Protocol for investigating phase transition of prion-like proteins in vitro with concentration variation

Summary

Protein concentration is an important factor regulating liquid-to-solid phase transition of proteins with prion-like domains (PLDs). Here, we present a protocol for investigating the effect of prion-like protein concentration on phase transition of fibrillarin (FBL) condensates in vitro using phase separation assays. We describe steps for construction of fluorescent-protein-tagged FBL plasmids, protein expression and purification in vitro, and detection of condensed states of FBL. This protocol has potential applications in phase separation assays for studying phase transitions in any prion-like protein.

For complete details on the use and execution of this protocol, please refer to Sun et al.¹

Graphical abstract

Highlights

• •Steps for constructing pET-N-GST-Thrombin-C-His plasmids with FBL-EGFP fusion segments
• •Instructions for high-yield expression and purification of FBL-EGFP protein in vitro
• •Guidance on detecting liquid-to-solid phase transition of prion-like proteins

Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.

Protein concentration is an important factor regulating liquid-to-solid phase transition of proteins with prion-like domains (PLDs). Here, we present a protocol for investigating the effect of prion-like protein concentration on phase transition of fibrillarin (FBL) condensates in vitro using phase separation assays. We describe steps for construction of fluorescent-protein-tagged FBL plasmids, protein expression and purification in vitro, and detection of condensed states of FBL. This protocol has potential applications in phase separation assays for studying phase transitions in any prion-like protein.

Before you begin

Rationale for the method development

Fibrillarin (FBL) is a key phase-separated prion-like protein which is essential for the formation of the dense fibrillar component (FDC) in nucleolus and plays a crucial role in pre-rRNA processing.^2,3,4,5 FBL shows the phase transition feature, which initially undergoes liquid-liquid phase separation and resulting droplets exhibit a more solid-like phase along with time in vitro.⁶ However, there is a lack of streamlined approach for researching prion-like protein phase transition as a function of protein concentration. The following protocol describes the detailed procedures to construct a prion-like protein purification system that yields high protein concentration, and quantitative measurement of the condensed state. More importantly, this protocol can be widely applied to other prion-like proteins to study the phase transition process.

Primer design

Timing: 2 days

To facilitate observation of FBL protein condensates, we employed a fluorescent tag (EGFP) fusion strategy. Furthermore, the incorporation of either a His-tag or GST-tag enables efficient purification of the FBL-EGFP fusion protein. For this protocol, we utilized the pET-N-GST-Thrombin-C-His plasmid (Beyotime, D2911) for protein expression and subsequent purification.

Note: We employ a histidine tag (His-tag) for protein purification. Ni²⁺ is typically the preferred metal ion in affinity chromatography columns for isolating His-tagged recombinant proteins from cellular contaminants.

• 1.Retrieve the mRNA coding sequence (CDS) of the FBL protein from the National Center for Biotechnology Information (NCBI) using the accession number NM_001436.4.

Note: Expression of eukaryotic proteins in prokaryotic systems typically requires codon optimization. In this protocol, we employed the Transetta(DE3) strain, which provides tRNAs for rare codons to enhance protein expression efficiency. For alternative expression systems, codon optimization should be considered.

• 2.Get EGFP sequence from MSCV-EGFP plasmid (Addgene, Cat#91975).
• 3.Select the suitable restriction enzyme sites. Here, we choose the XbaI and XhoI, for the enzyme site sequences matching the multiple cloning site (MCS) in the pET plasmid and can digest the pET vector to remove GST.

Note: We employ a Ni²⁺ affinity column for protein purification. The GST tag is not utilized as its relatively large molecular size may interfere with the phase behavior of the FBL protein.

• 4.
  Design a homologous arm on each side of the FBL-EGFP fusion segment, one of which is repeat of the last 20 base pairs (bp) of the fusion segments and the other is the same as the first 20 bp of the vector adjacent to the inserts correspondingly.

  Note: Here, we should design two paired primers for fusion PCR which ligate two DNA segments through the overlapping sequences of the primers. The primers used in this study are listed in the key resources table.

  Optional: Free online tools such as NEBuilder (https://nebuilder.neb.com/) can be used to assist in primer design.

  CRITICAL: Taking into consideration the information above, primers should have the following properties: (1) Melting temperature (Tm) of 55°C–65°C and primer pairs should have a Tm within 5°C of each other. (2) The primer for amplifying FBL should retain the start codon and remove the stop codon for the fusion EGFP in the C-terminal. (3) The primer for amplifying EGFP should remove the start codon and stop codon for the His tag in the C-terminal. (4) Ensure that the FBL-EGFP insert is in-frame with the His-tag coding sequence in the vector to facilitate proper protein translation. (5) Primer design can be performed using Primer Premier 5 software.

• 5.Synthesize and purify the primers with PAGE gel from Ruibiotech, Guangzhou, China.

