Enrofloxacin exposure enhances GABA synthesis via PI3K/Akt signaling pathway in crucian carp brain

Abstract

It has been proved that enrofloxacin (ENR) induces disturbance of neuroendocrine system, resulting in reproductive damage in animals and fish. Our previous work revealed that ENR promoted testosterone (T) synthesis but inhibited the conversion of T to E₂ in crucian carp. The toxicological mechanism involves HPG axis, secretoneurin A (SNa) and aromatase, but the upstream mechanism is still unknown. To further explore the molecular mechanism, this study investigated the effect of ENR on metabolism of γ-aminobutyric acid (GABA) in female crucian carp brain. Fish exposed to ENR and/or PI3K inhibitor LY249002 were detected contents of GAGA and Glu, expression of glutamic acid decarboxylase (GAD) and GABA transaminase (GABA-T) expression, and contents of TCA cycle products and bioamines, as well as expression and activation of Akt protein in brain of crucian carp, using detection kits, qPCR, immunohistochemical analysis and ultra performance liquid chromatography, respectively. Data show that ENR promoted GABA synthesis from Glu in the shunt route through activating PI3K/Akt signaling pathway to upregulate GAD and GABA-T expression, resulting in accumulation of GABA and acetyl-CoA. Consequently, GABA stimulated the anabolic pathway of T via SNa associated pathways, thereby accelerated T synthesis from acetyl-CoA. These results indicate a new perspective for learning toxicological mechanism of ENR induced disorder of the neuroendocrine system and reproductive injury in animal.

As an exclusive antibacterial agent for animals, enrofloxacin (ENR) has been widely used in livestock and aquaculture industry to prevent and treat infectious diseases for the activity of inhibiting DNA gyrase of Gram-negative bacteria and topoisomerase (Top) IV of Gram-positive bacteria, respectively. Due to misapplication and economic benefit, ENR is commonly overprescribed and massively discharged into ecological environment, which results in ecotoxicity, bringing disaster to plant and animals, even humans through food and drinking water^1–5. Although it is defined as a hypotoxic antimicrobial, ENR has been proved to have some adverse properties due to its action of dysfunctioning Top I/II and DNA polymerase alpha/primase complex, inhibiting DNA/RNA synthesis, repressing cell growth and proliferation, and inducing oxidative stress and metabolic disturbance, consequently resulting in extensive toxic effect in animals, such as cerebral toxicity, reproductive toxicity, etc^4,6.

Presently, ENR induced reproduction toxicity has been reported by some researches, mainly found in male and female mammals, including mouse, rat, buck, bovine and marmoset, as well as nematode⁷which evidenced that ENR destroyed reproductive cells and disordered synthesis and secretion of reproductive hormones, such as testosterone (T), luteinizing hormone (LH) and follicle-stimulating hormone (FSH) in mammals^8–10and induced concussive multi-generational effects on reproduction of Caenorhabditis elegans^11,12. In fish, Cao et al. firstly observed that ENR disturbed neuroendocrine in grass carp via activating growth hormone/insulin-like growth factor (GH/IGF) axis and hypothalamic-pituitary-thyroid (HPT) axis¹³suggesting that ENR can damage fish reproductive function, which was verified by our previous findings in female crucian carp. ENR markedly stimulated gonadotrophin 2 (GtH 2, namely LH) expression, and did not significantly promote the expression of gonadotrophin releasing hormone (GnRH) and GtH 1 (namely FSH) in female crucian carp, which promoted synthesis of sex steroids in ovary and brain, and consequently resulted in T content augmentation in plasma and brain. Interestingly, estradiol (E₂) content in brain and plasma was not elevated, but declined accompanied by expression inhibition of aromatase A genes in ovary (cyp19a1a) and brain (cyp19a1b)^7,14. These data indicate that ENR promotes sex steroids metabolism but inhibits conversion of T to E₂ in ovary and brain of female crucian carp, the PI3K/Akt pathway involves in the regulation of biological process⁷.

