Skip to main content
Poultry Science logoLink to Poultry Science
. 2025 Jun 14;104(9):105437. doi: 10.1016/j.psj.2025.105437

Cecal microbiota transplantation enhances calcium retention through modulation of gut microbiota and intestinal calcium transporter gene expression in chicks

Xingyi Tang a, Miao Mao a, Xinyu Zhang a, Hang Gao a, Zhouyuan Wang b, Rendong Fang a, Heng-wei Cheng c, Sha Jiang a,⁎
PMCID: PMC12221639  PMID: 40541100

Abstract

Bone development during early life is crucial for maintaining skeletal health and productivity in laying hens. The aim of this study was to investigate the effects of transferring cecal bacterial material of healthy adult hens on growth performance, gut integrity, microbial development, and bone metabolism of recipient chicks. Cecal contents were collected from 12 healthy Lohmann Pink-shell laying hens aged 47 weeks (donors). A total of 120 1-day-old Lohmann Pink chicks (recipients) were randomly assigned to 2 treatments for a 34-day trial: CONT (0.1 mL saline, Control) and CMT (0.1 mL cecal microbial solution). Each group had 10 replicates and 6 chicks per replicate. The pooled cecal sample as well as saline was administered via oral gavage once daily from day 1 to day 10, and then boosted on days 16, 23, and 30. One bird from each replicate was randomly taken for sample collection at day 34 (n=10). The results showed that CMT chicks had significantly higher Ca and P retention rates than CONT chicks. The mRNA expressions of intestinal Ca transporters, CaBP-D28K and VDR in the ileum and NCX1 in the jejunum, were also upregulated in CMT chicks. Additionally, the mRNA expression of a tight junction protein, ZO-1, was upregulated in the duodenum of CMT chicks. CMT chicks also had higher mRNA expressions of pro-inflammatory cytokines, IL-6, IL-1β, and TNF-α, in the intestinal tract. Furthermore, CMT chicks had a more diverse and mature gut microbial community compared to CONT chicks. The relative abundances of SCFA-produced bacteria (e.g., Bacteroides, Rikenellaceae_RC9_gut_group, and Prevotellaceae_UCG-001) were increased, while the relative abundances of Alistipes, Lactobacillus, and Barnesiella were reduced in CMT chicks. However, there were no CMT effects on body weight, organ indexes, bone morphology, and gene expression-associated with bone metabolism. This study demonstrates that transferring cecal bacteria from adult laying hens enhances calcium absorption and retention in newly hatched chicks by upregulating key calcium transporters and enhancing intestinal barrier integrity via modulating the gut microbiome.

Keywords: Cecal microbiota transplantation, Calcium retention, Gut microbiota, Hen, Chick

Introduction

Skeletal development prior to sexual maturity has long-term effects on bone health and production in laying hens. Medullary bone of the three types of skeleton bones of laying hens serves as a calcium (Ca) reservoir, developing gradually during the early grower stage and playing a critical role in supplying Ca for eggshell formation (Fleming et al., 1998; Whitehead & Fleming, 2000; Zhao et al., 2020). After the onset of sexual maturity (about 18-19 weeks of age), Ca reserved in the medullar bone is rapidly turned over at the rate approximately 1.6 g/day until the end of the laying cycle (Whitehead & Fleming, 2000), resulting in about 25-40% of the eggshell Ca is from skeletal stores (Fleming, 2008). Chicks with higher body weight and better skeletal development may exhibit greater bone mass, allowing for the increased accumulation of medullary bone with reserved Ca before the laying phase (Bishop et al., 2000; Kim et al., 2012). To meet the Ca demand for egg production, the compositions of chicken feed are changed from pullet diet to pre-layer and layer diets, increasing Ca amount from 2.2% to 3.5–3.8% (Sumano-Lopez et al., 2021). In addition, adequate Ca absorption in the small intestine is vital for sustaining egg production, egg quality, and overall bone health in laying hens. Therefore, enhancing and sustaining capacity of the intestinal Ca absorption is critical for protecting bone health and improving egg production of laying hens (Jiang et al., 2023). Gut microbiota plays a key role in regulating bone development and modification, mineral absorption, integrity of intestinal barrier, and functions of immune and endocrine systems in laying hens (Behera et al., 2020; Locantore et al., 2020; Grüner et al., 2023). However, the exact mechanisms of how gut microbiota influences bone metabolism are not fully understood.

The process for establishing and developing gut microbiota composition and diversity during early life in chickens as well as in other animals is particularly sensitive to various factors with long-lasting health and productivity effects. In wild chickens, several factors including the eggshell (van Veelen et al., 2018), nest (Kubasova et al., 2019; Diez-Méndez et al., 2023), maternal contact, and mother's orally feeding (Kubasova et al., 2019; Chen et al., 2020), contribute to the early colonizing gut bacteria to establish microbiota composition. Conversely, commercial chicks are hatched in an environment with their gastrointestinal tract (GIT) relatively devoid of microorganisms (van Veelen et al., 2018). The initial gut microbiota in the commercially hatched chicks is primarily shaped by the hatchery and production environments (Rychlik, 2020; Li et al., 2022; Lyte et al., 2024) due to the absence of directly maternal contact (Shterzer et al., 2023). Several studies have reports that the early life stage is a critical window for manipulating the intestinal microbiota to optimize health status, immune function, and body growth (Rubio, 2019; Yu et al., 2021; Lee et al., 2022). Therefore, providing intestinal bacteria from adult chickens to newly hatched chicks may alter the gut microbiota diversity, composition, and function in a way that benefits overall health (Shterzer et al., 2023).

Fecal microbiota transplantation (FMT) is a therapeutic procedure involving the deliberate transferring of fecal suspension from a healthy donor to a patient to alter the recipient’s microbial composition with conferred health benefits (Gupta et al., 2016). It has been used in humans for treating Clostridioides difficile infection since the 1950s (Eiseman et al., 1958). FMT has been gaining recognition for its clinical efficacy in recurrent or refractory C. difficile infections, particularly when conventional antibiotic therapies fail (Bernard et al., 2021). Despite its effectiveness, the precise mechanisms underlying FMT therapeutic internation remain unclear. It is believed that FMT can efficiently restore gut microbiota ecosystem and suppress pathogenic overgrowth in patients although pathogen transfer (secondary infection) may occur with the procedure (Andary et al., 2024). In poultry, the potential of microbiota transfer can be traced back to 1970s, when transferring gut contents from adult chickens to the crops of newly hatched chicks to improve the resistance against Salmonella infection (Nurmi & Rantala, 1973). Since then, FMT has been shown to enhance health and productivity by modulating gut microbiota composition and function (Metzler-Zebeli et al., 2019; Liu et al., 2025). Given that the ceca harbor the highest microbial density in the chicken GIT (Yue et al., 2024), and operational taxonomic units (OTUs) analysis shows the quality of fecal microbiota is similar to cecal microbiota, quantity of cecal microbiota is quite different in alpha and beta diversity compared to it of fecal microbiota (Stanley et al., 2015). Recent studies have focused on the transplantation of cecal content, namely cecal microbiota transplantation (CMT), as a promising intervention for improving health and welfare of poultry. Specifically, CMT from adult chickens have been shown to promote the maturation and development of the intestinal microbiota in chicks (Kubasova et al., 2019; Yu et al., 2021; Marcolla et al., 2023), enhance immune organ development (Yu et al., 2021, Yue et al., 2024; Song et al., 2023b, 2024), and increase resistance to colonization of pathogens including Salmonella and Campylobacter, thereby improving the survivability of chicks (Wang et al., 2022; Pang et al., 2023). In addition, CMT has demonstrated benefits in improving growth and production performance, including body weight (Fu et al., 2022; Yu et al., 2021), meat quality (Lei et al., 2022), ovarian function (Cao et al., 2023), and tibial length (Yu et al., 2021). Despite these promising outcomes, no study has yet examined the impact of early-life CMT on bone metabolism in chickens. Evidence from murine models has shown that FMT can exert anti-osteoclastogenic effects, suggesting its potential role in mitigating bone loss and even promoting bone formation (Ma et al., 2021). Therefore, the objective of this study was to investigate the effects of CMT from adult laying hens on the growth performance, bone metabolism, and gut microbiota composition in newly hatched chicks. This research aims to provide valuable insights into the strategies for safeguarding the bone health of laying hens.

Materials and methods

Animal and experimental design

The research was conducted under the guidelines approved by the Animal Care and Use Committee of the Southwest University, China (No: IACUC-20220720-04).

Donors. Following physical and parasitic examinations and common infectious disease tests including Newcastle disease, infectious bursal disease, infectious bronchitis, and avian influenza, 12 healthy 47-week-old Lohmann pink laying hens (at a high egg production stage) were selected as donors. After the laying hens were euthanized by cervical dislocation under anesthesia with pentobarbital sodium (30 mg/kg body weight), approximately 1 g of the cecal contents per sampled bird was collected into sterile cryotubes and stored at -80°C for intestinal microbial analysis. The remaining cecal contents were rapidly diluted with cryopreservation solution (composed of guanidine thiocyanate and deionized water) at a ratio of 1:6.7 (ChengGe Biotechnology Co., Ltd, Xiamen, China), and then the suspension was filtered through a sterilized three-layer filter cloth (gauze, 80-mesh filter cloth, and 140-mesh filter cloth) to obtain a uniform cecal microbiota solution (Ma et al., 2023), and then frozen at -80 °C.