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
FBL (1:1,000)	Proteintech	Cat# 66985-1-Ig; RRID: AB_2882303
Multi-rAb HRP-goat anti-rabbit recombinant secondary antibody (H+L) (1:10,000)	Proteintech	Cat# RGAR001; RRID: AB_3073505
Bacterial and virus strains
Transetta (DE3)	TransGen Biotech	Cat# CD801
Chemicals, peptides, and recombinant proteins
IPTG (isopropyl β-D-thiogalactoside)	TransGen Biotech	Cat# GF101
Halt protease inhibitor cocktail, EDTA-free (100×)	Thermo Fisher Scientific	Cat# 78425
HisTrap FF	Cytiva	Cat# 17531901
Superose 6 10/300 GL	Cytiva	Cat# 17517201
Thioflavin T (ThT)	Sigma-Aldrich	Cat# T3516
Tris Base	Sigma-Aldrich	Cat# 77-86-1
NaCl	Sigma-Aldrich	Cat# S7653
β-mercaptoethanol (BME)	Sigma-Aldrich	Cat# 444203
Glycerol	Solarbio	Cat# G8192
Phosphatebuffered saline (PBS)	MIKX	Cat# CE362
Lysozyme	Macklin	Cat# 5836553
Imidazole	Solarbio	Cat# 288-32-4
Hydrochloric acid	Sigma-Aldrich	Cat# 258148
Nuclease-free water	Milli-Q	N/A
Phenylmethanesulfonyl fluoride (PMSF)	Beyotime	Cat# ST506
Immobilon PVDF membranes	Merck	Cat# IPVH00010
Skim milk	BD Biosciences	Cat# 232100
Immobilon ECL Ultra western HRP substrate	Merck	Cat# WBULS0500
Coomassie brilliant blue G250	Beyotime	Cat# ST030
Critical commercial assays
HiPure plasmid EF micro kit	Magen	Cat# P1111-03
PrimeScript II 1st strand cDNA synthesis kit	Takara	Cat# 6210A
KOD FX	TOYOBO	Cat# KFX-101
HiPure gel pure DNA mini kit	Magen	Cat# D2111-03
ClonExpress Ultra one step cloning kit	Vazyme	Cat# C115
TGX FastCast acrylamide kit (10%)	Bio-Rad	Cat# 161-0173TA
Takara Bradford protein assay kit	Takara	Cat# T9310A
Oligonucleotides
pET-XbaI-FBL-forward: TGAGCGGATA ACAATTCCCCTCTAGAATGAAGCCA GGATTCAGTCCCCGT	Ruibiotech	N/A
pET-FBL-reverse: AGCTCCTCGCCCTTG CTCACGTTCTTCACCTTGGGGGGTGG	Ruibiotech	N/A
pET-C′-EGFP-forward: CCACCCCCCAAGG TGAAGAACGTGAGCAAGGGCGAGGAGCT	Ruibiotech	N/A
pET-C′-EGFP-XhoI-reverse: CAGTGGTGG TGGTGGTGGTGCTCGAGCTTGTACAGC TCGTCCATGCCCA	Ruibiotech	N/A
pET-forward: AAACGTATTGAAGCTATCCC	Ruibiotech	N/A
pET-reverse: TGCTAGTTATTGCTCAGCGG	Ruibiotech	N/A
Recombinant DNA
pET-FBL-EGFP-His	This paper	N/A
pET-N-GST-Thrombin-C-His	Beyotime	Cat# D2911
MSCV-EGFP	Golden et al.7	Addgene plasmid Cat# 91975
Software and algorithms
Primer Premier 5	PREMIER Biosoft International	https://www.premierbiosoft.com
SnapGene	GSL Biotech LLC	https://www.snapgene.com
Fiji (free)	Schindelin et al.	https://imagej.net/software/fiji/
LAS X	Leica Microsystems	https://www.leica-microsystems.com/products/microscope-software/p/leica-las-x-ls/
GraphPad Prism 8	GraphPad Software	https://www.graphpad.com/; RRID:SCR_002798
Other
ChemiDoc MP imaging system	Bio-Rad	N/A
Ultrasonic generator probe sonicator	SCIENTZ	SCIENTZ-950E
100 × oil-immersion objective lens	Leica HCX PL APO 100×/1,40-0,70 OIL	N/A
Leica TCS SP8X system	Leica Microsystems	N/A
35 mm no. 15 glass-bottomed dishes	MATTEK	N/A

Materials and equipment

Stock solution

Reagent	Final concentration	Amount
Tris	1 M	6.057 g / 50 mL
NaCl	4 M	11.688 g / 50 mL

All the stock solution can be store at 4°C for up to one year.

CRITICAL: Tris base is toxic, wear gloves and a mask to avoid exposure.

Binding buffer

Reagent	Final concentration	Amount
Tris-HCl pH 7.4 (1 M)	20 mM	10 mL
NaCl (4 M)	500 mM	62.5 mL
Imidazole	20 mM	0.68 g
β-mercaptoethanol	12 mM	419.58 μL
ddH2O	N/A	427.5 mL
Total	N/A	500 mL

This buffer can be stored at 4°C up to one year.

The 0.5 mM PMSF should be added before use. PMSF is unstable in water and its half-life may be as short as 35 min under alkaline conditions.

CRITICAL: Hydrochloric acid (HCl) is volatile and harmful, wear gloves, goggles, and face-shield to avoid skin exposure and inhalation. Using HCl in a fume cupboard is better.

CRITICAL: β-mercaptoethanol is toxic and danger, wear gloves, goggles, and face-shield to avoid skin exposure and inhalation. Use only in a chemical fume hood.

Elution buffer

Reagent	Final concentration	Amount
Tris-HCl pH 7.4 (1 M)	20 mM	2 mL
NaCl (4 M)	500 mM	12.5 mL
imidazole	1 M	6.808 g
ddH2O	N/A	85.5 mL
Total	N/A	100 mL

This buffer can be stored at 4°C up to one year.

The 0.5 mM PMSF should be added before use.

Storage buffer

Reagent	Final concentration	Amount
Tris-HCl pH 7.4 (1 M)	20 mM	1 mL
NaCl (4 M)	500 mM	6.25 mL
ddH2O	N/A	42.75 mL
Total	N/A	50 mL

This buffer can be stored at 4°C up to one year.