It can be deduced based on the above data that ENR regulated GnRH/GtH/T-E₂ axis to impair reproduction property of female crucian carp. However, GnRH neuron is the finial output pathway of neuronal network that controls reproduction in mammals, GnRH secretion is dependent on inputs into GnRH neurons, such as γ-aminobutyric acid (GABA) and glutamate (Glu), two principal neurotransmitters with opposite action on regulating GnRH release from GnRH neurons through their receptors, such as GABA_A and GABA_B receptors, and NMDA and AMPA receptors on GnRH neurons in hypothalamic preoptic area^15,16suggesting that ENR induced activation of GnRH/GtH/T-E₂ axis in female crucian carp might be related to GABA synthesized and released from GABAergic neurons. To validate the deduction, this work investigated the effect of ENR on GABA synthesis and the involved mechanisms in female crucian carp brain.

Results

ENR short-term exposure promotes GABA synthesis from Glu in crucian carp brain

To explore the effect of ENR on GABA synthesis metabolism from Glu in fish brain, contents of GABA and Glu in different dosages of ENR exposed crucian carp brain were determined. Data in Fig. 1 show that in brain and plasma of different dosages of ENR exposed fish, GABA contents were observed significant increase along with decrease of Glu content, which suggests that ENR promoted conversion of Glu to GABA in crucian carp brain. Since GABA is mostly synthesized in brain, blood GABA content is closely related to brain GABA content. Conversion enzyme of Glu to GABA, glutamic acid decarboxylase (GAD), was promoted expression in fish brain by ENR, meanwhile the GABA transaminase (GABA-T) catalyzing GABA to succinic acid semialdehyde was also significantly promoted transcription. Noteworthily, the elevated folds of gad and gaba-t mRNAs were 7.91 and 3.35, respectively, which is contributed to GABA accumulation and Glu decline in ENR exposed fish. To support the results, the total activities of GAD and GABA-T in fish brain were determined. Consistent with expression contents of the two genes, both the total activities of GAD and GABA-T were strengthened, the raised folds were 4.45 and 2.65, respectively. These results reveal that short-term exposure of ENR promotes conversion of Glu to GABA, which is a critical part of GABA shunt pathway, resulting in Glu decrease and GABA increase.

Fig. 1.

ENR promotes conversion of Glu to GABA through regulating critical metabolic enzymes in crucian carp brain. Fish were exposed to normal saline or ENR for 24 h, and then were subjected to detect contents of GABA and Glu, total activity of GAD and GABA-T using detection kits, and transcript contents of gad and gaba-t gene using qPCR. Data were expressed as mean and standard deviation. Different lowercases represent significant difference among groups, p < 0.05, n = 6 (6 fish/group, 3 replicates).

According to the calculated IBRv2 based on eight indicators (Fig. 2), Glu and GABA contents in brain and plasma, GAD and GABA-T activities in brain, and contents of gad and gaba-t mRNAs, it was observed that Glu was repressed and others were induced, therein induction of two enzymes were obviously higher than the other four indicators. With increase of ENR dosages, IBRv2 values were augmented gradually, suggesting that ENR induced incremental stress was positively related with ENR dosage, which indicates that ENR associated toxicity towards fish brain is dose-dependent. Combination of the IBR index and data of indicators, 50 mg/kg ENR was selected for the following work.

Fig. 2.

IBR index in crucian carp treated with different dosages of ENR. Based on the data in Fig. 1, comprehensive IBR index values (IBRv2) were calculated to determine brain response to ENR according to GAD activity, GABA-T activity, GABA content in brain (GABA-B), GABA content in plasma (GABA-P), Glu content in brain (Glu-B), Glu content in plasma (Glu-P), gad mRNA content in brain (gad-m) and gaba mRNA content in brain (gaba-t-m). Left star map shows comprehensive IBR index values, and right histogram expresses IBRv2.