Recipients. A total of 120 1-day-old recipient Lohmann pink female chicks (Sichuan Shengluolan Agricultural Technology Co., Ltd.) were housed in an environmental control room through the study. The chicks were randomly divided into 2 groups with 10 replicate pullet cages (70 cm × 70 cm × 30 cm per cage) of 6 chicks each for a 34-day trial (n = 10): CONT group (0.1 mL 0.9% sterile saline, Control) and CMT (0.1 mL cecal microbial solution) group. All chicks were kept in the same house throughout the study. The cecal microbiota solution was thawed in an ice water bath for 2h and then evenly pooled among the collected cecal samples before use. Oral gavage for the transplantation was performed once daily from day 1 to day 10, and then boosted on days 16, 23, and 30 (Fu et al., 2022). During the entire experiment period, food and water were provided ad libitum, the temperature, light time and intensity of the room were strictly adjusted according to the guideline of the Lohmann Pink Layers Management Guide.

Sample collection from recipients

Feed intake and fecal samples from each cage were collected for analysis of Ca and P intake/excretion on day 33 according to the previously published method (Jiang et al., 2013). On day 34, one bird from each of the 10 replicate cages per group (n = 10) was randomly taken, weighed, then anesthetized using pentobarbital sodium (30 mg/kg body weight). Blood samples were collected into blood collection tubes via cardiac puncture. A small portion of blood sample was used immediately for preparing blood smears, and the remains were kept for 2 h at room temperature and then centrifuged at 850 × g for 15 min under 4 °C for collecting serum.

After blood collection, the chicks were euthanized by cervical dislocation. The bursa of fabricius, spleen, thymus, and liver were collected and weighed for calculation of each organ index (organ index = organ weight (g) / chicken body weight (kg)). Cecal contents were collected into sterile, freezer-safe tubes and stored at -80°C for intestinal microbial analysis. The left tibia, the entire right femur and tibia and the contents of the duodenum, jejunum, and ileum of each sampled bird were collected and frozen at -20 °C. The cancellous bone of the left femur was also collected and frozen at -80 °C. Additionally, intestinal tissue samples from the midpoint (5.0 cm/sample) of the duodenum, jejunum, and ileum were collected separately after being flushed with 0.9% saline to remove intestinal contents. Each sample was cut into two parts and stored separately: one group was fixed with 10% formalin immediately, and another group was frozen at -80 °C.

Blood smear analysis

Blood smears were stained with Wright-Giemsa. White blood cells were observed under a light microscope and the types of white blood cells were counted (100 cells from each of the duplicate smears) under the high-power field (100 ×), and the proportions of lymphocytes, heterophils, eosinophils, basophils, and monocytes were calculated (Kolesnik et al., 2020).

Blood bone metabolism and immune parameter analysis

Serum Ca, alkaline phosphatase (ALP), and phosphorus (P) were detected by automatic biochemical analyzer (Mindray BS-240 Vet, Shenzhen, China). Prior to analysis, serum samples were thawed at room temperature. Once thawed, samples were transferred into centrifuge tubes and centrifuged at 1000 × g for 20 min at 4 °C to remove potential precipitates or impurities. The resulting supernatant was transferred to fresh tubes, and the tube caps were removed before placement onto the reagent tray of the analyzer. Corresponding reagent kits for Ca, ALP, and P, along with wash solution (CD80) and normal saline, were also loaded onto designated positions in the analyzer. The detection parameters were programmed via the system software, and the automated analysis was initiated. During the assay run, the waste tank was emptied and wash solution replenished every 40 min, as required by the instrument’s maintenance protocol. Tartrate-resistant acid phosphatase (TRACP) was analyzed via TRACP Assay Kit (catalog number: P0332; Shanghai Beyotime Biotechnology co., Ltd, Shanghai, China). Briefly, serum samples were incubated with pre-mixed working solution (containing detection buffer, tartrate solution, and colorimetric substrate) at 37 °C for 10 min, followed by added the stop solution. The absorbance was measured at 405 nm (ThermoFisher, Waltham, USA). TRACP activity was calculated based on the standard curves and enzyme activity defined by the manufactural instruction. The serum levels of pro-inflammatory cytokine interleukin (IL)-6, IL-1β, and tumor necrosis factor-alpha (TNF-α), were detected by using chicken ELISA kits (catalog numbers: EHJ-50214, EHJ-50232, and EHJ-50231; Xiamen Huijia Biotechnology Co., Ltd, Fujian, China). Briefly the serum samples were prepared and diluted according to the manufacturer’s instructions. Plates were incubated at 37 °C for 1h, washed five times with diluted wash buffer, and enzyme conjugate was added. After a second incubation and wash step, colorimetric substrates A and B were added, followed by the stop solution. Absorbance was measured at 450 nm using a microplate reader within 15 min of stopping the reaction. Each indicator’s concentrations were calculated based on standard curves and adjusted for dilution factors.

Bone morphological analysis

After thawing at room temperature, the soft tissue (skin and muscles) on the right femur and tibia were completely stripped off. Clean gauze was used to wipe off the surface oil and then placed on an analytical balance to weigh each bone, separately. The length and diameter of both the tibia and femur were measured three times using a vernier caliper to obtain its average values. Each of the bone tissues was fully immersed in a measuring cylinder containing saline, and the saline volumes, V1 and V2, before and after immersion, were used to calculate the bone volume (bone volume = V2-V1).

Analysis of the Ca and P levels in feed, bone, and excrement

Approximately 3g of feed, fecal, and femoral samples of each sampled bird were separately ground and transferred to drying bottles after passing through a 40-mesh sieve, then dried with an oven at 110°C until a consistent weight was achieved according to the method published previously (Jiang et al., 2023). Briefly, then, 0.1 g of each dried sample was placed into a crucible, carbonized at 200°C until smokeless on an electric heating plate, subsequently transferred to a muffler furnace (FO811C, Yamato scientific America, Inc., Japan), and then calcined at 550°C for 3 h until the sample was completely turned into ash. Each of the calcined femoral samples was weighed on an analytical balance to determine the bone ash fraction after the ash sample was cooled to room temperature. Next, each sample was dissolved in pure nitric acid, heated to boiling on an electric heating plate, filtered into a 50 mL volumetric flask, and titrated to 50 mL with warm ultrapure water. Finally, the contents of Ca and P in the solutions were determined by inductively coupled plasma optical emission spectrometry (ICP-OES) (iCAP 7000 SERIES, Thermo, USA). The Ca and P retention rates were calculated according to the formula: The Ca or P retention rate = (the Ca or P intake – Ca or P in excrement) / the Ca or P intake × 100% (Jiang et al., 2023).

Intestinal histomorphology and intestinal content pH measurements

Approximately 1 cm of each collected intestinal sample was dehydrated in gradient concentrations of ethanol, cleared with xylene, immersed in liquid paraffin, embedded using an embedding machine, and sectioned (3 μm thickness per section) with a sliding microtome (Leica RM2235, Leica microsystems, Wetzlar, Germany), and then stained with hematoxylin and eosin solution. Histologic sections were examined under a light microscope under a 4x objective magnification, and an average of 3 non-overlapping fields were randomly observed and, at least, 15 villus-crypt units per section were collected. Image-Pro Plus 6.0 software was used to analyze the villus length (VL) and crypt depth (CD) in each segment of the small intestine, and VL/CD ratios were calculated.

Content samples collected from the duodenum, jejunum, ileum, and cecum were separately diluted, mixed with ultrapure water (1:50), vortexed briefly, and then used for pH measurement. The pH values were measured using a digital pH meter (FE28, Mettler Toledo, Switzerland) equipped with an automatic temperature compensation function. All measurements were performed at room temperature (∼25 °C), and each sample was measured in duplicate. Between measurements, the pH electrode was rinsed with ultrapure water to avoid cross-contamination.

Real-time PCR

Total RNA was extracted from each collected cancellous bone, duodenum, jejunum, and ileum samples by using Trizol reagent (Invitrogen, Thermo Fisher Scienctific, USA). The quality and concentration of RNA were assessed using a nano-spectrophotometer P330 (IMPLEN, Germany). Only RNA samples with an A260/A280 ratio between 1.8 and 2.1, A260/A230 ratio > 1.8, and concentrations above 1700 ng/μL were used for cDNA synthesis. According to the kit protocol (Novoprotein Scientific Inc., Jiangsu, China), cDNA was synthesized, and Real-time qPCR was performed by using SYBR qPCR SuperMix Plus. The quantities of mRNA expression of osteoprotegerin (OPG), receptor activator of nuclear factor-κB (RANK), receptor activator of nuclear factor-κB ligand (RANKL), collagen type I alpha 2 chain (COL1A2), IL-1β, IL-6, TNF-α, occludin (OCLN), Zonula occludens 1 (ZO-1), Calcium-binding protein-D28k (CaBP-D28K), Na+/Ca2+ exchanger 1 (NCX1), Na+-dependent Pi transporters Ⅱb (NPt2b), plasma membrane Ca ATPase 1b (PMCA1b), and vitamin D receptor (VDR) relative to β-actin mRNA (used as a housekeeping gene) were determined using the 2−ΔΔCt method by fluorescent quantitative real-time PCR, where ΔCt = Ct target gene − Ct housekeeping gene. The sequences of primers were designed using the Oligo 7.0, synthesized by the Sangon Biotech (Shanghai, China), and presented in Table 1.

Table 1.

Sequence of primers used for RT-qPCR analysis.