The 0.5 mM PMSF should be added before use.

The 10% Glycerol should be added after gel filtration.

Dilution buffer

Reagent	Final concentration	Amount
Tris-HCl pH 7.4 (1 M)	20 mM	1 mL
ddH2O	N/A	59 mL
Total	N/A	50 mL

This buffer can be stored at 4°C up to one year.

The 0.5 mM PMSF should be added before use.

Step-by-step method details

pET-FBL-EGFP-His vector construction

Timing: 3 days

This step describes how to construct pET-N-GST-Thrombin-C-His (Beyotime, D2911) plasmids with FBL-EGFP fusion segments for subsequent in vitro protein purification and phase transition assays. Here provides a flow chart to describe this process (Figure 1).

• 1.
  To get the inserted fragment, amplify the FBL-EGFP by PCR using specific primers containing homologous arms. Purify the PCR products by HiPure DNA Mini columns from Hipure Gel Pure DNA Mini kit.

  • a.
    First round of PCR to amplify FBL and EGFP respectively by using primers FBL-F/R and EGFP-F/R respectively (The primers used in this protocol are shown in the key resources table). The templates are cDNA and MSCV-EGFP plasmid respectively. The cDNA was synthesized from RNA extracted from the acute myeloid leukemia cell line MOLM13 using the PrimeScript II 1st Strand cDNA Synthesis Kit.
  • b.
    Perform the second round of PCR (overhang extension PCR) to amplify FBL-EGFP fusion segments by using the primers FBL-F and EGFP-R. The templates are equimolar quantities products from the first round of PCR.

    Reagent	Final concentration	Amount
    2 × PCR buffer for KOD FX	1 ×	25 μL
    2 μM dNTPs	0.4 μM each	10 μL
    10 pmol / μL Primer F	0.3 μM	1.5 μL
    10 pmol / μL Primer R	0.3 μM	1.5 μL
    Template DNA	50 ng	1 μL
    KOD FX enzyme (1 U/μL)	1 U / 50 μL	1 μL
    ddH2O	N/A	10 μL
    Total	N/A	50 μL

  • c.
    PCR reactions with the following conditions.

    PCR cycling conditions
    Steps	Temperature	Time	Cycles
    Predenature	94°C	2 min	1
    Denature	98°C	10 s	35
    Annealing	60°C	30 s	–
    Extension	68°C	1 min/kb	–
    Final extension	68°C	7 min	1
    Hold	12°C	forever	–

• 2.
  pET vector construction for in vitro protein expression. The DNA fragments of FBL coupled with EGFP (FBL-EGFP) were cloned into pET to generate pET-FBL-EGFP-His vectors.

  Note: The pET prokaryotic expression vector contains a His-tag fragment for protein purification through the Ni²⁺ column.

  • a.
    Use XbaI and XhoI to digest the pET vector at 37°C for 15 min. Purify the digested vector by gel electrophoresis in a 1% agarose gel and then extracted by Gel Extraction Kit (Hipure Gel Pure DNA Mini Kit, Magen). The reaction system is as follows:

    Reagent	Final concentration	Amount
    pET vector	1 μg	2 μL
    FastDigest enzyme	1 reaction	1 μL each
    10 × FastDigest Green Buffer	1 ×	2 μL
    ddH2O	N/A	14 μL
    Total	N/A	20 μL

    Note: Use the water thermostat for the incubation, air thermostats are not recommended due to the slow transfer of heat to the reaction mixture. The FastDigest Green Buffer can be used as an electrophoresis loading buffer for any DNA samples at a final 1 × concentration. Higher concentrations of FastDigest Green Buffer in the sample supply excess salt concentration which may alter DNA mobility.

    Optional: Inactivate the enzyme by heating for 5 min at 65°C.

  • b.
    Load the digestion mixture onto DNA gel and perform electrophoresis at 120 V for 30 min. Cut the target fragments with a lancet and purify by Omega DNA Purification Kit.
  • c.
    To obtain the inserted fragment, amplify the FBL-EGFP by PCR using specific primers containing homologous arms. The PCR products were purified by HiPure DNA Mini columns.
• 3.Insert the FBL-EGFP fusion segments into the digested vectors by homologous recombination (Vazyme, C115). The incubation condition is at 50°C for 5 min.

Reagent	Final concentration	Amount
Digested pET vector	0.03 pmol	x μL
FBL-EGFP segments	0.06 pmol	x μL
2 × ClonExpress Mix	1 ×	5 μL
ddH2O	N/A	up to 10 μL
Total	N/A	10 μL

Note: Gently pipette up and down for several times to mix thoroughly. DO NOT VORTEX! Centrifuge briefly to collect the reaction solution at the bottom of the tube for subsequent incubation.

Note: For single-fragment homologous recombination, the optimal amount of vector required is 0.03 pmol, and the optimal amount of insert required is 0.06 pmol (the molar ratio of vector to insert is 1:2). The amounts of linearized vectors and inserts calculates as followed:

Figure 1.

The schematic of pET-FBL-EGFP vector construction

The optimal mass of vector required = [0.02 × number of base pairs] ng (0.03 pmol);

The optimal mass of insert required = [0.04 × number of base pairs] ng (0.06 pmol).

Optional: Alternative kits, such as the In-Fusion HD Cloning Kit (TaKaRa) or NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs), can facilitate the recombination of multiple inserts into linearized plasmids without requiring the overhang extension PCR step.

• 4.
  Transformation.

  • a.
    Thaw the Transetta (DE3) competent bacterial cells on ice for 5 min.