Since conversion of Glu to GABA is a critical part of GABA shunt pathway that also includes another important biological process, TCA cycle (Fig. 3). To explore the mechanisms of ENR promoting GABA biosynthesis in crucian carp brain, TCA cycle was detected. Data in Fig. 4 show that TCA cycle in fish brain tissue was not efficiently disturbed by ENR demonstrated by unchanged contents of citric acid isocitric acid and α-ketoglutaric acid, as well as expression of citrate synthase, isocitrate dehydrogenase and α-ketoglutarate dehydrogenase genes. These data suggest that the metabolic pathway from GABA to α-ketoglutaric acid was not significantly enhanced. Combination with significant promotion of gad and gaba-t genes expression and sharply increased content of GABA and decreased content of Glu, it can be concluded that short-term exposure of ENR did not speed shunt pathway, but promoted conversion of Glu to GABA in the pathway.

Fig. 3.

GABA biosynthesis pathways. SSA: succinic acid semialdehyde, Succ: succinic acid, Acetyl-CoA: acetyl coenzyme A, Citrate: citric acid, α-KG: α-ketoglutaric acid, Succ-CoA: succinyl-coenzyme A, P5C: e,Δ¹-pyrroline-5-carboxylic acid, Pro: proline, Asp: aspartic acid, Arg: arginine, Orn: ornithine, Put: putrescine, PAO: polyamine oxidase, Spd: spermidine, Spm: spermine, SPDS: spermidine synthase, ABAL: 4-aminobutyraldehyde, TCA: tricarboxylic acid cycle.

Fig. 4.

Effect of ENR on TCA cycle in crucian carp brain. Fish were exposed to normal saline (control) and 50 mg/kg ENR for 24 h, brains were collected for determination of metabolites with UPLC-Q Exactive/MS system and of transcriptional level of key enzymes in TCA cycle using qPCR. Data were expressed as mean and standard deviation. Different lowercases represent significant difference among groups, n = 3 (3 fish brains in a sample for detection of metabolites, 9 fish/group, 3 replicates), n = 6 (for detection of mRNA, 6 fish/group, 3 replicates).

PI3K signaling pathway involves GABA synthesis induced by ENR in crucian carp brain

Data in Fig. 5A/B show no significant difference of GABA and Glu contents in plasma and brain of fish exposed to ENR for 2 h to 24 h between normal saline treated fish in control and DMSO treated fish in vehicle, suggesting that DMSO did not affect GABA and Glu metabolism in brain. Compared to fish in vehicle, fish exposed ENR and DMSO were detected significant increase of GABA content in brain and plasma, and decrease of Glu content in brain, which indicated synthesis promotion of GABA from Glu by ENR. However, in LY249002 exposed fish, contents of GABA and Glu in brain and plasma had almost all returned to the levels in control or vehicle fish. These data present that PI3K inhibitor mitigated ENR induced GABA synthesis from Glu, suggesting that PI3K signaling pathway involved in the regulative process of ENR-mediating GABA biosynthesis in fish brain, the deduction was verified by the data of Akt protein expression and activation (Fig. 5C). ENR significantly promoted expression and activation of Akt, which was effectively suppressed by LY294002. Meanwhile, the expression levels of gad and gaba-t genes were also improved by ENR, but were found inhibition in ENR and LY249002 co-treated fish brain.

Fig. 5.

PI3K inhibitor LY249002 represses ENR induced metabolic disturbance of GABA and Glu in crucian carp brain. Fish were exposed to normal saline (control), DMSO (vehicle), 50 mg/kg ENR and DMSO (ENR), and 50 mg/kg ENR and 25 mg/kg LY249002, respectively. A: exposure for 2 h, 12 h and 24 h; B and C: exposure for 24 h. Fish were sacrificed to collect brain for detection of contents of GABA and Glu using detection kits, and mRNA contents of gad and gaba-t gene in fish brain exposed to ENR for 24 h using qPCR. Blood from fish exposed to ENR for 24 h was collected and anticoagulated with heparin to detect contents of GABA and Glu in plasma using detection kits. Brain was collected for determination of Akt protein expression and activation using immunohistochemistry detection. Data were expressed as mean and standard deviation. Different lowercases represent significant difference among groups, p < 0.05, n = 6 (6 fish/group, 3 replicates).

Comprehensively, ENR induced GABA synthesis from Glu was related to activation of PI3K/Akt pathway to promote expression of GAD in brain of crucian carp.

Short-term exposure of ENR induced GABA synthesis is not related to polyamine degradation pathway

As shown in the diagram (Fig. 3), polyamine degradation pathway, another synthesis route of GABA, is originated from Glu. Since Glu was rapidly converted to GABA by GAD, less Glu was converted to putrescine, spermidine and spermine, resulting in inapparent decrease of contents of the three amines in fish brain (Fig. 6). Meanwhile, expression of both spermidine synthase and polyamine oxidase was slightly inhibited by short-term exposure of ENR (Fig. 6), which further demonstrated that polyamine degradation pathway was not promoted by ENR in fish brain. These data reveal that ENR induced GABA synthesis is not related to polyamine degradation pathway.

Fig. 6.

Effect of ENR on polyamine degradation pathway in crucian carp brain. Fish were exposed to normal saline (control) and 50 mg/kg ENR for 24 h, brains were collected for determination of metabolites with UPLC-Q Exactive/MS system and of transcriptional level of key enzymes in polyamine degradation pathway using qPCR. Data were expressed as mean and standard deviation. Different lowercases represent significant difference among groups, n = 3 (3 fish brains in a sample for detection of metabolites, 9 fish/group, 3 replicates), n = 6 (for detection of mRNAs, 6 fish/group, 3 replicates).

Discussion

ENR induced reproduction damage of mammals and nematode has been recognized, the toxicology mechanisms are proved to be apoptosis induction of reproductive cells and disruption of endocrine system^8–10. In fish, ENR associated neuroendocrine system disorder was firstly found in grass carp demonstrated by activation of GH/IGF and HPT axis¹³. In our previous work, ENR was firstly observed disruption on sex steroid metabolism pathway in ovary and brain, resulting in elevation of T content and reduction of E₂ content in blood and brain via activating PI3K/AKT signaling pathway in female crucian carp^7,14 which suggests that ENR disordered reproductive endocrine system is closely related to hypothalamus, pituitary body and ovary, namely HPG axis, and radial glial cells (RGCs) that synthesize central steroid hormone.

Sex steroid hormone metabolism is stimulated by pituitary gonadotropic cells-derived FSH and LH that are controlled by GnRH neurons secreted GnRH in hypothalamus. However, ENR failed to significantly induce GnRH and FSH expression, but markedly promoted expression of LH¹⁴ consequently promoted steroid hormone metabolism pathway and repressed conversion of T to E₂ via expression inhibition of CYP19A1, including CYP19A1A in ovary and CYP19A1B in brain, in female crucian carp, resulting in T accumulation and E₂ decline^7,14. These results are in line with the biological mechanism of secretoneurin A (SNa), a neuropeptide that has been proved to be reproductive hormone and functions in promoting expression of LH but specifically inhibiting expression of CYP19A1, a types of key enzymes of steroid hormone metabolism pathway. The neuropeptide expression was upregulated by ENR in brain of female crucian carp via activation of PI3K/Akt signaling pathway⁷.

Both GnRH from GnRH neurons and SNa from SNa neurons are controlled by GABA. It was firstly documented that SNa inhibited cyp19a1b expression in female Carassius auratus RGCs that exclusively express cyp19a1b in brain, but other enzymes expression in the steroid hormone metabolism pathway were not modified by the active peptide¹⁷ indicating that ENR decreased E₂ content in our previous work^7,14 should be closely related to promotion of SNa expression. The group also indirectly revealed that GABA stimulated expression of SNa and LH in goldfish pituitary¹⁸. Summarily, findings in this work, ENR promoting GABA synthesis strongly supports our previous reports of ENR inhibiting E₂ synthesis in female crucian carp^7,14.