Gene GenBank ID PCR Primers sequence (5’ to 3’) PCR Products (bp)
OPG NM_001033641.2 F: TGGCTGAACACCCTTGCAGA
R: ACTGTGCCTTTGTTTAATCCG
81
RANKL NM_001083361.2 F: AAACCTGACTAAAAGAGGGCTTC
R: AGTATTTGGTGCTTCCTCCCTTC
104
RANK XM_004939689.5 F: AGCATTTCTCACCCGTACCCA
R: ATCGTTCTCCCCTACCTCCAC
140
COL1A2 NM_001079714.2 F: GGCTTTGATGCAGAATACTACCG
R: GTTGTTCAATGTTTTCAGAGTGGC
90
OCLN XM_025144247.1 F: ATCGTCATCCTGCTCTGCCTCATCT
R: CGTTCTTCACCCACTCCTCCAC
142
ZO-1 XM_413773 F: CTTCAGGTGTTTCTCTTCCTCCTC
R: CTGTGGTTTCATGGCTGGATC
131
IL-1β NM_204524.1 F: GGTCAACATCGCCACCTACA
R: CATACGAGATGGAAACCAGCAA
86
IL-6 NM_204628.1 F: AAATCCCTCCTCGCCAATCT
R: CCCTCACGCTCTTCTCCATAAA
106
TNF-ɑ NM_204267.2 F: GGACAGCCTATGCCAACAAG
R: ACACGACAGCCAAGTCAACG
168
CaBP-D28K NM_205513.2 F: GTGCAAAAGAGTTCAATAAAGCC
R: AGAGATCCTTCAGTAGTGCAT
96
NCX1 NM_001398209.1 F: GTCTACTGCCACCGTCACC
R: GGGCACAATAACATTTCCTCGT
148
NPt2b NM_204474.3 F: ACTGGCTTGCTGTGTTTGC
R: AGGGGCATCTTCACCACTTT
107
PMCA1b NM_001168002.4 F: AGCTCAAGATGGTGCAGCTA
R: AACAAACCTGCTTTGCCAATCT
165
VDR NM_205098.2 F: CACCGGCTTCCACTTCAACGC
R: AACATCGCTTTCCTCTTCATGCT
81
β-actin NM_205518.2 F: GATATTGCTGCGCTCGTTGT
R: TACCAACCATCACACCCTGAT
152

Microbial diversity analysis

Total microbial genomic DNA was extracted from each collected cecal content samples using the Stool DNA Extraction Kit (YuHua, Shanghai, China) according to the manufacturer’s instructions. DNA samples were evaluated by 1.0% agarose gel electrophoresis and a NanoDrop2000 spectrophotometer (Thermo Scientific, United States) to ensure suitability for downstream applications. The hypervariable region V3-V4 of the bacterial 16S rRNA gene were amplified with primer pairs 338F (5′-ACTCCTACGGGAGGCAGCAG-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3′) by T100 Thermal Cycler PCR thermocycler (BIO-RAD, USA). Amplification success was confirmed by gel electrophoresis prior to sequencing.

The PCR product was extracted from 2% agarose gel and purified using the PCR Clean-Up Kit (YuHua, Shanghai, China) according to manufacturer’s instructions and quantified using Qubit 4.0 (Thermo Fisher Scientific, USA). Purified amplicons were pooled in equimolar amounts and paired-end sequenced on an Illumina PE300/PE250 platform (Illumina, San Diego, USA) according to the standard protocols by Majorbio Bio-Pharm Technology Co. Ltd. (Shanghai, China). The raw sequencing reads were deposited into the NCBI Sequence Read Archive (SRA) database (Accession Number: SRP521400).

After demultiplexing, the resulting sequences were quality filtered with fastp (0.19.6) and merged with FLASH (v1.2.11). Then the high-quality sequences were de-noised using DADA2 plugin in the Qiime2 (version 2020.2) pipeline with recommended parameters, which obtains single nucleotide resolution based on error profiles within samples. DADA2 denoised sequences were used for checking the amplicon sequence variants (ASV). To minimize the effects of sequencing depth on alpha and beta diversity measures, the number of sequences from each sample was rarefied to 20,000, which still yielded an average Good’s coverage of 97.90%. Taxonomic assignment of ASVs was performed using the Naive bayes consensus taxonomy classifier implemented in Qiime2 and the SILVA 16S rRNA database (version 138). The false discovery rate (FDR) adjusted P-value (q-value) was used for multiple comparisons using the Benjamini–Hochberg method. A corrected q-value < 0.05 was considered statistically significant.

Statistical analysis

The data were analyzed by using SPSS 22.0 (IBM Co., USA). Statistical unit was cage (n = 10). The T-test was used to analyze the differences between the CONT and CMT groups, and a One-way ANOVA was used to analyze the gut microbiota differences among the CONT, CMT (recipients), and DONOR groups. Values were expressed as mean ± SEM, P < 0.05 were considered statistically significant.

Results

Growth and organ index

The transplantation of cecal microbiota from adult laying hens had no significant impact on the body weight as well as the index of the bursa of fabricius, liver, spleen, and thymus of chicks (P > 0.05, Table 2).

Table 2.

Effects of CMT on the body weight and organ indexes in chicks.

Parameters CONT CMT SEM P
Body weight (kg) 0.38 0.36 0.01 0.33
bursa of fabricius index (g/kg) 6.55 7.16 0.55 0.28
Liver index (g/kg) 28.92 28.30 0.95 0.53
Spleen index (g/kg) 2.12 2.19 0.16 0.65
Thymus index (g/kg) 6.39 6.54 0.55 0.79

CONT = control group, chicks treated with normal saline; CMT = cecal microbiota transplantation treated chicks.

Values are represented by Mean ± SEM, (n = 10).

Blood differential leukocyte count, bone turnover biochemical indicators, and proinflammatory parameters

There were no significant treatment effects on the counts of heterophilies granulocytes, lymphocytes, eosinophilic granulocytes, basophilic granulocytes, and monocytes between the CONT and CMT chicks (P > 0.05, Table 3). In addition, H/L ratio was no significant different between CONT and CMT chicks (P > 0.05). CMT treatment also did not significantly affect the levels of ALP and TRACP as well as the levels of proinflammatory cytokines, IL-1, IL-6, and TNF-ɑ (P > 0.05).

Table 3.

Effects of CMT on differential leukocyte counts, bone metabolism, and serum immune parameters of chicks.

Parameters CONT CMT SEM P
Heterophilic granulocyte 47.65 46.45 2.03 0.56
Lymphocyte 44.90 45.95 2.00 0.61
H/L ratio 1.08 1.02 0.09 0.48
Eosinophilic granulocyte 2.50 2.75 0.53 0.64
Basophilic granulocyte 3.85 3.55 0.58 0.61
Monocyte 1.10 1.30 0.39 0.62
ALP (U/L) 4344.88 3820.23 1019.74 0.61
TRACP(U/L) 3.30 4.70 0.85 0.12
IL-1 (ng/L) 43.18 43.34 3.34 0.96
IL-6 (ng/L) 8.63 11.20 1.62 0.13
TNF-ɑ (ng/L) 15.29 14.61 1.16 0.57

CONT = control group, chicks treated with normal saline; CMT = cecal microbiota transplantation treated chicks. H/L = heterophil-to-lymphocyte; ALP = alkaline phosphatase; TRACP = tartrate-resistant acid phosphatase; IL-1 = interleukin-1; IL-6 = interleukin-6; TNF-α = tumor necrosis factor-alpha.

Values are represented by Mean ± SEM, (n = 10).

Ca and P retention

There were no treatment effects on both feed intake and Ca intake (P > 0.05, Table 4). However, compared with CONT chicks, CMT chicks had higher blood levels of Ca (P = 0.001) and P (P = 0.007). The P content (P < 0.001) in the femur and the Ca and P contents (P < 0.011) in feces were significantly reduced in CMT chicks. Additionally, CMT chicks had lower Ca (P < 0.05) and P excretions (P < 0.05) with a significant increase in both Ca and P retention rates (P < 0.01).

Table 4.

Effects of CMT on mineral absorption, bone mineral contents, and mineral retention in chicks.

Parameters CONT CMT SEM P
Diet
Feed intake, g/day 30.36 28.50 2.49 0.48
Ca intake, mg/day 578.93 543.42 47.51 0.48
Serum
Ca (mmol/L) 1.68 1.98* 0.07 0.001
P (mmol/L) 1.81 2.12* 0.09 0.007
Femur
Bone ash, % 43.87 45.18 0.91 0.17
Ca, mg/g 138.41 141.80 2.53 0.20
P, mg/g 80.02 72.85* 1.37 <0.001
Excrement
Dry excrement weight, g 12.94 13.04 1.09 0.94
Ca, mg/g 28.34 21.37* 1.27 0.002
P, mg/g 12.73 9.89* 0.55 0.002
Ca in excrement, mg/day 367.89 277.79* 31.65 0.030
Ca retention, mg/day 211.04 265.63 26.26 0.08
Ca retention rate, % 36.64 48.72* 2.72 0.004
P in excrement, mg/day 164.86 129.13* 14.50 0.049
P retention, mg/day 109.09 128.01 9.70 0.1
P retention rate, % 39.97 49.81* 1.55 0.001

Values are represented by Mean ± SEM. *P < 0.05, (n = 10).

CONT = control group, chicks treated with normal saline; CMT = cecal microbiota transplantation treated chicks.

Bone morphology and mRNA expression of bone formation related genes

There were no treatment effects on the length, diameter, volume, and weight of both the tibia and femur (P > 0.05, Table 5). In addition, the CMT treatment had no significant impact on the levels of OPG, COL1A2, RANK, and RANKL mRNA expressions in the femur (P > 0.05, Fig. 1).

Table 5.

Effects of CMT on bone morphology in chicks.

Parameters CONT CMT SEM P
Femur
Length, cm 49.85 48.75 0.96 0.27
Diameter, mm 4.87 4.69 0.13 0.16
Volume, mL 1.94 1.85 0.17 0.58
Weight, g 2.09 1.97 0.13 0.39
Relative weight, g/kg 5.52 5.42 0.19 0.63
Tibia
Length, cm 70.26 68.73 1.41 0.29
Diameter, mm 4.30 4.17 0.09 0.16
Volume, mL 2.95 2.90 0.21 0.82
Weight, g 3.33 3.13 0.17 0.28
Relative weight, g/kg 8.80 8.63 0.19 0.40

CONT = control group, chicks treated with normal saline; CMT = cecal microbiota transplantation treated chicks. Values are represented by Mean ± SEM (n=10).Relative weight = bone weight, g/ body weight, kg.