    Optional: The recombinant products can be directly transformed into Transetta (DE3) competent cells for subsequent protein expression. Alternatively, you may select the DH5α cells for miniprep cloning before switching the plasmid into Transetta strain.

  • b.
    Pipette 5–10 μL of the recombination products into 100 μL competent cells, flick the tube wall to mix thoroughly, and then place the tube on ice for 30 min.
  • c.
    Heat shock at 42°C water baths for 45 s and then immediately place on ice for 2-3 min.
  • d.
    Add 900 μL LB liquid medium (without antibiotics). Then, shake at 37°C for 1 h at 200–250 rpm.
  • e.
    Centrifuge at 2,500 g for 5 min, discard 900 μL of supernatant. Then, use the remaining medium to suspend the bacteria and use a sterile spreading rod to gently spread on an agar plate which contains the appropriate selection antibiotic.
  • f.
    Incubate at 37°C for 12–16 h.
• 5.
  Recombinant product identification and DNA sequencing. Troubleshooting 1.

  • a.
    After overnight culture, pick several colonies from the plate of recombination reaction for PCR with the pET-F and pET-R of the vector (these primers used in this protocol are shown in the key resources table).
  • b.
    Positive colonies should exhibit PCR products that migrate slightly above the expected insert size when analyzed by agarose gel electrophoresis.
  • c.
    Send the mono colony bacteria to DNA sequencing. Using SnapGene to visualize and align sequences.

FBL-EGFP protein expression and purification

Timing: 1 week

This step is aims to obtain the high purity FBL-EGFP protein through ӒKTA pure chromatography system (Cytiva, pure GE AKTA) with HisTrap FF(Cytiva) and gel filtration chromatography (Superose 6 10/300 GL, Cytiva). A flow chart was provided to describe this process (Figure 2A).

• 6.Inoculate a fresh, isolated single colony of Transetta (DE3) cells into 5 ml LB media supplemented with 50 ng/μL kanamycin at 200 rpm, 37°C for 14–16 h.
• 7.Dilute the culture 100-fold into 100 ml LB media supplemented with 50 ng/μL kanamycin. Incubate at 37°C with shaking (200 rpm) until the OD₆₀₀ reaches 0.6–0.8 (approximately 4 h).

Note: It is recommended to measure the optical density (OD₆₀₀) of the bacterial suspension and proceed only when it reaches 0.6–0.8. If the OD₆₀₀ exceeds 0.8, it is advisable to restart the bacterial culture from step 6. Optimal protein expression requires bacterial cells to be in the logarithmic growth phase.

• 8.Add IPTG (0.25 mM) to the bacterial suspension after complete cooling of LB at 19°C. Incubate at 19°C at 180 rpm for 16 h. Troubleshooting 2.

Note: The temperature in this step is to avoid the inclusion bodies formation.

• 9.Harvest cell pellets by centrifugation at 2,500 g at 4°C for 15 min. The bacterial pellets which express EGFP protein exhibit green fluorescence (Figure 2B).
• 10.Wash cell pellets twice with PBS (Phosphate Buffered Saline), and resuspended in 30 ml binding buffer containing protease inhibitors (PMSF) and with 2 mg/ml lysozyme rotated at 4°C for 30 min.

Note: Buffers should be prepared from the highest available grade reagents and water, filtered through a 0.22 μm filter and degassed thoroughly by ultrasonic bath.

Note: Do not include DTT in the binding buffer, as it may reduce the Ni²⁺ ions in the column, thereby decreasing the binding efficiency of the target protein.

• 11.Sonicate the cell pellets on ice using 300W power in pulse mode (3 s on, 5 s off) for 30 min (Figure 2C).

Note: Use the 6 mm ultrasonic probe and keep the detector below in the middle of the solution all the working time.

CRITICAL: Sonication generates heat which may destroy proteins. To maintain protein stability, keep the sample on ice during sonication process.

• 12.Clear the lysates by centrifugation at 13,000 g for 15 min at 4°C.
• 13.Filter the supernatant cell lysates through a 0.22 μm filter (Figure 2D).

Note: For additional purification, we employ a 0.22 μm filter to remove potentially intact bacterial cells that may not have been completely lysed by sonication, thereby preventing clogging of the chromatography system. If subsequent purification steps are not required, a 0.45 μm filter may be used as an alternative.

• 14.
  Use ӒKTA pure chromatography system (Cytiva, pure GE AKTA) coupled with HisTrap FF (1 mL, Cytiva) to purify high purity FBL-EGFP (Figure 3). Troubleshooting 3.

  Note: The entire purification process should be maintained at 4°C. We recommend placing the complete chromatography system in a 4°C cold room or refrigerator.

  • a.
    Turn on the purification system, after the instrument self-test complete, double-click the UNICORN icon on the desktop, to enter the operator interface.
  • b.
    Cleaning and pipeline preparation.

    • i.
      Wash all inlets thoroughly with distilled water. Subsequently, equilibrate inlets A1 and A2 with 10 column volumes of binding buffer, and equilibrate inlet B1 with 10 column volumes of elution buffer.
    • ii.
      Insert the inlet of pipeline A1 into the binding buffer and the inlet of pipeline B1 into the elution buffer.

      Note: keep the inlet pipeline number coordinated with the ‘process picture’ window.

    • iii.
      Click ‘manual’ in the toolbar of the system control window.
    • iv.
      Orderly select ‘execute manual instructions’, ‘pump’, ‘pump A wash’, ‘pump B wash’.
    • v.
      Select the inlets A1 and B1, and click ‘execute’. The pumping and washing will stop automatically after completion.
  • c.
    Installation of chromatographic column.