As final output pathway of neuronal network that controls reproduction in mammals, hypothalamic GnRH neurons releasing GnRH is controlled by inputs into the neurocyte, such as GABA released from synapses of GABAergic neurons and glutamate released from synapses of glutamatergic neurons, two principal neurotransmitters of the entire central nervous system including hypothalamus¹⁶. It is well-known that GABA is an inhibitory neurotransmitter released from GABAergic neurons synapse directly onto GnRH neurons located within the medial preoptic aera (mPOA) of the hypothalamus, and inhibits expression and release of GnRH from GnRH neurons distributed diffusely in mPOA via postsynaptic GABA receptors, including GABA_A receptors and GABA_B receptor¹⁹ oppositely glutamate excites GnRH neurons to release GnRH²⁰. Glutamatergic synapses forms after GABAergic synapses formation, the development sequence of GABA → glutamate signaling in hippocampus underlies pulsatile inputs into GnRH cell body¹⁵. Our findings in this study showed that ENR promoted conversion of Glu to GABA via expression promotion of glutamate decarboxylase, consequently decreasing Glu content and increasing GABA content, which resulted in release inhibition of GnRH from GnRH neurons. Additionally, estrogen negative feedback stimulates GnRH and LH release, resulting in the preovulatory GnRH/LH surge that triggers ovulation in the female of species with spontaneous ovulation²⁰. ENR decreased E₂ content in our previous reports^7,14 which might be attributed to reduction of GnRH in female crucian carp.

The current viewpoint regarding action of GABA on GnRH neurons is controversial, GnRH neurons are excited or inhibited by GABA via GABA_A and GABA_B receptors, the net GABA effects are contingent on the balance of GAGA_A and GABA_B receptor-mediated effects along with the GnRH neuron soma and dendrite²¹. Activation of GABA_A receptor by agonists through evocation of L-type calcium channels induces depolarization of GnRH neurons, contradictorily, GABA can switch GABA_A receptor from depolarization to hyperpolarization via activation of chloride ion channel²¹. The response of GABA depends on GnRH neuron location in the hypothalamus, for example excitatory to GnRH neurons in coronal slices but inhibitory in the anterior hypothalamic area in horizontal slices, which is attributed to the direct activation of GABA_A and GABA_B receptors, the nerve cells in POA can be activated by the inhibitory neurotransmitter²¹. GnRH neurons are also excited by GABA in fish, such as goldfish, sea lamprey and dwarf gourami, GABA_A receptor can be activated by GABA to induce excitation in the terminal nerve-GnRH neurons²¹. Additionally, SNa neurons are densely present in POA region¹⁸. In POA region, GABA inhibits GnRH secretion and promotes SNa expression, but SNa stimulates GnRH release from GnRH neurons and directly activates LH cells, to produce FSH and LH²² therefore ENR exposure improved sex steroid hormones metabolism through activating SNa pathway to ameliorate GnRH-mediated inhibition of FSH and LH, resulting in elevation of contents of the two gonadotropins.

Based on the above-mentioned data, it can be concluded that ENR induced disruption of sex steroid hormones, increase of T and decrease of E₂, should be attributed to enhancement of GABA synthesis resulted from promotion of GAD, resulting in SNa release to stimulate LH for improving steroid hormones synthesis metabolism, and to inhibit CYP19A1 for blocking conversion of T to E₂.

