medical University (2020-L-29). The research adhered to the Declaration of Helsinki. Human keratinocytes and fibroblasts were isolated as previously described20,21. Briefly, circumcised skin tissue was digested with 0.5 mg/ml thermolysin (HY-P1748, MCE, USA) for 18 h to separate the epidermis and the dermis. The epidermis was further treated with 0.25% Typsin-EDTA for 25 min to isolate keratinocytes, which were cultured in Keratinocyte Medium (KM) (2101, Sciencell, USA) supplemented with keratinocyte growth supplement (2152, Sciencell) and penicillin–streptomycin (15140148, Gibco). The dermis was further digested with 0.125 U/ml Type H collagenase (11074032001, Merck, USA) for 3 h, and fibroblasts were cultured in DMEM/F12 (12,634,028, Gibco, USA). Cells were passaged until P5 for identification using immunofluorescence. Keratinocytes were identified using Pan-Cytokeratin antibody, while fibroblasts were identified using Vimentin and K15 antibodies. Details of the antibodies are provided in Supplementary Table 1.
Isolation of PUR-P
PUR was collected in Lijiang, Yunnan Province, China, and identified by Prof. Yun-Heng Ji from the Kunming Institute of Botany. A voucher specimen (No. HY20210502) is deposited in the Sate Key Laboratory of Phytochemistry and Plant Resources in West China. Deoiled PUR powder underwent 95% EtOH for 3 h to remove low-molecular-weight molecules. The extract was filtered and subjected to extraction with deionized water at 90 °C for three cycles of 2 h. The combined extract was concentrated under reduced pressure and precipitated with 95% ethanol at 4 °C overnight. Proteins were removed using the Sevage method, the supernatant was collected by centrifugation. PUR-P was obtained through freeze-drying, with a concentration of 32.2%, as determined by absorbance at 582 nm using a Multiskan SkyHigh microplate reader (A51119600C, Thermo Scientific, USA). D-glucose served as the standard. As we previously described22, the molecular weight of PUR-P ranges from 436–203,280 Da. The monosaccharide composition and ratio of PUR-P was 49.33% glucose, 14.69% arabinose, 13.30% galacturonic acid, 10.19% galactose, 4.91% xylose, 3.69% rhamnose, 2.2% mannose, 1.23% glucuronic acid and 0.47% fucose.
Proliferation and apoptosis assays of keratinocytes
Keratinocytes were treated PUR-P at concentrations of 0–120 mg/mL for 24, 48 and 72 h. Cell viability and proliferation were assessed using the Super-Enhanced Cell Counting Kit-8 (C0048XL, Beyotime, China) and the BeyoClick EdU-488 Kit (C0071S, Beyotime, China), respectively. Absorbance for the CCK-8 assay and image collection of Edu staining were done using a Multiskan SkyHigh microplate reader and a BX53-LED fluorescence microscope (Olympus, Japan), respectively. Apoptosis was evaluated using the eBioscience Annexin V Kit (88–8005-74, Invitrogen, USA) and analyzed on an Attune NxT flow cytometer (A24858, Invitrogen, USA).
Infection and treatment of keratinocytes
The design of hairpin RNA (shRNA) targeting PPARα, construction of PGMLV-SB3 RNAi recombinant plasmid, and lentiviral packaging were performed by genomeditech (Shanghai, China). The shRNA sequences against PPARα were TTCTCCGAACGTGTCACGT (sh-NC), TTTACGGAATACCAGTATTTA (sh-PPARα_1), CAAGGCCTCAGGCTATCATTA (sh-PPARα_2), and TGAAGAGTTCCTGCAAGAAAT (sh-PPARα_3). The oligo sequences of all shRNAs are displayed in Supplementary Table 2. The lentiviral titers of sh-PPARα_1, sh-PPARα_2, and sh-PPARα_3 were 5.96 × 108, 5.66 × 108, and 7.63 × 108 TU/ml, respectively.
Keratinocytes were randomized into six groups: CTRL, Solvent, PUR-P, Norathyriol, KD-NC and KD-PPARα. The KD-NC and KD-PPARα groups were infected with sh-NC and sh-PPARα_1 lentivirus using the HitransG P (REVG005, Genechem, China) for 48 h. The Norathyriol group were treated with 100 μM Norathyriol, a PPARα antagonist (HY-N1029, MCE, USA)23 for 24 h. Subsequently, the PUR-P, Norathyriol, KD-NC, and KD-PPARα groups were treated with 10 mg/ml PUR-P for 48 and 72 h. The Solvent group were treated with equal volumes of sterile water.
FulKutis reconstructed human full thickness skin model
The construction of FulKutis Reconstructed Human Full Thickness Skin Model (FulKutis skin model) was entrusted to Biocell Biotechnology (Guangdong, China). The FulKutis skin model has a complete the epidermis containing the stratum corneum, stratum granulosum, stratum spinosum and stratum basale as well as the dermis. The original FulKutis skin model was bubble-free, non-shrinking, non-wet, and the cells had an OD570 nm ≥ 0.7 and SD < 18%.
The FulKutis skin model was randomized into seven groups: CTRL, Solvent, SLS, PUR-P, Norathyriol, KD-NC and KD-PPARα. The KD-NC and KD-PPARα groups were constructed with keratinocytes infected with sh-NC and sh-PPARα lentivirus, and the remaining FulKutis skin models were constructed with normal keratinocytes. The SLS, PUR-P, Norathyriol, KD-NC, and KD-PPARα groups were all injured with sodium lauryl sulfate (SLS), and the PUR-P, Norathyriol, KD-NC, and KD-PPARα groups were all treated with 10 mg/ml PUR-P for 72 h. Subsequently, the Norathyriol group was treated with Norathyriol.