    • i.
      In the manual instructions, select ‘Pump’, ‘System Flow’, enter the flow rate of 1 ml/min, click ‘insert’.
    • ii.
      Select ‘Alarms’, ‘alarm precolumn pressure’, set the ‘high alarm’, ‘insert’, ‘execute’.

      Note: The ‘high alarm’ is the tolerated pressure of the packing, which can be found in the column packing manual. Here, we use HisTrap FF (Cytiva, 1 mL), prepacked with Ni Sepharose 6 Fast Flow resin, that the max flow rate is 4 ml/min for 1 ml column.

    • iii.
      After the solution flows out of the No. 1 pipeline of the Injection Valve, connect the pipeline to the upper end of the HisTrap FF column.
    • iv.
      Slightly tighten and then remove the snap-off end at the column outlet and connect it to the pipeline, and connect it to the chromatography system.
  • d.
    Purification.

    • i.
      Equilibrate the column with at least 5 column volumes of binding buffer. Recommended flow rates are 1 ml/min for the 1 ml columns (Figures 4A and 4B).

      Note: If the column contains 20% ethanol, wash it with 5 column volumes of distilled water before equilibration. Use a linear flow rate of 1 ml/min.

    • ii.
      Select the detection wavelength: ‘Monitors’, ‘Wavelength’, ‘UV1’, ‘UV2’, ‘UV3’. Wait for the column balance well (when the absorbance trends flat). Then zeroing the UV (select ‘Monitors’, ‘auto zero UV’, ‘execute’).
    • iii.
      Apply the pretreated protein sample in inlet A2 (Figure 4C).
    • iv.
      Wash with binding buffer until the absorbance reaches the baseline (generally, at least 10 to 15 column volumes) (Figure 4D).

      Note: Purification results are improved by using imidazole in sample and binding buffer. Finding the optimal imidazole concentration for a specific histidine-tagged protein is a trial-and-error effort, but 20 to 40 mM in the binding and wash buffer is a good starting point for many proteins.

    • v.
      Elute with the mix of elution buffer and binding buffer using the linear gradient (Figure 4E).

      Note: For step elution, 5 column volumes of elution buffer are usually sufficient. Here, we collected in 1 ml eluted protein sample per tube. For linear gradient, a shallow gradient over 20 column volumes, may separate proteins with similar binding strengths.

      Note: The binding buffer and elution buffer contained 500 mM NaCl to prevent solid-like phase separation of FBL-EGFP in vitro.⁸

    • vi.
      Set the fraction collection, tube type, and enter the collecting volume of each tube to collect the purified protein (Figure 4E).

      Note: With the elution buffer ratio increasing, the His-tagged protein has been eluted in some tube which show a distinct absorption peak at 280 nm (Figure 5A). When the elution buffer accounted for approximately 70%, FBL-EGFP was efficiently eluted (Figure 5B).

  • e.
    Clean the pump and discharge the lower chromatographic column (Figure 4F).

    • i.
      Put the B2 inlets into 20% ethanol and operate in the same way to fill the entire pipeline with ethanol.
    • ii.
      Give the system a slow flow rate, set the system protection pressure, and then disassemble the column.

      Note: First disassemble the lower end of the column and screw the plug on in a dripping state. Then disassemble the upper end joint of the column and screw on the upper plug. The whole process prevents air from entering the column.

• 15.
  Use gel filtration chromatography (Superose 6 10/300 GL, Cytiva) further purify the FBL-EGFP protein.

  Note: Before connecting the Superose column to a chromatography system, ensure there is no air in the tubing and valves.

  • a.
    Remove the storage/shipping device and the stop plug from the column.
  • b.
    Check the upper adapter locked.
  • c.
    Make sure that the column inlet is filled with liquid and connect it drop to-drop to the system.

    Note: Superose 6 swells slightly when transformed from ethanol to water.

  • d.
    To avoid local high backpressure, follow the following steps for initial equilibration:

    • i.
      12 ml distilled water at 0.2 ml/min.
    • ii.
      38 ml distilled water at 0.5 ml/min.
    • iii.
      50 mL eluent at 0.5 mL/min.

      Note: Ensure that the back-pressure over the column does not exceed 1.2 MPa during equilibration.

  • e.
    Load the protein sample (tube 9, 1 ml) collected from the previous elution step onto the gel filtration column using the injection valve.

    Note: For the single absorbance peak obtained in the last elution step (Figure 5A), we selected tubes 9 and 10 (corresponding to the two fractions with the highest peaks) for Coomassie blue staining. Based on the subsequent staining results, tube 9 was chosen for further gel filtration due to its higher yield of FBL-EGFP protein.

  • f.
    Elute the protein using storage buffer without Glycerol at a flow rate of 0.1–0.5 ml/ min (Figure 6). Initiate sequential fraction collection (equal volume, 500 μL/tube) into sample tubes upon protein elution, while simultaneously monitoring and recording the UV absorbance at 280 nm to generate the elution profile.

    Note: If the viscosity of the buffers and samples is high, you may need to choose a lower flow rate to keep the pressure below the recommended limit.