GABA synthesis routes include shunt pathway and polyamine degradation pathway. The shunt pathway is a primary route of GABA synthesis and metabolism in animals and plants, and the only known pathway that can decrease cytoplasmic GABA content²³. The pathway comprises two stages, conversion from Glu to GABA catalyzed by GAD in cytoplasm and multi-step conversion process of GABA to Glu, the latter stage contains Kreb’s cycle in mitochondria²³ which implies that ENR might change energy metabolism in brain of fish. It has been proved that ENR induced metabolic disturbance in gut of American shad^24,25 and brain of crucian carp²⁶. Although two key enzymes, GAD and GABA-T, in shunt pathway were found markedly upregulated expression, but it was still unable determine whether the complete pathway involved the biological process. Data in this work showed that TCA cycle was not significantly changed that was demonstrated by unchanged contents of three key metabolites and expression of three important enzymes. These results reveal that ENR short-term exposure activated the shunt pathway to promote GABA synthesis in crucian carp brain, just through enhancing conversion of Glu to GABA in shunt pathway, and could not promote the complete pathway. However, it must be noted that GABA-T was promoted expression in the ENR-exposed fish brain, indicating that GABA was efficiently converted to be succinic acid semialdehyde (SSA), the downstream products of SSA were succinic acid and acetyl coenzyme A (acetyl-CoA) (Fig. 3). No significant modification regarding TCA cycle was found, therefore SSA was more inclined to be converted into other substances through acetyl-CoA, such as fatty acid. Du and co-workers found that ENR obviously increased body weight of American shad through accumulation of protein and lipid, which was closely related to dysregulation of carbohydrate metabolism pathways^24,25. In our previous work, ENR was verified the dysfunction in metabolisms of carbohydrate, protein, lipid, nucleotide and energy via various signaling pathways including glycosphingolipid biosynthesis, PI3K/Akt, adipocytokine, estrogen, glycosaminoglycan degradation, etc²⁶. Recently, Hayashi et al. found that neuroestrogens enhanced leptin responsiveness, and counteracted body weight gain²⁷. Our studies revealed ENR-induced decrease of E₂ content, including central E₂, which supported the results by Du et al.^24,25. These data suggest that ENR might promote the synthesis of cholesterol, fatty acids, acetylcholine and acetylated substances through conversion of SSA to acetyl-CoA by inducing GAD and GABA-T expression in crucian carp brain. More importantly, our previous work reported that ENR significantly promoted T anabolism in crucian carp, including brain^7,14suggesting that more cholesterol has been converted into T, which provided a vital evidence for that ENR promoted GAD and GABA-T expression but did not alter TCA cycle.

Polyamine degradation pathway is an alternative route for GABA synthesis using putrescine as a precursor, it is primary synthesis route of GABA in some tissues/organs of animal, such as adrenal gland and brain in postnatal rat²³. Sequerra et al. found that in the postnatal rat subventricular zone GABA synthesis is dependent on putrescine degradation, and no obvious immunological marker of GAD²⁸. This work showed that ENR did not modify the pathway, no significant decrease of contents of putrescine, spermidine and spermine, and expression levels of spermidine synthase and polyamine oxidase in ENR-exposed crucian carp brain. These results matched the shunt pathway, since large amount of Glu had been rapidly and directly converted into GABA by induced GAD, very little Glu entered the polyamine degradation pathway and underwent a relatively longer transformation process to be converted into GABA. Therefore, elevated GABA content in ENR-exposed fish brain was not originated from polyamine degradation pathway.

PI3K/Akt is a classic signaling pathway that is highly conserved, it is tightly controllably activated. Activated PI3K by receptor tyrosine kinases phosphorylates Akt protein via multistep process, and consequently activates GABA_AR, resulting in activation of synaptic signaling²⁹ which indicates that PI3K/Akt signaling pathway can activate GABAergic neurons in fish. Our previous work evidenced that ENR exposure activated PI3K/Akt pathway in crucian carp brain^7,26 and this study re-found that the signaling cascade was triggered in brain of ENR exposed crucian carp, moreover the signaling pathway involved in promotion of GABA synthesis by ENR via shunt route. Therefore, it can be made a preliminary determination that ENR promotes GABA synthesis on basis of conversion of Glu to GABA in the shunt route, the related mechanism is related to activation of PI3K/Akt signaling pathway in crucian carp brain.