Fig. 1.

Fig 1

Effects of CMT on mRNA expression of bone-related genes in the left femur.

CONT = control group, chicks treated with normal saline; CMT = cecal microbiota transplantation treated chicks.

OPG = osteoprotegerin; RANKL = receptor activator for nuclear factor-κ B ligand; RANK = receptor activator of nuclear factor-κB; COL1A2 = collagen type I alpha 2 chain. Values are represented by Mean ± SEM, (n = 10).

Intestinal morphological and pH values of intestinal content

There were no treatment effects on the VL, CD, and VL/CD ratio of the small intestine (the duodenum, jejunum, and ileum) (P > 0.05, Fig. 2A, B, C), but the pH value of the ileum while not the duodenum and jejunum was significantly lower in CMT chicks compared to CONT chicks (P < 0.05, Fig. 2D).

Fig. 2.

Fig 2

The effects of CMT on the intestinal histomorphology and intestinal pH levels of chicks. (A) The villous height (VH) (B) the crypt depth (CD) (C) the VH/CD ratio (D) the intestinal pH-value; (E) the intestinal histomorphology of 34-day-old chicks.

CONT = control group, chicks treated with normal saline; CMT = cecal microbiota transplantation treated chicks. Values are represented by Mean ± SEM, * P < 0.05 (n=10).

mRNA expression of intestinal tight junction protein, inflammatory factors and Ca and P transporter factor

There was no significant difference in the levels of OCLN mRNA expressions in the duodenum, jejunum, and ileum between CONT and CMT chicks (P > 0.05, Fig. 3A), however, the expression level of ZO-1 mRNA in the duodenum was significantly higher in CMT chicks than in CONT chicks (P < 0.05). Moreover, compared with CONT chicks, CMT chicks had an increased mRNA expressions of IL-1β and TNF-ɑ in the jejunum, as well as IL - 6 in the duodenum (P < 0.05, Fig. 3B).

Fig. 3.

Fig 3

Effects of CMT on the mRNA expression of intestinal tight junction protein and inflammatory factor genes and genes related to intestinal calcium and phosphorus transporters in chicks. (A) The OCLN and ZO-1 mRNA expression; (B) the IL-1β, IL-6 and TNF-ɑ mRNA expression; (C) The CaBP-D28k, NCX1, PMCAlb, NPt2b and VDR mRNA expression.

CONT = control group, chicks treated with normal saline; CMT = cecal microbiota transplantation treated chicks OCLN = occludin; ZO-1 = zonula occludens 1; IL-1β = interleukin-1β; IL-6 = interleukin-6; TNF-α = tumor necrosis factor-alpha; CaBP-D28k = Ca-binding protein-D28k; NCX1 = Na+/Ca2+ exchanger 1; PMCAlb = plasma membrane Ca ATPase 1b; NPt2b = Na+-dependent Pi transporters Ⅱb; VDR = Vitamin D receptor. Values are represented by Mean ± SEM, * P < 0.05 (n = 10).

The mRNA expressions of CaBP- D28k (P < 0.05, Fig. 3C) and VDR (P < 0.05,) in the ileum as well as NCX1 in the jejunum (P < 0.05) were significantly increased in CMT chicks compared to CONT chicks. However, no significant effect of CMT was detected on the levels of PMCAlb (P > 0.05) and NPt2b (P > 0.05) mRNA expressions in the duodenum, jejunum, and ileum.

Cecal bacterial composition

The analysis of the gut microbial composition revealed there were significant differences in the cecal microbiota diversity among the CONT, CMT, and DONOR groups. Shannon diversity index analysis demonstrated a strong alpha diversity in both CMT and DONOR groups, indicating well-diversified gut microbial community in both groups, compared to CONT group (Fig. 4A). Venn analysis highlighted 85 microbial species shared across the three groups, with 58 species unique to both the CMT and DONOR groups but only 7 species shared between the CONT and DONOR groups (Fig. 4B). Principal Coordinate Analysis (PCoA) revealed a distinct clustering of microbial communities, the microbiota composition of CMT group was more similar to that of DONOR group than CONT group (P = 0.001, Fig. 4C). Fig. 4D and 4E illustrated the cecal microbial profiles of the top 20 abundant species at the phylum and genus levels, respectively. At the phylum level, similar to donor laying hens, the phyla of Bacteroidetes and Firmicutes were predominant in both CONT and CMT chicks, while the abundances of some phyla were significantly different among three groups (P < 0.05) including the phyla Spirochactota, Desulfobacterota, Deferribacterota, Campilobacterota, and unclassified_k__norank_d__Bacteria. At the genus level, Bacteroides (P = 0.02) predominates in both CMT and DONOR groups, while Alistipes (P = 0.02) was the most abundant genus in CONT group. Additionally, other genera were significantly different among groups (P < 0.05), including Rikenellaceae_RC9_gut_group, Lactobacillus, Prevotellaceae_UCG - 001, Ruminococcus_torques_group, Barnesiella, norank_f__norank_o__Clostridia_vadinBB60_group, Parabacteroides, Desulfovibrio, and unclassified_f__Tannerellaceae (Fig. 4E). Compared to CONT group, the relative abundances of Bacteroides, Rikenellaceae_RC9_gut_group, Ruminococcus_torques_group, Parabacteroides, Desulfovibrio, and unclassified_f__Tannerellaceae were increased (P < 0.05), whereas the relative abundances of Alistipes, Lactobacillus, Barnesiella, and norank_f__norank_o__Clostridia_vadinBB60_group were decreased in the cecum of CMT chicks (P < 0.05. Additional file 1). The Spearman correlation heatmap revealed several notable associations between microbial genera and key physiological markers involved in calcium metabolism and gut health (Fig. 4F). Serum Ca level was positively correlated with Bacteroides and Prevotellaceae_UCG-001, while negatively correlated with Alistipes, Lactobacillus, and Barnesiella. Serum P level was positively correlated with Bacteroides. Additionally, several microbial genera showed strong positive correlations with the expression of ZO-1 (a tight junction protein) and calcium transporters such as NCX1 and VDR. Specifically, the expression of duodenal ZO-1 was positively correlated with Ruminococcus_torques_group, Prevotellaceae_UCG-001, and unclassified_f__Tannerellaceae, while negatively correlated with Alistipes, Lactobacillus, Barnesiella, and norank_f__norank_o__Clostridia_vadinBB60_group. The expression of jejunal NCX1 was positively correlated with Bacteroides. The expression of ileal VDR was positively correlated with Bacteroides, Rikenellaceae_RC9_gut_group, and Prevotellaceae_UCG-001, while negatively correlated with Lactobacillus and Barnesiella.

Fig. 4.

Fig 4

Effects of CMT on the cecal microbiota composition of chicks. (A) The Shannon index analysis; (B) the Venn analysis; (C) the PCoA analysis; (D) Percent of community abundance at phylum level; (E) Percent of community abundance at genus level; (F) Heatmap of correlation analysis.

CONT = control group, chicks treated with normal saline (n=10); CMT = cecal microbiota transplantation treated chicks (n=10); DONOR = adult laying hens providing for the cecum contents (n=12).

Values are represented by mean ± SEM, * P < 0.05 (n = 10).

Discussion

Calcium and P are critical mineral elements involved in bone remodeling, which is particularly important in laying hens (Sinclair-Black et al., 2023). Dietary Ca and P are the major sources for the body to utilize, and their resorption in the GIT affects biological homeostasis, skeletal health, and egg production. Gut microbiota plays a critical role in the mineral resorption process (Skrypnik & Suliburska, 2018; Hao et al., 2019). A study has shown that Ca digestibility was significantly improved in Duroc × Landrace × Yorkshire (DLY) pigs received FMT from Ningxiang (NX) pigs (Li et al., 2024). The differences of the gut microbiota composition and metabolites between DLY pigs and obese NX pigs have been identified (Yang et al., 2025). Similarly, in our study, the differences in the gut microbiota composition between the donors, Lohmann Pink-shell adult laying hens, and the recipients, Lohmann Pink chicks, have been identified and CMT from the donors led to significant changes in Ca metabolism in recipients. A significant increase in Ca retention was revealed in CMT chicks. Moreover, CMT chicks exhibited increased serum Ca and P levels compared to CONT chicks. This is coupled with a significant reduction of the Ca and P contents in feces, suggesting improved absorption of these essential minerals from the GIT.

The increased Ca retention is likely affected by multiple factors. One contributing factor is the upregulations of the mRNA expressions of the critical Ca transporters in the GIT, such as CaBP-D28k, VDR, and NCX1, were detected in CMT chicks. These transporters play essential roles in Ca uptake and Ca homeostasis (Diaz de Barboza et al., 2015; Khattar et al., 2022). Similar findings have been documented in several previous studies. One study reported that dietary supplementation with Bacillus subtilis enhanced the expression of CaBP-D28K mRNA in the duodenum of laying hens during the late laying stage, subsequently leading to improved intestinal Ca absorption, elevated serum Ca levels, and enhanced eggshell quality (Wang et al., 2021). Therefore, it is likely CMT positively affects Ca retention in chicks by increasing intestinal Ca absorption through upregulating these key transporters.