    Note:Figure 6A shows three absorbance peaks from gel filtration chromatography. We collected fractions corresponding to tubes 6, 12, and 21 to represent the different peak samples and performed Coomassie blue-stained SDS-PAGE analysis (Figure 6B). The results confirmed that all fractions contained FBL-EGFP protein. Since FBL oligomerizes in vivo,⁸ these fractions likely represent distinct assembly states of FBL-EGFP: aggregated (tube 6), oligomeric (tube 12), and monomeric (tube 21) forms. Gel filtration chromatography separates components based on molecular size. We subsequently collected fractions from tubes 21–24 (monomeric FBL-EGFP) for further analysis by Coomassie blue staining (Figures 7A and 7B). The results demonstrated that tube 21 contained the highest purity of monomeric FBL-EGFP and was therefore selected for downstream experiments.

  • g.
    Clean the column after 10–20 separation cycles:

    • i.
      Wash the column with 25 ml 0.5 M sodium hydroxide alternatively 0.5 M acetic acid at a flow rate of 0.5 ml/min.
    • ii.
      Immediately rinse the column with 25 ml distilled water followed by at least 50 ml eluent buffer at a flow rate of 0.5 ml/min.

      Note: Before the next run, equilibrate the column until the UV baseline and pH are stable.

• 16.Add final concentration of 10% Glycerol to the collected protein sample and stored at −80°C.

Pause point: The assay would be paused at step 16 and the collected protein should be stored at −80 °C no more than half a year.

• 17.Check the specificity of purified FBL-EGFP-His protein by Coomassie blue staining (Figures 7A and 7B). Troubleshooting 4.
• 18.
  Use TakaRa Bradford Protein Assay to accurately quantify protein concentration.

  Note: If the protein purity is below 95%, we recommend using ELISA or Western blot assays for accurate quantification of recombinant protein concentration.

  • a.
    Prepare dilutions of the BSA standard solution with protein buffer (elution buffer) as shown below.

    Note: Before use, bring the BSA Standard Solution to room temperature or warm in a 20–50°C water bath. After warming, vortex or tap lightly to mix well then briefly spin down.

    2 mg/ml BSA standard (μL)	Diluent (μL)	Final concentration of BSA (μg/mL)
    50	50	1,000
    30	50	750
    20	60	500
    20	140	250
    10	150	125
    5	395	25
    0	100	0 (Blank)

  • b.
    Standard curve and sample measurement:

    • i.
      Dispense 4 μL each of the dilutions of BSA standard solution into the wells of the microtiter plate. Perform at least duplicate measurements (n=2) for each concentration.
    • ii.
      Dispense 4 μL of 100-fold diluted FBL-EGFP sample into microtubes. Perform at least duplicate measurements (n=2) for each sample. It is also possible to prepare a serial dilution of a sample in the same manner as the standard solution for measurement.
    • iii.
      Add 200 μL of the Bradford Dye Reagent and mix immediately.
    • iv.
      Incubate for 5 min at 25°C or room temperature.
    • v.
      Measure absorbance at 595 nm using a plate reader. Use protein buffer (elution buffer) as a zero blank.
    • vi.
      Subtract the average value of blank replicates from the absorbance for all other individual standard measurements, and generate the standard curve. The standard curve generated from BSA measurements and the corresponding protein sample absorbance values are presented in Figure 7C. The molecular weight of FBL-EGFP is 70,000 g/mol. The final concentration of FBL-EGFP protein has been calculated as 993 μM (≈ 1 M).

      Note: It is recommended that samples be measured on the same plate and at the same time as the BSA standards. The measurement time should be controlled within 1 h after the reaction as much as possible.

Figure 2.

Protein expression and sonication before purification

(A) Schemes for protein expression and purification process.

(B) Bacterial pellets show green fluorescence when expressing EGFP.

(C) Bacterial cell pellets should be sonicated on ice.

(D) The supernatant cell lysates are filtered through a 0.22 μm filter.

Figure 3.

Configuration of the ÄKTA pure chromatography system coupled with a HisTrap FF column for affinity purification and a Superose 6 10/300 GL column for gel filtration chromatography

Figure 4.

Parameter settings for the purification system

(A) The process picture displays the current flow path from monitors during a run. The green line showed the open flow path with flow and the gray line showed the closed flow path.

(B) Using Binding Buffer (inlet A1) for equilibration column. Elution Buffer accounted for 0% meaning inlet B1 is closed.

(C) Cell lysate flow through inlet A2 into HisTrap FF column.

(D) Using 10 column volumes Binding Buffer (inlet A1) to wash HisTrap FF column for remove non-specific binding.

(E) Eluent the protein using 5 column volumes in linear gradient manner. Collect protein samples using fraction collector (1 ml per tube).

(F) Using 20% ethanol (inlet B2) to clean the column and system.

Figure 5.

Elution profile of His-tagged FBL-EGFP from the Ni-affinity purification step

(A) A280 nm absorbance profile of FBL-EGFP eluted from Ni-affinity chromatography.

(B) Profile showing the percentage of elution buffer (Buffer B) during FBL-EGFP elution from Ni-affinity purification.

Figure 6.

Purification of FBL-EGFP by gel filtration chromatography

(A) Absorbance peak profile of FBL-EGFP eluted from gel filtration chromatography.

(B) Coomassie blue-stained SDS-PAGE confirming the presence of FBL-EGFP protein in the different absorbance peak fractions.

Figure 7.

Quality assessment of purified FBL-EGFP proteins

(A) Comparison of protein solutions after Ni-affinity purification, SEC purification (Size Exclusion Chromatography), and the original lysate (input).

(B) Coomassie blue-stained SDS-PAGE analysis of different fractions from Ni-affinity purification and SEC purification.

(C) Standard curve generated from BSA measurements and absorbance values of diluted FBL-EGFP protein samples.