Protein and mRNA expression assays for markers
Protein and RNA extraction from keratinocytes was performed using RIPA lysate (ab156034, Abcam, USA) and TRIZOL lysate (GK20008, Glpbio, USA), respectively. The concentrations of protein and RNA were determined using a Multiskan SkyHigh microplate reader. Total protein samples from each group were subjected to SDS-PAGE electrophoresis for the detection of target proteins. Representative images of the gel blot were collected using a gel imager (5200 Multi, Tanon, China). Antibody information for the target proteins is provided in Supplementary Table 1, including K1, K10, K16, K17, FLG, INV, LOR, CERS3, FAS, HMGCS2, PPARα, PPARβ/δ, PPARγ, ZO-1, Occludin, and Claudin-1. Total RNA samples from each group were assayed for target mRNA expression using Taq Pro Universal SYBR qPCR Master Mix Kit (Q712-02, Vazyme, China) and FastKing RT Kit (4,992,250, Tiangen, Germany). A 7500 Fast real-time fluorescent quantitative PCR system (4,351,107, Applied Biosystems, USA) was used to identify the Ct value of the target mRNA. The primer sequences for the target are listed in Supplementary Table 3. The internal reference for the target is β-actin.
Statistical analysis
Data were analyzed and visualized using GraphPad Prism software v.8.3.0 (GraphPad, USA) and represent at least three experimental replicates. The student t-test or Mann–Whitney test was applied for CCK-8 assay, Edu staining, and flow cytometry, while one-way ANOVA with Tukey’s multiple comparisons test or Kruskal–Wallis with Dunn’s multiple comparisons test were used for Western blot assay, qRT-PCR assay, and IF staining. Statistical significance was defined as P < 0.05.
Results
Effect of PUR-P on proliferation and apoptosis of keratinocytes
To evaluate the potential of PUR-P for repairing skin barrier damage, this study investigated its effects on keratinocyte proliferation and apoptosis. As indicated in Fig. 1A, the isolated cells exhibited Pan-Cytokeratin positivity, indicating that human-derived keratinocytes were successfully isolated in this study. CCK-8 assay revealed that PUR-P treatment at concentrations of 0–20 mg/ml for 24 h, 0–10 mg/ml for 48 h, and 0–5 mg/ml for 72 h did not significant impact keratinocyte viability (Fig. 1B). Concentrations exceeding these thresholds reduced keratinocyte proliferation. Edu staining further confirmed that greater than 10 mg/ml PUR-P treatment for 48 h and 5 mg/ml PUR-P treatment for 72 h significantly reduced the percentage of Edu-positive keratinocytes (Fig. 1C). Flow cytometry revealed that PUR-P treatment at concentrations of 0–10 mg/ml for 48 h and 0–5 mg/ml for 72 h had no significant effect on keratinocyte apoptosis; however, higher concentrations and prolonged exposure led to increased apoptosis (Fig. 1D). These results suggest that excessive PUR-P concentrations exhibit cytotoxicity toward keratinocytes, with 10 mg/ml identified as most appropriate condition for clinical application.
Fig. 1.
Effect of Polysaccharide from Prinsepia utilis Royle (PUR-P) on proliferation and apoptosis of keratinocytes. (A) Immunofluorescence (IF) staining characterized the proportion of positive Pan-cytokeratin in human-derived keratinocytes. Scale: 50 μm. (B) CCK-8 assay analyzed the effect of PUR-P with different concentrations on the activity of the keratinocytes. Black, red, and yellow lines represent PUR-P treatment for 24 h, 48 h and 72 h, respectively. (C) Representative pictures of Edu staining for keratinocytes at different time points (48 and 72 h) after treatment with different concentrations of PUR-P (0, 2, 5, 10 and 20 mg/ml). (D) After treatment with different concentrations of PUR-P (0, 0.5, 1, 2, 5, 10, and 20 mg/ml), the apoptotic percentage of keratinocytes at 48 and 72 h was characterized using flow cytometry. N = 3; Two-way ANOVA test with Tukey’s multiple comparisons test; Statistical significance was defined as P < 0.05.
PUR-P facilitates keratinocyte differentiation, lipid metabolism and tight junction
Keratinocyte differentiation, lipid metabolism, and tight junctions are essential for maintaining skin moisture and barrier integrity. This study assessed the effect of 10 mg/ml PUR-P on these phenotypes. Compared to the CTRL group, the solvent treatment did not affect the expression of DRPs (K1 and K10), PRPs (K16 and K17), SSRPs (CERS3, FAS, and HMGCS2), TJRPs (ZO-1, Occludin, and Claudin-1), CEPs (FLG, INV, and LOR), and PPRPs (PPARα, PPARβ/δ, and PPARγ). PUR-P treatment increased the expression of K1 and K10, and decreased the expression of K16 and K17, particularly at 72 h (Fig. 2A). Ceramide (Cer), free fatty acids (FFA) and cholesterol (CHOL) are the main sebum substances synthesized by keratinocytes, and are essential for maintaining the skin barrier. As indicated in Fig. 2B, PUR-P treatment enhanced CERS3 expression at 48 h and both CERS3 and FAS at 72 h, with no effect on HMGCS2 expression. As expected, the expression of ZO-1, Occludin and Claudin-1 were significantly upregulated by PUR-P (Fig. 2C). PUR-P upregulated the expression of FLG, INV and LOR in keratinocytes, especially at 72 h (Fig. 2D). The three isoforms of PPAR, PPARα, PPARβ/δ, and PPARγ, have been well documented to regulate keratinocyte differentiation, lipid metabolism, and tight junctions, as well as skin barrier integrity18,24. As presented in Fig. 2E, PUR-P also enhanced the expression of PPARα and PPARβ/δ in keratinocytes, though not PPARγ. At the mRNA level, PUR-P also increased the expression of K1, K10, CERS3, FAS, ZO-1, PPARα and PPARβ/δ (Fig. 3A–D). These findings suggest that PUR-P facilitates keratinocyte differentiation, lipid metabolism and tight junctions.