Tight junctions are essential to the function of the intestinal barrier, regulating transfer of various substances across the intestinal epithelia, including Ca and P minerals (Lee et al., 2018). Disruption of the tight junctions in intestinal dysbiosis is associated with both local and systemic diseases (Paradis et al., 2021; Horowitz et al., 2023). In the current study, ZO-1, a key tight junction protein in the poultry intestinal tract, was significantly upregulated in the duodenum of CMT chicks, indicating an enhanced intestinal barrier in the duodenum. The duodenum functions to continue digestive processes and to enable the absorption of various nutrients including minerals in the following segments of the small intestines via receiving various hormones from the liver, gallbladder, and pancreas (Bildstein et al., 2024). The current finding may indicate that transferred microbiota from adult hens via CMT may strengthen the integrity of tight junctions in growing chicks. Our study further revealed the positive effect of CMT on the intestinal barrier of newly hatched chicks, indicating a reduced Ca loss through the intestinal tract. Additionally, CMT chicks had a lower ileal pH level compared to CONT chicks. Paralleled to the previous findings (Behera et al., 2020), our findings supported there is a positive association between the lowered ileal pH and increased Ca retention. In addition, the avian cecum, a primary site of fermentation, plays a key role in synthesizing short chain fatty acids (SCFAs) (Ramírez et al., 2020). The current and previous findings suggest that SCFAs producing bacteria may be favored by CMT lowering the intestinal pH, thereby increasing Ca solubility in the intestinal lumen, ultimately enhancing Ca absorption.

In addition to Ca, the current study found that CMT had a notable effect on increasing P retention in treated chicks. Laying hens are facing a challenge in efficiently utilizing P to reduce substantial P loss through excrement, which contributes not only to bone damage (Teng et al., 2020; Wei et al., 2022) but also environmental pollution (Symeon et al., 2025). Phosphorus pollution in grazing lands and lands applied poultry manure has become an increasing concern, highlighting the need to reduce P excretion and improve P utilization in laying hens (Faridi et al., 2015). One previous study has demonstrated positive effects of supplementing Enterococcus faecium on broiler production. In treated broilers, the abundance of SCFAs and P absorption in the intestines were increased while the P excretion was reduced (Wang et al., 2020). Similarly, our study recorded a significant elevation in serum P level as well as a reduction in P excretion, suggesting an increase in intestinal P absorption in CMT chicks. It is possible that altered intestinal microenvironment such as lower intestinal pH by CMT contributes to the increased P absorption. However, the lack of evidence for CMT effects on bone metabolism in this study suggested that P may not be a major contributor to bone formation at the early life stage (day 1 to day 34). The reduced femoral P levels may be affected by various factors, such as redistribution of P for other physiological needs due to its multiple functions involving in maintenance of biological homeostasis via the neuro-endocrine-immune pathway (Wagner, 2024). The current results suggest a potential of regulating P utilization to reduce both skeletal damage and environmental pollution via manipulating gut microbiota. However, the exact regulatory mechanisms of P utilization involved in the gut microbiota modulation require further investigation.

Gut microbiota plays an essential role in maintaining intestinal integrity as well as facilitating nutrient digestion and absorption. The findings of our study have also demonstrated that CMT is able to involve in establishing gut microbiota composition in newly hatched chicks and further contributes to increased Ca and P retentions. Chicks received CMT developed a more diverse and mature microbial community at the end of the study (day 34), supported by the highest α and β diversities of the gut microbiota in CMT chicks, which is closely similar to those of DONOR adult hens. CMT significantly altered the relative abundances of certain bacterial phyla and genera, increasing the presence of beneficial bacteria such as Bacteroides, Prevotellaceae_UCG-001, Rikenellaceae_RC9_gut_group, and Parabacteroides. All of them belong to phylum Bacteroidetes, and some of them are known to regulate host sensitivity to inflammation (Bálint et al., 2020; Wu et al., 2022; Yang et al., 2022). This finding aligns with a previous study utilizing FMT, in which it similarly reported increased abundances of these four genera in FMT chicks, alongside enhanced resistance to Salmonella Enteritidis infection (Wang et al., 2022). Additionally, in the present study, Bacteroides and Prevotellaceae_UCG-001 were positively correlated with serum Ca concentration, while Bacteroides was also positively correlated with serum P concentration, suggesting their potential roles in enhancing Ca and P absorption. In one of our previous studies, it demonstrated an association between increased Ca retention and lower ileal pH value as well as a negative correlation between the relative abundance of Prevotellaceae_UCG-001 and ileal pH value in a low Ca diet fed laying hens (Jiang et al., 2023). Given the similarly decreased ileal pH values seen in this study, Prevotellaceae_UCG-001 might contribute to Ca homeostasis by regulating Ca absorption. While research on Prevotellaceae_UCG-001 remains limited, it is worth noting that both Prevotellaceae_UCG-001 and Prevotella belong to the family Prevotellaceae (Zhao et al., 2017). Prevotellaceae_UCG-001 may have similar functions as Prevotella in maintaining a host’s biological homeostasis (Chen et al., 2021). It has been reported that Prevotella is a strictly anaerobic polymorphic bacillus with function in fermenting substrates to produce SCFAs, such as acetate and succinate (Takahashi & Yamada, 2000). It has been recognized as a dietary fiber fermenter and a potential biomarker for detecting gut physiological homeostasis, attracting considerable attention in recent studies (Li et al., 2024). Notably, Prevotella histicola, a representative species of Prevotella, has been shown to mitigate intestinal inflammation and to alleviate depressive behaviors and neuronal damage in mice with estrogen deficiency-induced depression through modulating the gut microbiota (Huang et al., 2022). Additionally, Prevotella histicola has been found to reduce intestinal permeability by enhancing the expression of intestinal tight junction proteins and reducing the inflammatory response in estrogen deficiency-induced osteoporosis mouse model, where it functionally inhibits osteoclast production and mitigates bone loss. Although the specific functions of Prevotellaceae_UCG-001 were not examined in this study, we observed a positive correlation between Prevotellaceae_UCG-001 and the expression of ZO-1 mRNA in the duodenum as well as VDR mRNA expression in the ileum, supporting its potential role in maintaining intestinal integrity and enhancing Ca absorption. Consequently, it further supports our hypothesis that the increased abundance of Prevotellaceae_UCG-001 is linked to Ca retention, and Prevotellaceae_UCG-001 in CMT chicks may play a similar role in regulating bone metabolism as that of Prevotella histicola (Wang et al., 2021; Zhang et al., 2022). Future research using germ-free models or in vitro co-culture of Prevotellaceae_UCG-001 with intestinal epithelial cells is needed to determine whether this bacterial genus exerts a direct regulatory effect on calcium transport pathways. Nevertheless, our findings highlighted a potential mechanism by which the gut microbiota modulates the Ca and P retention, reinforcing the impact of CMT on intestinal integrity and nutrient absorption.

On the other hand, CMT significantly reduced the relative abundance of Alistipes, Lactobacillus, and Barnesiella in the cecum of treated chicks. Both Alistipes and Barnesiella are members of the phylum Bacteroidetes and are often considered as a part of the normal gut microbiota (Torok et al., 2011). However, the effects of Alistipes on gut health appear contradictory, as some studies suggest it contributes to microbial diversity and stability with protective effects against certain diseases, while others consider it associates with pathogenic outcomes (Parker et al., 2020). Interestingly, Alistipes has been shown to express glutamate decarboxylase which is an enzyme metabolizing glutamate into γ-aminobutyric acid (GABA) in chickens (Polansky et al., 2015), implying the potential role of gut microbiota on brain function and behavioral exhibition. Meanwhile, Barnesiella is often known for its role in eliminating gut pathogens and regulating immune responses (Wu et al., 2021). However, in poultry, it has been associated with proinflammatory reactions. Two studies on dietary supplements in broiler chickens have linked both Alistipes and Barnesiella to intestinal dysbiosis and exacerbated inflammation (Wu et al., 2021; Song et al., 2023a). Lactobacillus, on the other hand, is widely known for its beneficial effects in maintaining gut health and promoting intestinal integrity. It is a common probiotic choice to promote weight gain in poultry (Wang et al., 2014; Fesseha et al., 2021) . In our study, Lactobacillus was significantly less abundant in CMT chicks and, along with Alistipes and Barnesiella, negatively correlated with the expression levels of ZO-1 mRNA in the duodenum. Notably, there are a wide variety of Lactobacillus strains in the intestinal tract and the beneficial effects of Lactobacillus are strain-specific (Jha et al., 2020). One study reported supplementation with Lactobacillus plantarum S27 improved food intake and body weight gain in broiler chickens (Benbara et al., 2020), while another study using a probiotic mixing four Lactobacillus spp. (L. salivarius, L. reuteri, L. ingluviei, and L. alvi) showed no resistance to Salmonella Enteritidis infection and related negative effects on production in chickens (Juricova et al., 2022). These findings highlight the need for further analysis at the species- or even strain-level to better characterize the effect of Lactobacillus on chicken gut health. Nevertheless, in our study, Alistipes, Lactobacillus, and Barnesiella were largely negatively correlated with Ca levels as well as ZO-1 and Ca transporters mRNA expression. Reduced abundance of these bacteria in CMT chicks further supports a positive effect of CMT on the integrity of the intestinal barrier and Ca absorption.

Despite the positive effects of CMT on Ca and P absorption and retention as well as the gut microbial community shifts, no significant differences were observed in the body weight and organ indexes of the bursa of fabricius, liver, spleen, and thymus. It suggests that CMT might not have a major immediate effect on these specific organs at the early life stage conducted in the study. Nevertheless, CMT did not induce a stress response in the chicks over the period of the trial time, as evidenced by the lack of significant differences in the hematological parameters such as the H/L ratio, a marker of chronic stress (Thiam et al., 2021) between the control and CMT groups.