In vitro phase separation

Timing: 1 h

This step described that the FBL-EGFP has a strong ability to spontaneously occur Liquid-liquid phase separation (LLPS) and its phase transition with protein concentration alteration.

• 19.Thaw frozen FBL-EGFP aliquots on ice and dilute with dilution buffer to achieve 100 mM NaCl (optimal for phase separation). Adjust FBL-EGFP protein concentration to 200 μM–1.56 μM for experiments.
• 20.Mix protein solutions with varying volumes of salt buffer to achieve the target protein concentration.
• 21.Incubate the solution at 25°C for 45 min, and avoiding the light.

Note: Prolonged light exposure can cause photobleaching of the EGFP protein, potentially compromising fluorescence imaging quality.

• 22.After incubation, examine the droplet formation immediately using TCS SP8X system (Leica Microsystems). Troubleshooting 5.

Phase transition identification

Timing: 3 days

Four methods were described to identify the liquid-to-solid phase transition of FBL protein concentration alteration.

• 23.Observe the phase transition of FBL protein at different protein concentrations (Figure 8A). FBL-EGFP protein underwent phase transitions into a solid-like state in a concentration-dependent manner.
• 24.
  Use Thioflavin T (ThT) to determine the protein aggregates with green fluorescence in vitro (Figure 8B). Follow the following steps for the dye binding assay:

  • a.
    Dissolve ThT in alcohol at a concentration up to 100 mg/ml.

    Note: The ThT working solution should probably be prepared fresh and filtered for each use.

  • b.
    Incubate the high FBL-EGFP concentration solution (100 μM) after phase separation with ThT (5 μM, 20 min, 37°C).
  • c.
    Load one droplet (total volume 1 ml) of the protein mixture onto the 35 mm no. 15 glass-bottomed dishes (MATTEK), and immediately image with a fluorescence microscopy (Leica TCS SP8X) at the excitation and emission of 405 and 482 nm.
• 25.
  Use fast recovery after photobleaching (FRAP) to evaluate the liquid-like behavior of FBL droplets has reduced with increasing concentration (Figures 8C and 8D).

  • a.
    Prepare the proteins at an appropriate concentration in 100 mM NaCl (Sigma); incubate at 25°C for 20 min; load onto a confocal dish (MATTEK); and image using a Leica TCS SP8X confocal microscope with a 100× oil-immersion objective lens (Leica, HCX PL APO 100×/1.40–0.70 OIL).
  • b.
    Apply the laser (488 nm) at a 1 s dwell time to the droplet, and image the recovery on a Leica TCS SP8X confocal microscope for the indicated time periods.
  • c.
    Normalize the fluorescence recovery curves against both the background intensity and the fluorescence intensity of adjacent unbleached cells, and then plot them using GraphPad software.
• 26.
  Use sedimentation experiment, which separate the solid phase protein in precipitation and liquid phase protein suspended in supernatant through the effect of gravity, to explore the solid-like phase of FBL increased with elevated concentration (Figures 8E and 8F).

  • a.
    Dilute the FBL-EGFP protein into concentration gradients (100 μM, 25 μM, 6.25 μM); incubate at 25°C for 30 min for phase separation.
  • b.
    Centrifuge at 12,000 g for 5 min to harvest supernatant and precipitation respectively.
  • c.
    Use western blot to illustrate the formation of FBL fibers in a concentration-dependent manner.

    • i.
      Run the high, middle and low concentrations of FBL supernatant and precipitation lysates samples on reducing SDS-PAGE gels.
    • ii.
      Blot the protein to 0.45 μm PVDF membrane with transfer buffer (containing 2.90 g glycine, 5.80 g Tris, and 200 mL methanol in ddH₂O brought to a final volume of 1 L) in constant current of 280 mA, 90 min.
    • iii.
      Block with 5% skim milk for 1 h at room temperature (about 25°C).
    • iv.
      Incubate overnight (about 12 h) at 4°C in anti-FBL antibody (proteintech, Cat# 66985).
    • v.
      Incubate with Rabbit HRP-conjugated secondary antibody at room temperature (about 25°C) for an hour.
    • vi.
      Develop the blots with Immobilon ECL Ultra Western HRP Substrate (Merck).
    • vii.
      Detect signals in ChemiDoc MP Imaging System (Bio-Rad).

Figure 8.

Phase transition identification of FBL-EGFP

(A) Representative images of phase transition of FBL condensates (green) into a solid-like state in a concentration-dependent manner in vitro. Scale bars, 5 μm.

(B) Stain the FBL aggregates formed at high FBL concentration in vitro with Thioflavin T (ThT). Scale bars, 5 μm.

(C and D) Representative images of FRAP (C) and the mobility of FBL condensates examined by FRAP (D), with Low or high FBL protein concentration in vitro. Scale bars, 1 μm.

(E and F) The schematic of a sedimentation experiment (E) and the representative results were analyzed by western blotting (F) with different FBL protein concentration.

Expected outcomes

The FBL-EGFP fusion protein underwent phase transition into a solid-like state in a concentration-dependent manner (Figure 8A).

For the ThT dye staining assay, there was a bright fluorescence with this dye in the presence of FBL aggregation (Figure 8B).

For the in vitro FRAP assays, the high concentration FBL protein could increase the lost rate of FBL condensate, promoting FBL aggregation (Figures 8C and 8D).

For the sedimentation experiment and western blot detection, the protein concentration promotes FBL aggregation from solution (Figures 8E and 8F).

The above four assays all illustrated that the transition of FBL form liquid to solid phase is a concentration-dependent manner.