Fig. 2.
PUR-P contributes to the expression of proteins related to differentiation, lipid metabolism and tight junctions in keratinocytes. (A–E) After 48 and 72 h of treatment with 10 mg/ml PUR-P, the expression of differentiation-associated (K1 and K10; A), proliferation-associated (K16 and K17; A), sebum-synthesis-associated (CERS3, FAS, and HMGCS2; B), tight junction-associated (ZO-1, Occludin, and Claudin-1; C), cornified envelope-associated (FLG, INV, and LOR; D), and PPAR-associated (PPARα, PPARβ/δ, and PPARγ; E) proteins were identified using western blot assay. The original gel blot is shown in the Supplementary Information file. DRPs: keratinocyte differentiation-related proteins; PRPs: keratinocyte proliferation-related proteins; SSRPs: sebum synthesis-related proteins; TJRPs: tight junction-related proteins; CEPs: cornified envelope-related proteins; PPRPs: PPAR-related proteins. N = 3; One-way ANOVA test with Tukey’s multiple comparisons test or Kruskal–Wallis test with Dunn’s multiple comparisons test; Statistical significance was defined as P < 0.05.
Fig. 3.
PUR-P facilitates the expression of mRNAs related to differentiation, lipid metabolism and tight junctions in keratinocytes. (A–D) PUR-P promotes the expression of differentiation-associated (K1 and K10; A), sebum synthesis-associated (CERS3 and FAS; B), tight junction-associated (ZO-1; C), and PPAR-associated (PPARα and PPARβ/δ; D) mRNAs in keratinocytes. DRPs: keratinocyte differentiation-related proteins; PRPs: keratinocyte proliferation-related proteins; SSRPs: sebum synthesis-related proteins; TJRPs: tight junction-related proteins; PPRPs: PPAR-related proteins. N = 3; One-way ANOVA test with Tukey’s multiple comparisons test or Kruskal–Wallis test with Dunn’s multiple comparisons test; Statistical significance was defined as P < 0.05.
PPARα is a target of PUR-P-mediated differentiation, lipid metabolism and tight junction in keratinocytes
Given the marked upregulation of PPARα by PUR-P, this study further addressed whether PPARα is a target for PUR-P in keratinocytes. As displayed in Fig. 4A–B, three PPARα shRNA lentivirus were effective in limiting the expression of PPARα protein and mRNA in keratinocytes. LV-PPARα_1 was selected for follow-up experiments. Notably, both shRNA lentivirus and Norathyriol (PPARα antagonist) was applied to inhibit PPARα expression in keratinocytes. As expected, Norathyriol and shRNA lentivirus were effective in mitigating PUR-P-induced upregulation of PPARα protein and mRNA (Fig. 4C,D). Compared with the treatment of PUR-P, Norathyriol down-regulated the expression of DRPs (K1 and K10; Fig. 5A), SSRPs (CERS3 and FAS; Fig. 5B), CEPs (FLG and LOR; Fig. 5C), and TJRPs (ZO-1; Fig. 5D). Similarly, compared to the LV-NC group, PPARα shRNA lentivirus reduced these protein and mRNA levels (Fig. 5A–D). Notably, both Norathyriol and PPARα shRNA lentivirus had no significant effect on the expression of INV protein and mRNA. These findings suggest that restriction of PPARα expression alleviates the promotional effects of PUR-P on keratinocyte differentiation, lipid metabolism, and tight junctions.
Fig. 4.
Norathyriol and PPARα shRNA lentivirus alleviate PUR-P-induced upregulation of PPARα expression. (A,B) Western blot (A) and qRT-PCR (B) assays characterized the effect of shRNA lentivirus on the expression of PPARα protein and mRNA in keratinocytes. (C,D) Representative images of PPARα gel blot (C) and PPARα mRNA expression in different groups (D). PUR-P facilitates the expression of PPARα protein and mRNA in keratinocytes, and this is limited by Norathyriol (PPARα antagonist) and PPARα shRNA lentivirus. The original gel blot is shown in the Supplementary Information file. N = 3; One-way ANOVA test with Tukey’s multiple comparisons test; Statistical significance was defined as P < 0.05.
Fig. 5.
Norathyriol and PPARα shRNA lentiviral restricted promotion effects of PUR-P on keratinocyte differentiation, lipid metabolism and tight junctions. (A–D) Western blot and qRT-PCR assays characterized the effects of Norathyriol (PPARα antagonist) and PPARα shRNA lentivirus on the expression of differentiation-associated (K1 and K10; A), sebum-synthesis-associated (CERS3 and FAS; B), cornified envelope-associated (FLG, INV, and LOR; C) and tight junction-associated (ZO-1; D) proteins and mRNA. The original gel blot is shown in the Supplementary Information file. DRPs: keratinocyte differentiation-related proteins; SSRPs: sebum synthesis-related proteins; CEPs: cornified envelope-related proteins; TJRPs: tight junction-related proteins. N = 3; One-way ANOVA test with Tukey’s multiple comparisons test or Kruskal–Wallis test with Dunn’s multiple comparisons test; Statistical significance was defined as P < 0.05.