In conclusion, based on our previous findings regarding ENR disturbing sex steroid hormones metabolism, including neuroestrogens and neuroandrogens, via regulating GnRH and SNa to promote T synthesis but inhibit the conversion of T to E₂, consequently increased T content and decreased E₂ content in central nervous system and blood, this work initially explained the underlying toxicological mechanism, a pathway of GAD/GABA/SNa-GnRH involved the biological process. As an important neurotransmitter of reproductive regulation, GABA biosynthesis was promoted by ENR in crucian carp brain via activating PI3K/Akt signaling pathway to induce expression of GAD, and thus improve conversion of Glu to GABA in shunt route. GABA inhibited expression of GnRH and consequent FSH/LH, but promoted SNa expression. Resultantly, SNa improved GnRH expression and directly stimulated expression of LH, as well as suppressed CYP19A1 expression, which resulted in increase of T and decrease of E₂. Elevation of T content was originated from the conversion of more cholesterol that was synthesized from acetyl-CoA, while the increased acetyl-CoA was attributed to the fact that the product succinic acid semialdehyde from GABA catalyzed by GABA-T was not converted into succinic acid that could enter TCA cycle. Comprehensively, ENR promotes expression of GAD and GABA-T via activation of PI3K/Akt pathway in crucian carp brain, thus elevates contents of GABA and acetyl-CoA, consequently activates SNa/LH and SNa/GnRH pathways to accelerate T synthesis. Noteworthily, it is still unknown how ENR regulates PI3KAkt signaling pathway to promote GAD expression, which is a crucial scientific issue for understanding the molecular mechanism of ENR disturbing neuroendocrine and reproductive endocrine systems in teleost.

Materials and methods

Crucian carp grouping and treatment

Based on our previous findings regarding the effect of ENR on reproductive system and neuroendocrine system of female crucian carp, this work employed female Pengze crucian carp as model. Acclimated healthy female Pengze crucian carps with stage 2 ovary weighted average 60 g (± 3 g), free of parasites and no medication history, were allocated to scheduled groups. ENR in normal saline was orally administrated, DMSO and LY249002 were intraperitoneally injected according to our published work⁷. During the experimental period, fish lived in the same environmental conditions as acclimation period, 25 ± 1℃ (ambient temperature), 6.5 ± 0.5 mg/L (dissolved oxygen), and pH 7.5–7.8. At the detection time points, fish were anesthetized and collected brain and blood. Fish use and handling protocols were approved by the Animal Ethics Committee of Jiangxi Agricultural University and conducted in accordance with the guideline of the committee. All animal care and experimental procedures were conducted following the ARRIVE guidelines.

Determination of GABA and Glu contents in brain and plasma

Contents of GABA and Glu in brain and plasma were detected using kits according to the protocols provided by manufacturer (Suzhou Grace Biotechnology, Co., Ltd., Suzhou, China).

Analysis of important metabolites in Tricarboxylic acid cycle (TCA) cycle

Crucian carp brain (100 mg) was grinded in liquid nitrogen, the tissue powder was suspended into 1 mL precooled solution of methanol/acetonitrile/H₂O (volume ratio: 2/2/1) that was then subjected to ultrasonic treatment for 30 min. After repeated twice, three extracts were merged. Following store for 1 h at − 20℃, solution was centrifugated (4℃, 12000 rpm, 20 min) to collect supernatant that was vacuum freeze-dried. The dried product was redissolved into 0.2 mL 50% acetonitrile solution that was centrifugated (4℃, 12000 rpm, 20 min) to collect supernatant that was subjected to detect contents of metabolites, including citric acid, isocitric acid and α-ketoglutaric acid, using UPLC-Q Exactive/MS system (Thermo, USA).

Analysis of bioamine contents

Crucian carp brain (100 mg) grinded in liquid nitrogen was placed into 1 mL of 0.1 mol/L HCl solution, store for 1 h at room temperature. After centrifugation (12000 rpm, 10 min), supernatant was diluted to prepare sample. Sample (10 µL) was added into derivative tube with 70 µL AccQ•Tag Ultra Borate buffer and 20 µL AccQ•Tag reagent. Mixture was heated for 10 min at 55 ℃, cooled solution was subjected to detect contents of bioamines, including putrescine, spermidine and spermine, using UPLC-Q Exactive/MS system (Thermo, USA).