Limitations

The prion-like protein FBL could be successfully purified and maintain activity in vitro using this protocol. However, the feature of prion-like protein to precipitate over time poses challenges for phase transition detection. It is recommended that studying other prion-like proteins should find the suitable protein expression and purification approach, such as a chemically-defined baculovirus-insect cell protein expression system or utilizing Co²⁺ resin for column purification to enhance protein purity and reduce processing time. It should be noted that in vitro phase separation assays may not fully replicate the phase behavior observed in cellular environments. Therefore, additional techniques and optimized protocols are required to comprehensively investigate the phase separation and transition properties of prion-like proteins.

Troubleshooting

Problem 1

Step 5. No positive clones which contain the correct inserts on the plate.

Potential solution

• •The amounts of linearized vectors and amplified inserts are too low / high in the recombination reaction or the ratio is not appropriate. Use the amount and ratio according to the specifications recommended.
• •Contamination in vector and insert inhibits the recombination: the total volume of unpurified DNA should be ≤ 2 μL (1/5 of the total volume of reaction system).
• •Unsuccessful recombination: the colony PCR shows only the band of the empty plasmid, indicating that the recombination was unsuccessful and the linearization of the vector was incomplete. It is recommended to optimize the enzyme digestion system.

Problem 2

Step 8. Protein yield is low.

Potential solution

The protein is usually expressed in an insoluble inclusion body in the E.Coli system. We strongly suggest that purifying the soluble form in the supernatant directly, rather than the inclusion body. It usually requires trying to find the suitable IPTG concentration and induction temperature for the largest yield before enlarging the induction volume. Additionally, we suggest incorporating a solubility-enhancing tag, such as GST, which can improve both protein solubility and yield. The tag can subsequently be removed using Thrombin (Sigma, Cat# T6884) prior to purification.

Problem 3

Step 14. The protein purity is not good.

Potential solution

• •The sonication process is important for the subsequently protein purification. First, to avoid protein denaturation by sonication, the protein should be kept on ice during the whole sonication process. Ice should be supplemented in the break during sonication. Second, to avoid the protein sample becoming too viscous, continue sonication until the viscosity is reduced, and/ or add DNase I to 5 μg/mL, Mg²⁺ to 1 mM, and incubate on ice for 10 to 15 min.
• •If no histidine-tagged protein is found in the purified fractions, consider these possibilities: First, elution conditions are too mild (histidine-tagged protein still bound), eluting with an increasing imidazole gradient or decreasing pH to determine the optimal elution conditions. Second, the protein has precipitated in the column, try detergents or change the NaCl concentration or elute under denaturing (unfolding) conditions (use 4 to 8 M urea or 4 to 6 M Gua-HCl) to remove precipitated proteins. Third, if the target protein is detected in the flow-through fraction, we recommend either reducing the imidazole concentration or verifying the pH of both the sample and binding buffer, as the pH may be too low for optimal protein binding.
• •If the eluted protein is not pure (multiple bands on SDS polyacrylamide gel), considerate these possibilities: First, the protein might have degraded during purification, you should add enough protease inhibitors in solution. Second, the contaminants may have high affinity for nickel ions, you should find the optimal imidazole concentration for binding buffer. Third, the contaminants are associated with tagged proteins, you should add detergent and/or reducing agents before sonicating the bacterial cells, and increase the detergent levels (e.g., up to 2% Triton X-100 or 2% Tween 20), or add glycerol (up to 50%) to the wash buffer to disrupt nonspecific interactions. Additionally, as an alternative approach, you may consider using Co²⁺ resin instead of Ni²⁺ resin for column purification, which could potentially enhance protein purity.

Problem 4

Step 17. The size of the protein, which as shown in Coomassie blue staining and Western blot results, purified from bacterial cells is inconsistent with what we expect.

Potential solution

It may be caused by the eukaryotic protein codon not being familiar to prokaryotic bacteria, and protein expression may be stopped by bacterial. Therefore, you should consider codon optimization to meet the preference of prokaryotic bacteria. Additionally, we suggest using Transetta (DE3) chemically competent cells (Transgen, Cat# CD801) for transformation and subsequent protein expression and purification. This strain is specifically designed to supplement tRNAs for codons that are rare in Escherichia coli, thereby enhancing both the expression level and quality of eukaryotic proteins in prokaryotic systems.

Problem 5

Step 22. It is difficult to capture the phase separation image.

Potential solution

The protein concentration, crowding reagent and incubation time are key factors affecting the phase separation assay. You should check the protein dilution firstly, to ensure the exact protein concentration is prepared. It should also explore the optimal incubation time, and then carry out the image acquisition.

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Tian-Qi Chen (chentq27@mail.sysu.edu.cn).

Technical contact

Further information and requests for technical information should be directed to and will fulfilled by the technical contact, Xiao-Tong Chen (chenxt223@mail2.sysu.edu.cn).

Materials availability

This study did not generate new unique materials or reagents.

Data and code availability

This study did not generate new databases or code.

Acknowledgments

This research was supported by the National Key R&D Program of China (no. 2022YFA1303302), the National Natural Science Foundation of China (nos. 32400439, 32170570, 32270598, and 32370594), Guangdong Province (nos. 2021B1515020002 and 2022A1515140018), and Guangzhou (no. 2024A04J5004).

Author contributions

X.-T.C., Y.-M.S., and T.-Q.C. designed the assay, and X.-T.C. performed the experiment and analyzed the data. T.-Q.C. wrote the paper, and W.-T.W. and Y.-Q.C. revised the paper. All the authors read and approved the final manuscript.

Declaration of interests

The authors declare no competing interests.