CMT did not significantly affect bone morphology or gene expression related to bone metabolism. Both the tibia and femur of CMT chicks were not different in length, diameter, volume, or weight compared to those of CONT group. CMT also did not cause significant differences in the mRNA expression of OPG, RANK, RANKL, and COL1A2, and OPG/RANKL ratio. OPG, RANK, and RANKL are key genes involving in osteoclastogenesis (osteoclast maturation and bone modeling and remodeling), and their relative concentrations in bone have been used as major indicators of increasing bone mass and strength (Wang et al., 2014; Song et al., 2023a). COL1A2 is highly expressed in osteoblasts during bone formation with a widely recognized role in osteogenesis (Teng et al., 2020). The current results indicate that the bacteria transferred from adult hens through CMT did not have negative effects on bone development in treated chicks. This is in contrast to a previous study in mice, which reported suppression of these bone-related factors following an 8-week FMT treatment (Zhang et al., 2022). In addition, our findings showed that CMT did not result in changes in TRACP and ALP serum levels. ALP and TRACP play opposing roles in bone metabolism, ALP involved in osteoblast-mediated bone formation while TRACP involved in osteoclast-mediated bone resorption (Tang et al., 2020). Alterations in ALP and TRACP levels have been used as markers of bone formation and absorption in various diseases (Takahashi et al., 2024). Additionally, the mRNA expressions of proinflammatory cytokines IL-1β, TNF-α, and IL-6 were found to be elevated in both the duodenum and jejunum, which might reflect a local immune response triggered by the presence of foreign microbial communities brought by CMT. It is noteworthy that inflammatory cytokines also function as key effectors in bone resorption via activating the immune-skeletal pathway through the RANKL/RANK/OPG axis. One study reported that increased inflammatory cytokine actively associate with enhanced bone turnover in mice (Weitzmann, 2013). Whether this immune activation is transient or trigger long-term changes in the chick’s gut will require further research with a longer experimental period of time. In addition, the absence of a multiple-dose regimen may have limited the extent of its observable effects on bone-related outcomes. The selected dose was based on previous studies (Fu et al., 2023; Khalid et al., 2024), however, without yielded significant improvements in Ca and P retention and transporter expression may indicate that a dose–depended responding approach might produce more pronounced effects on bone formation. The hypothesis will be examined in the coming study. Taken together, the current results suggest that the beneficial effects of CMT on Ca absorption did not translate into immediate structural changes in bone formation process, at least, during the early developmental stage in chickens. It is possible that the effects may become evident over a longer period of time. Further research with extended experiment period is needed to track skeletal development through the laying period, when Ca metabolism and bone turnover are most dynamically regulated.

Conclusion

This study revealed that cecal contents from adult laying hens enhanced Ca absorption and retention in newly hatched chicks by upregulating critical Ca transporters, strengthening the intestinal barrier, and modulating gut microbiota composition. Notably, CMT did not yield significant improvements in growth, bone morphology, and osteogenic gene expression within the experimental period of early life stage. These findings highlighted the potential use of CMT as a management tool for improving Ca metabolism via remodulating gut microbiome in poultry while also underscoring its limitations regarding skeletal development within the short term. Future studies are necessary to explore the long-term effects of CMT on bone health and productivity in laying hens, especially follow-up the time windows during puberty and early sexual maturity with high bone remodeling resulted from egg production.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgments

This research was supported by Chongqing Municipal Technology Innovation and Application Development Project (CSTB2024TIAD -KPX0007), Southwest Uuniversity Graduate Scientific Research Innovation Project (SWUS23139) and Southwest University Scientific Research Start-up Funding Project (SWU-KR25009).

Mention of trade names or commercial products in this article is solely for the purpose of providing specific information and does not imply recommendation or endorsement of the USDA. The USDA is an equal opportunity provider and employer.

Footnotes

Scientific Section: Animal Well-Being and Behavior

Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.psj.2025.105437.

Appendix. Supplementary materials

mmc1.docx (3.6MB, docx)