PUR-P repairs SLS-induced skin barrier damage in FulKutis model by modulating PPARα
To more clearly characterize the effect of PUR-P on the maintenance of skin barrier integrity, fibroblasts were isolated and used to construct the FulKutis model. As demonstrated in Fig. 6A, the isolated cells exhibited K15-negativity and Vimentin-positivity, indicating that human-derived fibroblasts were successfully isolated. Notably, the application of SLS resulted in the near disappearance of the stratum corneum in the FulKutis model, which was mitigated by PUR-P treatment (Fig. 6B). However, both Norathyriol and PPARα shRNA lentivirus alleviated the protective effects of PUR-P (Fig. 6B). Permeability assays showed that PUR-P limited the SLS-induced reduction in TEER and increase in FITC-Dextran permeability of the FulKutis model (Fig. 6C,D). As expected, treatment with Norathyriol and LV-PPARα alleviated the functions of PUR-P (Fig. 6C,D). This study further explored the effect of PUR-P, SLS and PPARα shRNA lentivirus on the expression of DRPs, SSRPs, CEPs and TJRPs in FulKutis model. SLS downregulated the expression of K1, K10, CERS3, FAS, FLG, INV, LOR, and ZO-1 in FulKutis model (Fig. 7A–D). Moreover, PUR-P alleviated the SLS-induced downregulation of these proteins in the FulKutis model, which was limited by Norathyriol and PPARα shRNA lentivirus. These findings suggest that PUR-P alleviates SLS-induced skin barrier damage by upregulating PPARα in the FulKutis model.
Fig. 6.
PUR-P alleviates sodium lauryl sulfate (SLS)-induced skin barrier damage in the FulKutis model. Fulkutis is a two-layer skin model constructed with fibroblasts and keratinocytes as seed cells. The FulKutis model was used to evaluate the effect of PUR-P on SLS-induced skin damage. (A) Immunofluorescence staining was used to detect and localize the expression of a negative marker (K15) and a positive marker (Vimentin) in human-derived fibroblasts. Scale: 50 μm. (B) HE staining was used to observe the structural integrity of the FulKutis model in each group. Representative images of FulKutis model from CTRL, SLS, PUP-R, Norathyriol, KD-NC and KD-PPARα groups. Scale: 50 μm. C-D: TEER (C) and FITC-Dextran permeability (D) of FulKutis model in each group were measured using RE1600 epithelial cell voltage-resistance meter and Multiskan SkyHigh microplate reader, respectively, to evaluate the therapeutic effect of PUR-P on SLS-induced skin barrier damage. Ep, De, SC, SG, SS and SB indicate epidermis, dermis, stratum corneum, stratum granulosum, stratum spinosum, and stratum basale, respectively. N = 3; One-way ANOVA test with Tukey’s multiple comparisons test; Statistical significance was defined as P < 0.05.
Fig. 7.
PUR-P facilitates the expression of proteins related to differentiation, lipid metabolism and tight junctions by regulating PPARα in the FulKutis model. (A,B) The expression of differentiation-associated (K1 and K10; A), sebum-synthesis-associated (CERS3 and FAS; B), cornified envelope-associated (FLG, INV, and LOR; C), and tight junction-associated (ZO-1; D) proteins were identified using western blot assay in the FulKutis model. The original gel blot is shown in the Supplementary Information file. DRPs: keratinocyte differentiation-related proteins; SSRPs: sebum synthesis-related proteins; CEPs: cornified envelope-related proteins; TJRPs: tight junction-related proteins. N = 3; One-way ANOVA test with Tukey’s multiple comparisons test; Statistical significance was defined as P < 0.05.
Discussion
This study investigated the effects of PUR-P on keratinocyte differentiation, lipid metabolism and tight junctions and its underlying molecular mechanisms, to characterize its function in the skin barrier. In the toxicity assessment, excessive PUR-P concentrations and excessive treatment times were found to be toxic to keratinocytes. The mechanism is manifested by a decrease in keratinocyte viability and Edu-positive percentage and an increase in apoptosis levels. Therefore, screening for appropriate concentration and duration of PUR-P treatment is an effective strategy to address its toxicity. The toxicity thresholds for PUR-P were 10 mg/ml for 48 h and 5 mg/ml for 72 h. Because PUR-P is planned to be developed into a skin care product in the future, processing time is not an important indicator. Therefore, higher concentrations of PUR-P (10 mg/ml) are more suitable for clinical translation. This condition was chosen for subsequent experiments in this study.
Keratinocyte differentiation, lipid metabolism, and tight junctions are important biological processes for maintaining skin barrier integrity. Keratinocyte differentiation is a central process in the maintenance of the skin barrier, which protects the body by forming the “brick wall structure” of the stratum corneum. During differentiation, keratinocytes synthesize key products, including cornified envelope-associated (FLG, INV, and LOR) and sebum-synthesis-associated (CERS3, FAS, and HMGCS2) proteins. Keratinocytes are enveloped by an insoluble cornified layer composed of polymerized LOR, INV, and FLG, which forms foundation of the stratum corneum as a skin barrier25–27. In lipid metabolism, CERS3, FAS, and HMGCS2 are key enzymes regulating the synthesis of Cer, FAA, and CHOL, playing essential roles in water retention, inflammation inhibition, and barrier repair28–30. Moreover, tight junctions, comprising transmembrane proteins (Claudin, Occludin, and JAM family) and cytoplasmic proteins (ZO and Cingulin family), seal cellular gaps to prevent the intrusion of bacteria, antigens, and other substances, thereby maintaining the function of the skin barrier25–27,31. The present study confirmed that PUR-P effectively upregulated the expression of these proteins in keratinocytes. This finding emphasizes the multifaceted protective effect of PUR-P on the skin barrier.
The Fulkutis skin model is a two-layer skin model containing epidermal and dermal layers constructed by in vitro reconstruction technology using fibroblasts and keratinocytes. Fulkutis skin model has a highly consistent histological structure and biological function with human skin, which can realize the detection of multi-dimensional data at the gene, protein and cellular levels32,33. Compared to the traditional EpiDerm and SkinEthic skin models, Fulkutis is a full-layer skin model containing both epidermal and dermal layers, which better simulates the human skin barrier for the study of complex pathological mechanisms and drug efficacy. Therefore, this study investigated the effect of PUR-P on skin barrier integrity using Fulkutis skin model as an in vivo model. Similar to the in vitro experiments, PUR-P alleviated SLS-induced damage in the Fulkutis skin model, including improved epidermal layer structure, reduced permeability, and increased expression of skin barrier-related proteins. These findings emphasize the consistency of PUR-P efficacy in cellular experiments and 3D skin models.
Mechanistically, PPARα is a target for PUR-P to exert skin barrier protection. PPARs are ligand-activated transcription factors belonging to the nuclear receptor superfamily, comprising three isoforms: PPARα, PPARβ/δ, and PPARγ, all of which are expressed in keratinocytes34. These isoforms have been implicated in keratinocyte differentiation and the formation of tight junctions24,35–37. Furthermore, PPARα, PPARβ/δ and PPARγ can control the transport and oxidation of fatty acids and cholesterol catabolism, serving as key stabilizers of homeostasis of lipid metabolism38,39. We found that PUR-P facilitated the expression of PPARα and PPARβ/δ. Notably, the expression of several markers mirrored the temporal pattern of PPARα, with significant changes observed at 72 h post-treatment, including K16, FAS, Occludin, Claudin-1, and LOR. Additionally, PPARα was able to modulate sebaceous gland homeostasis and skin ontogenesis compared to PPARβ/δ17–19, emphasizing the congruence between PPARα and PUR-P in the multifaceted protective role for the skin barrier. Therefore, this study interfered the expression of PPARα using Norathyriol (PPARα antagonist) and PPARα shRNA lentivirus to investigate the effect of PPARα on PUR-P utility. These interventions attenuated keratinocyte differentiation, lipid metabolism, and tight junctions, as well as the protective effect of PUR-P on the FulKutis model. These findings establish PPARα as a critical mediator for beneficial effects of PUR-P on the skin barrier.
In clinical practice, ceramides-based therapy and PPARα agonists are the primary strategies for treating skin barrier related diseases. Ceramide-based therapy is commonly used to enhance skin barrier function by replenishing the lipid matrix, but their effectiveness can be limited by skin penetration and stability issues40. PPARα agonists have shown promise in improving lipid metabolism and tight junction formation, though they may come with concerns regarding systemic side effects and long-term safety41. In contrast, PUR-P offers several potential advantages over existing therapies. First, PUR-P is derived from a natural source, which may reduce concerns about synthetic chemicals or irritants. Second, PUR-P’s interaction with PPARα provides a novel mechanism of action that could complement or enhance the effects of other treatments, such as those targeting lipid metabolism or tight junctions. Additionally, PUR-P may present a cost-effective solution, especially in markets where natural extracts are preferred over synthetic compounds. Therefore, PUR-P can be clinically translated into therapeutic agents similar to ceramides-based therapy and PPARα agonists. Moreover, additives for skin care products similar to PUR oil are also one of the directions for clinical translation of PUR-P. However, animal studies are needed to evaluate the toxicity and efficacy of PUR-P before clinical trials. In conclusion, these attributes position PUR-P as a promising candidate for further development as a therapeutic agent or skincare product for treating skin barrier-related disorders.
Notably, previous studies have also highlighted the therapeutic potential of PUR in conditions involving skin barrier damage. Shen et al.11 have shown that an aqueous extract of PUR leaves, rich in polyphenols, alleviates ACD by improving the epithelial barrier, hyaluronidase activity and Th2-type allergic inflammation. Additionally, our group previously demonstrated that the water extracts from PUR oil cakes alleviated TEWL and epidermal barrier damage in a mouse model of epidermal disruption42. Unlike these studies, which focused on PUR extracts, this study emphasizes the PUR-P and its specific interaction with PPARα in promoting skin barrier repair. Furthermore, a recent study found that PUR-P alleviated skin barrier damage in an IL-4-induced cellular inflammation model and an acetone–ether-induced mouse model22. Despite differences in the experimental models, these findings are consistent with the current study, reinforcing PUR-P’s protective role in maintaining skin barrier integrity. Collectively, these studies suggest that PUR has significant potential as a therapeutic agent for skin barrier-related disorders.
Beyond the current focus on skin barrier damage, PUR-P also holds promise for treating a wider range of dermatological conditions associated with barrier dysfunction, such as eczema and psoriasis. Eczema and psoriasis are inflammatory skin disorders where impaired barrier function plays a central role in disease progression43,44. PUR-P, by promoting keratinocyte differentiation, lipid synthesis, and tight junction function, could potentially alleviate the chronic inflammation and irritation associated with these conditions. Its role in enhancing barrier integrity could help to reduce TEWL and provide relief from dryness and discomfort, which are common symptoms of eczema and psoriasis. Furthermore, PUR-P’s anti-inflammatory effects, mediated through PPARα and other pathways, may also be beneficial for treating these inflammatory conditions. Further studies could investigate combination therapies that pair PUR-P with other active ingredients, such as ceramides, to provide a synergistic effect on barrier repair and overall skin health. Moreover, the development of targeted delivery systems for PUR-P could improve its clinical efficacy. Nanoparticles, liposomes, or microneedle-based systems might enhance the penetration of PUR-P into deeper skin layers, thereby increasing its therapeutic effects for conditions that affect both the epidermis and dermis45,46.
While this study provides significant insights into the mechanisms by which PUR-P regulates skin barrier integrity, several limitations need to be addressed. For instance, it is still not sufficient to validate the action of PUR-P by cellular experiments and the FulKutis model, but it is also necessary to characterize it by animal experiments. Future studies should incorporate animal experiments to further characterize the therapeutic potential of PUR-P, particularly for diseases associated with skin barrier damage. Additionally, the current study only examined the expression of synthases in lipid metabolism, and the effects of PUR-P on changes in key lipid substances remain to be further validated, including ceramides and fatty acids. Additionally, beyond PPARα, it would be valuable to explore the potential molecular interactions of PUR-P with other signaling pathways implicated in skin barrier homeostasis. These could include the NLRP and NF-κB pathways, which regulates inflammation, immunoreaction, and skin repair, or the MAPK signaling pathway, which is involved in stress responses and cell differentiation. These pathways have been demonstrated to be involved in the repair of the skin barrier by a variety of polysaccharides47–50. Investigating these pathways may uncover broader therapeutic mechanisms through which PUR-P promotes skin barrier recovery. The interplay between PPARα and other nuclear receptors, such as LXR and PGC-1α19,51, could also provide insights into the regulation of lipid metabolism and inflammation within the skin. These limitations are necessary and valuable to be explored in the future research.
In conclusion, this study is the first to demonstrates that PUR-P contributes to skin barrier integrity through PPARα-mediated regulation of keratinocyte differentiation, lipid metabolism, and tight junctions (Fig. 8). These findings provide a solid experimental foundation for the clinical translation of PUR-P, highlighting its potential as a therapeutic agent or skincare product for treating diseases associated with skin barrier damage. Future studies should expand on these findings by exploring additional molecular targets and evaluating the clinical efficacy of PUR-P in human trials.
Fig. 8.
Molecular mechanisms of PUR-P for maintaining the skin barrier. PUR-P upregulates differentiation- related (K1 and K10), proliferation- related (K16 and K17), sebum synthesis- related (CERS3, FAS, and HMGCS2), tight junction- related (ZO-1, Occludin, and Claudin-1), and cornified envelope-related (FLG, INV, and LOR) proteins in keratinocytes through activation of the PPARα pathway, thereby enhancing the skin barrier. It was obtained from Freepik (https://www.freepik.com/free-vector/anatomical-structure-human-skin-layers-with-cross-section-labelled-parts-realistic-infographics-vector-illustration_26762467.htm#fromView=search&page=1&position=1&uuid=dc21ff73-da36-48c9-aeee-3ddafbc95021&query=skin+structure). According to Freepik’s Terms of use, the way we use it does not re-quire permission file. For more information, please see https://www.freepik.com/legal/terms-of-use.
Electronic supplementary material
Below is the link to the electronic supplementary material.
Author contributions
Y.T., L.H., and H.G. conceived and designed the experiments; Y.T., N.L., H.L., and D.S. performed the experiments; Y.T. and N.L. analyzed and interpreted the data; H.L. and D.S. contributed reagents/materials/analysis tools; Y.T. wrote original draft; N.L., H.L., D.S., L.H., and H.G. reviewed and edited draft. All authors have read and agreed to the published version of the manuscript.
Funding
This study was supported by the Yunnan Province Clinical Center for Skin Immune Diseases (YWLCYXZX2023300076) and the National Natural Science Foundation of China (81960744).
Data availability
The datasets used and/or analysed during the current study available from the corresponding author on reasonable request.
Declarations
Competing interests
The authors declare no competing interests.
Ethics approval and consent to participate
This study was approved by the Ethics Committee of the First Affiliated Hospital of Kunming Medical University (2020-L-29), and was performed in accordance with the Declaration of Helsinki. Subjects and guardians agreed to the study and signed an informed consent form.
Consent for publication
Subjects and guardians consented to the publication of this study.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Contributor Information
Li He, Email: drheli2662@126.com.
Hua Gu, Email: guhua@kmmu.edu.cn.
References
- 1.Bouwstra, J. A. et al. The skin barrier: An extraordinary interface with an exceptional lipid organization. Prog. Lipid Res.92, 101252. 10.1016/j.plipres.2023.101252 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Elias, P. M. Epidermal lipids, barrier function, and desquamation. J. Investig. Dermatol.80(1 Suppl), 44s–49s. 10.1038/jid.1983.12 (1983). [PubMed] [Google Scholar]
- 3.Orsmond, A. et al. Skin barrier dysregulation in psoriasis. Int. J. Mol. Sci.10.3390/ijms221910841 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Yang, G. et al. Skin barrier abnormalities and immune dysfunction in atopic dermatitis. Int. J. Mol. Sci.10.3390/ijms21082867 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Medgyesi, B. et al. Rosacea is characterized by a profoundly diminished skin barrier. J. Investig. Dermatol.140(10), 1938-1950.e1935. 10.1016/j.jid.2020.02.025 (2020). [DOI] [PubMed] [Google Scholar]
- 6.Stevens, N. E., Cowin, A. J. & Kopecki, Z. Skin barrier and autoimmunity-mechanisms and novel therapeutic approaches for autoimmune blistering diseases of the skin. Front. Immunol.10, 1089. 10.3389/fimmu.2019.01089 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Gupta, R. et al. Antioxidative in vitro and antiosteoporotic activities of Prinsepia utilis Royle in female rats. Eur. J. Integr. Med.7(2), 157–163. 10.1016/j.eujim.2014.10.002 (2015). [Google Scholar]
- 8.Jia, R.-Y. et al. Hypoglyceminc effect of flavonoids from Prinsepia utilis on alloxan-induced diabetic mice. J. Chin. Med. Mater.31(3), 399–403 (2008). [PubMed] [Google Scholar]
- 9.Chauhan, K. et al. Exploring the therapeutic potential of Prinsepia utilis Royle seed oil: A comprehensive study on chemical composition, physicochemical properties, anti-inflammatory, and analgesic activities. J. Ethnopharmacol.319(Pt 3), 117312. 10.1016/j.jep.2023.117312 (2024). [DOI] [PubMed] [Google Scholar]
- 10.Maikhuri, R. K. et al. Nutritional composition of seed kernel and oil of wild edible plant species from Western Himalaya, India. Int. J. Fruit Sci.21(1), 609–618. 10.1080/15538362.2021.1907009 (2021). [Google Scholar]
- 11.Shen, W. et al. Prinsepia utilis Royle leaf extract: Ameliorative effects on allergic inflammation and skin lesions in allergic contact dermatitis and polyphenolic profiling through UPLC-MS/MS coupled to chemometric analysis. J. Ethnopharmacol.305, 116093. 10.1016/j.jep.2022.116093 (2023). [DOI] [PubMed] [Google Scholar]
- 12.Campolo, M. et al. Evaluation of a product containing xyloglucan and pea protein on skin barrier permeability. Skin Pharmacol. Physiol.33(4), 231–236. 10.1159/000509372 (2020). [DOI] [PubMed] [Google Scholar]
- 13.Wang, B. et al. Elaeagnus L gum polysaccharides alleviate the impairment of barrier function in the dry skin model mice. J. Cosmet. Dermatol.20(2), 647–656. 10.1111/jocd.13541 (2021). [DOI] [PubMed] [Google Scholar]
- 14.Jia, R. et al. Effect of polysaccharide from prinsepia utilis royle on the pathological change of cardiac muscle tissue in diabetic mice. J. Soochow Univ.28(4), 4 (2008). [Google Scholar]
- 15.Wu, X. et al. Effects of prinsepia utilis polysaccharides on RBC and lymphocyte immune in chicken. J. Anhui Agric. Sci.35(31), 9937 (2008). [Google Scholar]
- 16.Walczak, K., Gerkowicz, A. & Krasowska, D. PPARs and the kynurenine pathway in melanoma-potential biological interactions. Int. J. Mol. Sci.10.3390/ijms24043114 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Briganti, S. et al. New insights into the role of PPARγ in skin physiopathology. Biomolecules10.3390/biom14060728 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Zouboulis, C. C. et al. Sebaceous immunobiology—Skin homeostasis, pathophysiology, coordination of innate immunity and inflammatory response and disease associations. Front. Immunol.13, 1029818. 10.3389/fimmu.2022.1029818 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Schmuth, M. et al. Thematic review series: Skin lipids. Peroxisome proliferator-activated receptors and liver X receptors in epidermal biology. J. Lipid Res.49(3), 499–509. 10.1194/jlr.R800001-JLR200 (2008). [DOI] [PubMed] [Google Scholar]
- 20.Ścieżyńska, A. et al. Isolation and culture of human primary keratinocytes—A methods review. Exp. Dermatol.28(2), 107–112. 10.1111/exd.13860 (2019). [DOI] [PubMed] [Google Scholar]
- 21.Sierra-sánchez, Á. et al. Comparison of two human skin cell isolation protocols and their influence on keratinocyte and fibroblast culture. Int. J. Mol. Sci.10.3390/ijms241914712 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Wang, B. et al. Prinsepia utilis Royle polysaccharides promote skin barrier repair through the Claudin family. Skin Res. Technol.30(7), e13848. 10.1111/srt.13848 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Wilkinson, A. S. et al. Effects of the mango components mangiferin and quercetin and the putative mangiferin metabolite norathyriol on the transactivation of peroxisome proliferator-activated receptor isoforms. J. Agric. Food Chem.56(9), 3037–3042. 10.1021/jf800046n (2008). [DOI] [PubMed] [Google Scholar]
- 24.Sobolev, V. V. et al. The role of transcription factor PPAR-γ in the pathogenesis of psoriasis, skin cells, and immune cells. Int. J. Mol. Sci.10.3390/ijms23179708 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Kim, Y. & Lim, K. M. Skin barrier dysfunction and filaggrin. Arch. Pharm. Res.44(1), 36–48. 10.1007/s12272-021-01305-x (2021). [DOI] [PubMed] [Google Scholar]
- 26.Yin, H., Hu, M. & Li, D. Regulation of epidermal stratification and development by basal keratinocytes. J. Cell Physiol.238(4), 742–748. 10.1002/jcp.30978 (2023). [DOI] [PubMed] [Google Scholar]
- 27.Évora, A. S. et al. Corneocytes: Relationship between structural and biomechanical properties. Skin Pharmacol. Physiol.34(3), 146–161. 10.1159/000513054 (2021). [DOI] [PubMed] [Google Scholar]
- 28.Knox, S. & O’Boyle, N. M. Skin lipids in health and disease: A review. Chem. Phys. Lipids236, 105055. 10.1016/j.chemphyslip.2021.105055 (2021). [DOI] [PubMed] [Google Scholar]
- 29.Uchida, Y. & Park, K. Ceramides in skin health and disease: An update. Am. J. Clin. Dermatol.22(6), 853–866. 10.1007/s40257-021-00619-2 (2021). [DOI] [PubMed] [Google Scholar]
- 30.Mijaljica, D. et al. The heterogeneity and complexity of skin surface lipids in human skin health and disease. Prog. Lipid Res.93, 101264. 10.1016/j.plipres.2023.101264 (2023). [DOI] [PubMed] [Google Scholar]
- 31.Yokouchi, M. & Kubo, A. Maintenance of tight junction barrier integrity in cell turnover and skin diseases. Exp. Dermatol.27(8), 876–883. 10.1111/exd.13742 (2018). [DOI] [PubMed] [Google Scholar]
- 32.Biocell Biotech. FulKutis® Reconstructed Human Full Thickness Skin Model[EB/OL]. http://www.invitrotec.com/index.php?m=content&c=index&a=show&catid=26&id=3.
- 33.Zhang, X. et al. Systematic study of resveratrol nanoliposomes transdermal delivery system for enhancing anti-aging and skin-brightening efficacy. Molecules10.3390/molecules28062738 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Shi, Y. et al. Trace elements, PPARs, and metabolic syndrome. Int. J. Mol. Sci.10.3390/ijms21072612 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Chon, S. H. et al. Keratinocyte differentiation and upregulation of ceramide synthesis induced by an oat lipid extract via the activation of PPAR pathways. Exp. Dermatol.24(4), 290–295. 10.1111/exd.12658 (2015). [DOI] [PubMed] [Google Scholar]
- 36.Westergaard, M. et al. Modulation of keratinocyte gene expression and differentiation by PPAR-selective ligands and tetradecylthioacetic acid. J. Investig. Dermatol.116(5), 702–712. 10.1046/j.1523-1747.2001.01329.x (2001). [DOI] [PubMed] [Google Scholar]
- 37.Kim, B., Kim, J. E. & Kim, H. S. Caffeic acid induces keratinocyte differentiation by activation of PPAR-α. J. Pharm. Pharmacol.66(1), 84–92. 10.1111/jphp.12159 (2014). [DOI] [PubMed] [Google Scholar]
- 38.Igarashi, T. et al. Horse-derived ceramide accentuates glucosylceramide synthase and ceramide synthase 3 by activating PPARβ/δ and/or PPARγ to stimulate ceramide synthesis. Biomedicines10.3390/biomedicines11020548 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Helder, R. W. J. et al. The effect of PPAR isoform (de)activation on the lipid composition in full-thickness skin models. Exp. Dermatol.32(4), 469–478. 10.1111/exd.14733 (2023). [DOI] [PubMed] [Google Scholar]
- 40.Schild, J. et al. The role of ceramides in skin barrier function and the importance of their correct formulation for skincare applications. Int. J. Cosmet Sci.46(4), 526–543. 10.1111/ics.12972 (2024). [DOI] [PubMed] [Google Scholar]
- 41.Gupta, M. et al. Peroxisome proliferator-activated receptors (PPARs) and PPAR agonists: The “future” in dermatology therapeutics?. Arch. Dermatol. Res.307(9), 767–780. 10.1007/s00403-015-1571-1 (2015). [DOI] [PubMed] [Google Scholar]
- 42.Tu, Y. et al. The water extracts from the oil cakes of Prinsepia utilis repair the epidermal barrier via up-regulating Corneocyte Envelope-proteins, lipid synthases, and tight junction proteins. J. Ethnopharmacol.330, 118194. 10.1016/j.jep.2024.118194 (2024). [DOI] [PubMed] [Google Scholar]
- 43.Wang, J. et al. Pathogenesis of allergic diseases and implications for therapeutic interventions. Signal Transduct. Target Ther.8(1), 138. 10.1038/s41392-023-01344-4 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Man, A. M. et al. Inflammation and psoriasis: a comprehensive review. Int. J. Mol. Sci.10.3390/ijms242216095 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Dragicevic, N. & Maibach, H. I. Liposomes and other nanocarriers for the treatment of acne vulgaris: Improved therapeutic efficacy and skin tolerability. Pharmaceutics10.3390/pharmaceutics16030309 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Qu, F. et al. Advanced nanocarrier- and microneedle-based transdermal drug delivery strategies for skin diseases treatment. Theranostics12(7), 3372–3406. 10.7150/thno.69999 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Gruber, J. V. & Stojkoska, V. NLRP inflammasomes and induced skin inflammation, barrier recovery and extended skin hydration. Int. J. Cosmet Sci.42(1), 68–78. 10.1111/ics.12588 (2020). [DOI] [PubMed] [Google Scholar]
- 48.Liao, J. et al. Dendrobium officinale Kimura et Migo polysaccharide ameliorated DNFB-induced atopic dermatitis in mice associated with suppressing MAPK/NF-κB/STAT3 signaling pathways. J. Ethnopharmacol.335, 118677. 10.1016/j.jep.2024.118677 (2024). [DOI] [PubMed] [Google Scholar]
- 49.Fernando, I. P. S. et al. Fucoidan refined by Sargassum confusum indicate protective effects suppressing photo-oxidative stress and skin barrier perturbation in UVB-induced human keratinocytes. Int. J. Biol. Macromol.164, 149–161. 10.1016/j.ijbiomac.2020.07.136 (2020). [DOI] [PubMed] [Google Scholar]
- 50.Shu, Y. et al. Pleurotus ostreatus polysaccharide-mediated modulation of skin damage caused by microcystin-LR in tadpoles. Environ. Pollut.345, 123440. 10.1016/j.envpol.2024.123440 (2024). [DOI] [PubMed] [Google Scholar]
- 51.Luo, Y. & Bollag, W. B. The role of PGC-1α in aging skin barrier function. Cells10.3390/cells13131135 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The datasets used and/or analysed during the current study available from the corresponding author on reasonable request.