Immunohistochemical analysis

Paraffin Sects. (3–5 μm) of crucian carp brain were prepared based on routine method. After deparaffination and washing with distilled water, sections were used to antigen retrieval and sealing endogenous peroxidase with H₂O₂. Following 3% BSA sealing, sections were probed p-Akt protein with primary monoclonal antibody (GB150002, 1:5000) stored at 4℃ for overnight and then cultured in the secondary antibody labelled with horse radish peroxidase at room temperature for 50 min followed by CY3-TSA staining and microwave processing. Sections were in turn probed Akt protein with monoclonal antibody (GB13011-2, 1:200), Alexa Fluor 488 labelled secondary antibody and DAPI staining solution. Subsequently, sections were spontaneously quenched fluorescence, sealed and then subjected to be imaged using a Leica SP8 laser scanning confocal microscope. Optical density was analyzed using Aipathwell^® soft. Activation level of Akt was evaluated through calculating optical density ratio of p-Akt positive area to Akt positive area and the ratio of p-Akt positive area to Akt positive area.

Calculation of integrated biomarker response (IBR) index

IBR index, IBRv2, was calculated according to the methods^30,31. This study used glutamic acid decarboxylase (GAD) activity, GABA transaminase (GABA-T) activity, GABA content in brain (GABA-B), GABA content in plasma (GABA-P), Glu content in brain (Glu-B), Glu content in plasma (Glu-P), gad mRNA content in brain (gad-m) and gaba mRNA content in brain (gaba-t-m) to calculate IBRv2.

qPCR detection

The RNA from crucian carp brain was extracted according to the manufacturer protocol using Trizol reagent and then prepared cDNA that used to qRT-PCR detection for target genes. The qPCR primers were validated and their information is listed in Table 1. The 2^−ΔΔCt formula was used to calculate the gene fold change.

Table 1.

Information of primers.

Gene	Primer sequence (5’→3’)	Gene bank accession no.	Size (bp)
β-actin	F: CAGGGAGAAGATGACACAGATCAT	XM_026204620.1	137
	R: GGGTCACACCATCACCAGAAT
citrate synthase	F: CAATGTCTTTTCTCTCTATCAGCAG	XM_026200125.1	118
	R: AGGACGTCTTTCAAATTCGTGG
isocitrate dehydrogenase	F: CGCACATGGAGACCAGTACA	XM_026272070.1	99
	R: TTGATTGGCTCCCCTCCATT
α-ketoglutarate dehydrogenase	F: GTGTTTACTGTGTTTCGGAGTGA	XM_026269291.1	162
	R: GTGCCTCTTGTACGTTTGGC
glutamic acid decarboxylase	F: TTCTCTGTCGCTGCTCTGAT	AF149832.1	246
	R: CTCTCGGCTGTAGACCCAT
GABA transaminase	F: CTGCCTGGCCACAACACA	DO287923.1	115
	R: TCCCTCACAAACTCCTCCAGA
spermidine synthase	F: CCAGTACGAGAACTGCCAAGA	XM_026200062.1	120
	R: GGTCAGGGTTTTGTTCTTTCTGG
polyamine oxidase	F: GTCAGTGGAACCCACACGAT	XM_026223822.1	104
	R: AAACCTTCGTAACCTCCTGGG

Statistical analysis

Data were presented as mean ± SD and statistically analyzed on SPSS software. The parametric statistical significant difference of the data was analyzed by analysis of variance with LSD test.

Author contributions

J. R.: Conceptualization, investigation, methodology, funding acquisition, writing the original draft. G. W.: Investigation, methodology, data curation. P. L.: Visualization, writing the original draft. J. H.: Methodology, formal analysis. H. L.: Conceptualization, funding acquisition, reviewing and editing, project administration, supervision.

Funding

This research was predominantly funded by the Earmarked Fund for Jiangxi Agricultural Industry Technology System (JXARS-12), the Guangdong Basic and Applied Basic Research Foundation (No. 2022A1515012091), and the Special Project in Key Fields of Guangdong Universities (No. 2022ZDZX2025).

Data availability

Data is provided within the manuscript.

Declarations

Competing interests

The authors declare no competing interests.