References

  1. Andary C.M., Al K.F., Chmiel J.A., Gibbons S., Daisley B.A., Parvathy S.N., Maleki Vareki S., Bowdish D.M.E., Silverman M.S., Burton J.P. Dissecting mechanisms of fecal microbiota transplantation efficacy in disease. Trends Mol. Med. 2024;30:209–222. doi: 10.1016/j.molmed.2023.12.005. [DOI] [PubMed] [Google Scholar]
  2. Bálint A., Farkas K., Méhi O., Kintses B., Vásárhelyi B.M., Ari E., Pál C., Madácsy T., Maléth J., Szántó K.J., Nagy I., Rutka M., Bacsur P., Szűcs D., Szepes Z., Nagy F., Fábián A., Bor R., Milassin Á., Molnár T. Functional anatomical changes in ulcerative colitis patients determine their gut microbiota composition and consequently the possible treatment outcome. Pharmaceuticals. 2020;13:346. doi: 10.3390/ph13110346. (Basel) [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Behera J., Ison J., Tyagi S.C., Tyagi N. The role of gut microbiota in bone homeostasis. Bone. 2020;135 doi: 10.1016/j.bone.2020.115317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Benbara T., Lalouche S., Drider D., Bendali F. Lactobacillus plantarum s27 from chicken faeces as a potential probiotic to replace antibiotics: in vivo evidence. Benef Microbes. 2020;11:163–173. doi: 10.3920/BM2019.0116. [DOI] [PubMed] [Google Scholar]
  5. Bernard R., Hourigan S.K., Nicholson M.R. Fecal microbiota transplantation and microbial therapeutics for the treatment of Clostridioides difficile infection in pediatric patients. J. Pediatric Infect. Dis. Soc. 2021;10:S58–S63. doi: 10.1093/jpids/piab056. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bildstein T., Charbit-Henrion F., Azabdaftari A., Cerf-Bensussan N., Uhlig H.H. Cellular and molecular basis of proximal small intestine disorders. Nat. Rev. Gastroenterol. Hepatol. 2024;21:687–709. doi: 10.1038/s41575-024-00962-9. [DOI] [PubMed] [Google Scholar]
  7. Bishop S.C., Fleming R.H., McCormack H.A., Flock D.K., Whitehead C.C. Inheritance of bone characteristics affecting osteoporosis in laying hens. Br. Poult. Sci. 2000;41:33–40. doi: 10.1080/00071660086376. [DOI] [PubMed] [Google Scholar]
  8. Cao S., Guo D., Yin H., Ding X., Bai S., Zeng Q., Liu J., Zhang K., Mao X., Wang J. Improvement in ovarian function following fecal microbiota transplantation from high-laying rate breeders. Poult. Sci. 2023;102 doi: 10.1016/j.psj.2022.102467. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chen C.Y., Chen C.K., Chen Y.Y., Fang A., Shaw G.T., Hung C.M., Wang D. Maternal gut microbes shape the early-life assembly of gut microbiota in passerine chicks via nests. Microbiome. 2020;8:129. doi: 10.1186/s40168-020-00896-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chen X., Su X., Li J., Yang Y., Wang P., Yan F., Yao J., Wu S. Real-time monitoring of ruminal microbiota reveals their roles in dairy goats during subacute ruminal acidosis. NPJ Biofilms Microbiomes. 2021;7:45. doi: 10.1038/s41522-021-00215-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Diaz de Barboza G., Guizzardi S., Tolosa de Talamoni N. Molecular aspects of intestinal calcium absorption. World J. Gastroenterol. 2015;21:7142–7154. doi: 10.3748/wjg.v21.i23.7142. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Diez-Méndez D., Bodawatta K.H., Freiberga I., Klečková I., Jønsson K.A., Poulsen M., Sam K. Indirect maternal effects via nest microbiome composition drive gut colonization in altricial chicks. Mol. Ecol. 2023;32:3657–3671. doi: 10.1111/mec.16959. [DOI] [PubMed] [Google Scholar]
  13. Eiseman B., Silen W., Bascom G.S., Kauvar A.J. Fecal enema as an adjunct in the treatment of pseudomembranous enterocolitis. Surgery. 1958;44:854–859. [PubMed] [Google Scholar]
  14. Faridi A., Gitoee A., France J. A meta-analysis of the effects of nonphytate phosphorus on broiler performance and tibia ash concentration. Poult. Sci. 2015;94:2753–2762. doi: 10.3382/ps/pev280. [DOI] [PubMed] [Google Scholar]
  15. Fesseha H., Demlie T., Mathewos M., Eshetu E. Effect of Lactobacillus species probiotics on growth performance of dual-purpose chicken. Vet. Med. 2021;12:75–83. doi: 10.2147/VMRR.S300881. (Auckl) [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Fleming R.H. Nutritional factors affecting poultry bone health. Proc. Nutr. Soc. 2008;67:177–183. doi: 10.1017/S0029665108007015. [DOI] [PubMed] [Google Scholar]
  17. Fleming R.H., McCormack H.A., McTeir L., Whitehead C.C. Medullary bone and humeral breaking strength in laying hens. Res. Vet. Sci. 1998;64:63–67. doi: 10.1016/s0034-5288(98)90117-5. [DOI] [PubMed] [Google Scholar]
  18. Fu Y., Hu J., Erasmus M.A., Johnson T.A., Cheng H.W. Effects of early-life cecal microbiota transplantation from divergently selected inbred chicken lines on growth, gut serotonin, and immune parameters in recipient chickens. Poult. Sci. 2022;101 doi: 10.1016/j.psj.2022.101925. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Fu Y., Hu J., Erasmus M.A., Zhang H., Johnson T.A., Cheng H. Cecal microbiota transplantation: unique influence of cecal microbiota from divergently selected inbred donor lines on cecal microbial profile, serotonergic activity, and aggressive behavior of recipient chickens. J. Anim. Sci. Biotechnol. 2023;14:66. doi: 10.1186/s40104-023-00866-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Grüner N., Ortlepp A.L., Mattner J. Pivotal role of intestinal microbiota and intraluminal metabolites for the maintenance of gut-bone physiology. Int. J. Mol. Sci. 2023;24:5161. doi: 10.3390/ijms24065161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Gupta S., Allen-Vercoe E., Petrof E.O. Fecal microbiota transplantation: in perspective. Therap. Adv. Gastroenterol. 2016;9:229–239. doi: 10.1177/1756283X15607414. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Hao M.L., Wang G.Y., Zuo X.Q., Qu C.J., Yao B.C., Wang D.L. Gut microbiota: an overlooked factor that plays a significant role in osteoporosis. J. Int. Med. Res. 2019;47:4095–4103. doi: 10.1177/0300060519860027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Horowitz A., Chanez-Paredes S.D., Haest X., Turner J.R. Paracellular permeability and tight junction regulation in gut health and disease. Nat. Rev. Gastroenterol. Hepatol. 2023;20:417–432. doi: 10.1038/s41575-023-00766-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Huang F., Liu X., Xu S., Hu S., Wang S., Shi D., Wang K., Wang Z., Lin Q., Li S., Zhao S., Jin K., Wang C., Chen L., Wang F. Prevotella histicola mitigated estrogen deficiency-induced depression via gut microbiota-dependent modulation of inflammation in ovariectomized mice. Front. Nutr. 2022;8 doi: 10.3389/fnut.2021.805465. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Jha R., Das R., Oak S., Mishra P. Probiotics (direct-fed microbials) in poultry nutrition and their effects on nutrient utilization, growth and laying performance, and gut health: a systematic review. Animals (Basel) 2020;10:1863. doi: 10.3390/ani10101863. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Jiang S., Cheng H.W., Cui L.Y., Zhou Z.L., Hou J.F. Changes of blood parameters associated with bone remodeling following experimentally induced fatty liver disorder in laying hens. Poult. Sci. 2013;92:1443–1453. doi: 10.3382/ps.2012-02800. [DOI] [PubMed] [Google Scholar]
  27. Jiang S., Zou X.Y., Mao M., Zhang M., Tu W.J., Jin M.L. Low Ca diet leads to increased Ca retention by changing the gut flora and ileal ph value in laying hens. Anim. Nutr. 2023;13:270–281. doi: 10.1016/j.aninu.2023.02.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Juricova H., Matiasovicova J., Faldynova M., Sebkova A., Kubasova T., Prikrylova H., Karasova D., Crhanova M., Havlickova H., Rychlik I. Probiotic lactobacilli do not protect chickens against Salmonella Enteritidis infection by competitive exclusion in the intestinal tract but in feed, outside the chicken host. Microorganisms. 2022;10:219. doi: 10.3390/microorganisms10020219. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Khalid A., Huang Z., Khan I.M., Khalid F., Nassar N., Jiang X., Cheng M., Zhan K., Wang Z. Improving broiler health through cecal microbiota transplantation: a comprehensive study on growth, immunity, and microbial diversity. J. Anim. Sci. 2024;102:skae131. doi: 10.1093/jas/skae131. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Khattar V., Wang L., Peng J.B. Calcium selective channel Trpv6: structure, function, and implications in health and disease. Gene. 2022;817 doi: 10.1016/j.gene.2022.146192. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Kim W.K., Bloomfield S.A., Sugiyama T., Ricke S.C. Concepts and methods for understanding bone metabolism in laying hens. Worlds Poult. Sci. J. 2012;68:71–82. [Google Scholar]
  32. Kolesnik E., Derkho M., Strizhikov V., Strizhikova S., Sereda T., Gizatullina F., Rebezov M. Functional morphology of birds’ blood leukocytes. J. Exp. Biol. 2020;8:S374–S380. [Google Scholar]
  33. Kubasova T., Kollarcikova M., Crhanova M., Karasova D., Cejkova D., Sebkova A., Matiasovicova J., Faldynova M., Pokorna A., Cizek A., Rychlik I. Contact with adult hen affects development of caecal microbiota in newly hatched chicks. PLoS One. 2019;14 doi: 10.1371/journal.pone.0212446. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Lee B., Moon K.M., Kim C.Y. Tight junction in the intestinal epithelium: its association with diseases and regulation by phytochemicals. J. Immunol. Res. 2018;2018 doi: 10.1155/2018/2645465. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Lee M.D., Ipharraguerre I.R., Arsenault R.J., Lyte M., Lyte J.M., Humphrey B., Angel R., Korver D.R. Informal nutrition symposium: leveraging the microbiome (and the metabolome) for poultry production. Poult. Sci. 2022;101 doi: 10.1016/j.psj.2021.101588. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Lei J., Dong Y., Hou Q., He Y., Lai Y., Liao C., Kawamura Y., Li J., Zhang B. Intestinal microbiota regulate certain meat quality parameters in chicken. Front. Nutr. 2022;9 doi: 10.3389/fnut.2022.747705. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Li H., Han L., Zhou F., Wu Z., Zhang L., Xie R., Jiang F., Tian Q., Huang X. Ningxiang pig-derived microbiota affects the growth performance, gut microbiota, and serum metabolome of nursery pigs. Animals. 2024;14:2450. doi: 10.3390/ani14172450. (Basel) [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Li X., Bi R., Xiao K., Roy A., Zhang Z., Chen X., Peng J., Wang R., Yang R., Shen X., Irwin D.M., Shen Y. Hen raising helps chicks establish gut microbiota in their early life and improve microbiota stability after H9N2 challenge. Microbiome. 2022;10:14. doi: 10.1186/s40168-021-01200-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Liu Q., Akhtar M., Kong N., Zhang R., Liang Y., Gu Y., Yang D., Nafady A.A., Shi D., Ansari A.R., Abdel-Kafy E.-S.M., Naqvi S.U.-A.-S., Liu H. Early fecal microbiota transplantation continuously improves chicken growth performance by inhibiting age-related Lactobacillus decline in jejunum. Microbiome. 2025;13:49. doi: 10.1186/s40168-024-02021-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Locantore P., Del Gatto V., Gelli S., Paragliola R.M., Pontecorvi A. The interplay between immune system and microbiota in osteoporosis. Mediators Inflamm. 2020;2020 doi: 10.1155/2020/3686749. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Lyte J.M., Eckenberger J., Keane J., Robinson K., Bacon T., Assumpcao A.L.F.V., Donoghue A.M., Liyanage R., Daniels K.M., Caputi V., Lyte M. Cold stress initiates catecholaminergic and serotonergic responses in the chicken gut that are associated with functional shifts in the microbiome. Poult. Sci. 2024;103 doi: 10.1016/j.psj.2023.103393. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Ma S., Wang N., Zhang P., Wu W., Fu L. Fecal microbiota transplantation mitigates bone loss by improving gut microbiome composition and gut barrier function in aged rats. PeerJ. 2021;9 doi: 10.7717/peerj.12293. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Ma Z., Akhtar M., Pan H., Liu Q., Chen Y., Zhou X., You Y., Shi D., Liu H. Fecal microbiota transplantation improves chicken growth performance by balancing jejunal Th17/treg cells. Microbiome. 2023;11:137. doi: 10.1186/s40168-023-01569-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Marcolla C.S., Ju T., Willing B.P., Elkins C.A. Cecal microbiota development and physiological responses of broilers following early life microbial inoculation using different delivery methods and microbial sources. Appl. Environ. Microbiol. 2023;89 doi: 10.1128/aem.00271-23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Metzler-Zebeli B.U., Siegerstetter S.-C., Magowan E., Lawlor P.G., O′Connell N.E., Zebeli Q. Fecal microbiota transplant from highly feed efficient donors affects cecal physiology and microbiota in low- and high-feed efficient chickens. Front. Microbiol. 2019;10:1576. doi: 10.3389/fmicb.2019.01576. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Nurmi E., Rantala M. New aspects of salmonella infection in broiler production. Nature. 1973;241:210–211. doi: 10.1038/241210a0. [DOI] [PubMed] [Google Scholar]
  47. Pang J., Beyi A.F., Looft T., Zhang Q., Sahin O. Fecal microbiota transplantation reduces Campylobacter jejuni colonization in young broiler chickens challenged by oral gavage but not by seeder birds. Antibiotics. 2023;12:1503. doi: 10.3390/antibiotics12101503. (Basel) [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Paradis T., Bègue H., Basmaciyan L., Dalle F., Bon F. Tight junctions as a key for pathogens invasion in intestinal epithelial cells. Int. J. Mol. Sci. 2021;22:2506. doi: 10.3390/ijms22052506. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Parker B.J., Wearsch P.A., Veloo A.C.M., Rodriguez-Palacios A. The genus Alistipes: gut bacteria with emerging implications to inflammation, cancer, and mental health. Front. Immunol. 2020;11:906. doi: 10.3389/fimmu.2020.00906. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Polansky O., Sekelova Z., Faldynova M., Sebkova A., Sisak F., Rychlik I. Important metabolic pathways and biological processes expressed by chicken cecal microbiota. Appl. Environ. Microbiol. 2015;82:1569–1576. doi: 10.1128/AEM.03473-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Ramírez G.A., Richardson E., Clark J., Keshri J., Drechsler Y., Berrang M.E., Meinersmann R.J., Cox N.A., Oakley B.B. Broiler chickens and early life programming: microbiome transplant-induced cecal community dynamics and phenotypic effects. PLoS One. 2020;15 doi: 10.1371/journal.pone.0242108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Rubio L.A. Possibilities of early life programming in broiler chickens via intestinal microbiota modulation. Poult. Sci. 2019;98:695–706. doi: 10.3382/ps/pey416. [DOI] [PubMed] [Google Scholar]
  53. Rychlik I. Composition and function of chicken gut microbiota. Animals. 2020;10:103. doi: 10.3390/ani10010103. (Basel) [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Shterzer N., Rothschild N., Sbehat Y., Dayan J., Eytan D., Uni Z., Mills E. Vertical transmission of gut bacteria in commercial chickens is limited. Anim. Microbiome. 2023;5:50. doi: 10.1186/s42523-023-00272-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Sinclair-Black M., Garcia R.A., Ellestad L.E. Physiological regulation of calcium and phosphorus utilization in laying hens. Front. Physiol. 2023;14 doi: 10.3389/fphys.2023.1112499. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Skrypnik K., Suliburska J. Association between the gut microbiota and mineral metabolism. J. Sci. Food Agric. 2018;98:2449–2460. doi: 10.1002/jsfa.8724. [DOI] [PubMed] [Google Scholar]
  57. Song B., He J., Pan X., Kong L., Xiao C., Keerqin C., Song Z. Dietary Macleaya cordata extract supplementation improves the growth performance and gut health of broiler chickens with necrotic enteritis. J. Anim. Sci. Biotechnol. 2023;14:113. doi: 10.1186/s40104-023-00916-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Song Y., Cui Y., Wang Y., Wang T., Zhong Y., Liu J., Zheng X. The effect and potential mechanism of inulin combined with fecal microbiota transplantation on early intestinal immune function in chicks. Sci. Rep. 2024;14 doi: 10.1038/s41598-024-67881-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Song Y., Yu J., Wang B., Wen Q., Zhong Y., Wu M., Zheng X. Effect of fecal microbiota transplantation on early intestinal immune function and histomorphology of immune organs in chicks. Lett. Appl. Microbiol. 2023;76:ovad140. doi: 10.1093/lambio/ovad140. [DOI] [PubMed] [Google Scholar]
  60. Stanley D., Geier M.S., Chen H., Hughes R.J., Moore R.J. Comparison of fecal and cecal microbiotas reveals qualitative similarities but quantitative differences. BMC Microbiol. 2015;15:51. doi: 10.1186/s12866-015-0388-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Sumano-Lopez H., Carrillo-Gonzalez L., Monroy-Barreto M., Tapia-Perez G., Olvera L.G. Bioavailability of four calcium sources in the second-cycle egg-producing hens. J. Appl. Poult. Res. 2021;30 [Google Scholar]
  62. Symeon G.K., Akamati K., Dotas V., Karatosidi D., Bizelis I., Laliotis G.P. Manure management as a potential mitigation tool to eliminate greenhouse gas emissions in livestock systems. Sustainability. 2025;17:586. [Google Scholar]
  63. Takahashi K., Ikeda K., Hara-Isono K., Nitta A., Nagano N., Arimitsu T. Discordant responses of bone formation and absorption markers in Japanese infants with vitamin D deficiency: a comprehensive matched case-control study. JBMR Plus. 2024;8:ziae033. doi: 10.1093/jbmrpl/ziae033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Takahashi N., Yamada T. Pathways for amino acid metabolism by Prevotella intermedia and Prevotella nigrescens. Oral Microbiol. Immunol. 2000;15:96–102. doi: 10.1034/j.1399-302x.2000.150205.x. [DOI] [PubMed] [Google Scholar]
  65. Tang X.F., Ma Z.T., Gao Y.Y., Wang H., Li X.X., Yu P., Liu R.H. Systemic osteoprotective effects of Epimedii Folium and Ligustri Lucidi Fructus in senile osteoporosis rats by promoting the osteoblastogenesis and osteoclastogenesis based on MLP-ANN model. Chin. Med. 2020;15:87. doi: 10.1186/s13020-020-00368-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Teng X., Zhang W., Xu D., Liu Z., Yang N., Luo D., Wang H., Ge M., Zhang R. Effects of low dietary phosphorus on tibia quality and metabolism in caged laying hens. Prev. Vet. Med. 2020;181 doi: 10.1016/j.prevetmed.2020.105049. [DOI] [PubMed] [Google Scholar]
  67. Thiam M., Barreto Sánchez A.L., Zhang J., Zheng M., Wen J., Zhao G., Wang Q. Association of heterophil/lymphocyte ratio with intestinal barrier function and immune response to Salmonella enteritidis infection in chicken. Animals. 2021;11:3498. doi: 10.3390/ani11123498. (Basel) [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Torok V.A., Hughes R.J., Mikkelsen L.L., Perez-Maldonado R., Balding K., MacAlpine R., Percy N.J., Ophel-Keller K. Identification and characterization of potential performance-related gut microbiotas in broiler chickens across various feeding trials. Appl. Environ. Microbiol. 2011;77:5868–5878. doi: 10.1128/AEM.00165-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. van Veelen H.P.J., Salles J.F., Tieleman B.I. Microbiome assembly of avian eggshells and their potential as transgenerational carriers of maternal microbiota. ISME J. 2018;12:1375–1388. doi: 10.1038/s41396-018-0067-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Wagner C.A. The basics of phosphate metabolism. Nephrol. Dial. Transplant. 2024;39:190–201. doi: 10.1093/ndt/gfad188. [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Wang J., Wang W.W., Qi G.H., Cui C.F., Wu S.G., Zhang H.J., Xu L., Wang J. Effects of dietary Bacillus subtilis supplementation and calcium levels on performance and eggshell quality of laying hens in the late phase of production. Poult. Sci. 2021;100 doi: 10.1016/j.psj.2020.12.067. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Wang L., Fang M., Hu Y., Yang Y., Yang M., Chen Y. Characterization of the most abundant Lactobacillus species in chicken gastrointestinal tract and potential use as probiotics for genetic engineering. Acta. Biochim. Biophys. Sin. 2014;46:612–619. doi: 10.1093/abbs/gmu037. (Shanghai) [DOI] [PubMed] [Google Scholar]
  73. Wang W., Cai H., Zhang A., Chen Z., Chang W., Liu G., Deng X., Bryden W.L., Zheng A. Enterococcus faecium modulates the gut microbiota of broilers and enhances phosphorus absorption and utilization. Animals. 2020;10:1232. doi: 10.3390/ani10071232. (Basel) [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Wang X., Wu X.J., Cong X.Y., Ren J.R., Li J.T., Zhu J.S., Dai M.X., Hrabchenko N., Du Y.J., Qi J. The functional role of fecal microbiota transplantation on Salmonella Enteritidis infection in chicks. Vet. Microbiol. 2022;269 doi: 10.1016/j.vetmic.2022.109449. [DOI] [PubMed] [Google Scholar]
  75. Wei H., Bi Y., Li Y., Zhang H., Li J., Zhang R., Bao J. Low dietary phosphorus impairs keel bone health and quality in laying hens. Br. Poult. Sci. 2022;63:73–81. doi: 10.1080/00071668.2021.1960951. [DOI] [PubMed] [Google Scholar]
  76. Weitzmann M.N. The role of inflammatory cytokines, the rankl/opg axis, and the immunoskeletal interface in physiological bone turnover and osteoporosis. Scientifica. 2013;2013 doi: 10.1155/2013/125705. (Cairo) [DOI] [PMC free article] [PubMed] [Google Scholar]
  77. Whitehead C.C., Fleming R.H. Osteoporosis in cage layers. Poult. Sci. 2000;79:1033–1041. doi: 10.1093/ps/79.7.1033. [DOI] [PubMed] [Google Scholar]
  78. Wu Y., Wu C., Che Y., Zhang T., Dai C., Nguyễn A.D., Duan K., Huang Y., Li N., Zhou H., Wan X., Wang Y., Lei H., Hao P., Li C., Wu Y. Effects of glycyrrhiza polysaccharides on chickens' intestinal health and homeostasis. Front. Vet. Sci. 2022;9 doi: 10.3389/fvets.2022.891429. [DOI] [PMC free article] [PubMed] [Google Scholar]
  79. Wu Y.P., Li Q., Liu J.S., Liu Y.L., Xu Y.L., Zhang R.Q., Yu Y., Wang Y.X., Yang C.M. Integrating serum metabolome and gut microbiome to evaluate the benefits of lauric acid on lipopolysaccharide- challenged broilers. Front. Immunol. 2021;12 doi: 10.3389/fimmu.2021.759323. [DOI] [PMC free article] [PubMed] [Google Scholar]
  80. Yang M., Xie Q., Wang J., Zha A., Chen J., Jiang Q., Kang M., Deng Q., Yin Y., Tan B. Ningxiang pig-derived lactobacillus reuteri modulates host intramuscular fat deposition via branched-chain amino acid metabolism. Microbiome. 2025;13:32. doi: 10.1186/s40168-024-02013-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  81. Yang X., Tai Y., Ma Y., Xu Z., Hao J., Han D., Li J., Deng X. Cecum microbiome and metabolism characteristics of silky fowl and white leghorn chicken in late laying stages. Front. Microbiol. 2022;13 doi: 10.3389/fmicb.2022.984654. [DOI] [PMC free article] [PubMed] [Google Scholar]
  82. Yu J., Zhou Y., Wen Q., Wang B., Gong H., Zhu L., Lan H., Wu B., Lang W., Zheng X. Effects of faecal microbiota transplantation on the growth performance, intestinal microbiota, jejunum morphology and immune function of laying-type chicks. Anim. Prod. Sci. 2021;62:321–332. [Google Scholar]
  83. Yue Y., Luasiri P., Li J., Laosam P., Sangsawad P. Research advancements on the diversity and host interaction of gut microbiota in chickens. Front. Vet. Sci. 2024;11 doi: 10.3389/fvets.2024.1492545. [DOI] [PMC free article] [PubMed] [Google Scholar]
  84. Zhang Y.W., Cao M.M., Li Y.J., Lu P.P., Dai G.C., Zhang M., Wang H., Rui Y.F. Fecal microbiota transplantation ameliorates bone loss in mice with ovariectomy-induced osteoporosis via modulating gut microbiota and metabolic function. J. Orthop. Translat. 2022;37:46–60. doi: 10.1016/j.jot.2022.08.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  85. Zhao S.C., Teng X.Q., Xu D.L., Chi X., Ge M., Xu S.W. Influences of low level of dietary calcium on bone characters in laying hens. Poult. Sci. 2020;99:7084–7091. doi: 10.1016/j.psj.2020.08.057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  86. Zhao X.H., Chen Z.D., Zhou S., Song X.Z., Ouyang K.H., Pan K., Xu L.J., Liu C.J., Qu M.R. Effects of daidzein on performance, serum metabolites, nutrient digestibility, and fecal bacterial community in bull calves. Anim. Feed Sci. Technol. 2017;225:87–96. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

mmc1.docx (3.6MB, docx)

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES