Summary
The maintenance of invariant developmental phenotypes across disparate environments is termed canalization, but few examples of canalization mechanisms are described. In plants, robust flower production across environmental gradients contributes to reproductive success and agricultural yields. Flowers are produced by the shoot apical meristem (SAM) in an auxin-dependent manner following the switch from vegetative growth to the reproductive phase. While the timing of this phase change, called the floral transition, is sensitized to numerous environmental and endogenous signals, flower formation itself is invariant across environmental conditions. Previously we found that CLAVATA peptide signaling promotes auxin-dependent flower primordia formation in cool environments, but that an unknown mechanism promotes continuous flower formation at high temperatures. Here, we show that heat promotes floral primordia patterning and formation in SAMs not by increased auxin production, but through the production of the mobile flowering signal, florigen, in leaves. Florigen, which includes FLOWERING LOCUS T (FT) and its paralog TWIN SISTER OF FT (TSF) in Arabidopsis thaliana, is necessary and sufficient to buffer flower production against the loss of CLAVATA signaling and promotes heat-mediated primordia formation through specific SAM expressed transcriptional regulators. We find that sustained florigen production is necessary for continuous flower primordia production at warmer temperatures, contrasting florigen’s switch-like control of floral transition. Lastly, we show that CLAVATA signaling and florigen synergize to canalize flower production across broad temperature ranges. This work sheds light on the mechanisms governing the canalization of plant development and provides potential targets for engineering crop plants with improved thermal tolerances.
Graphical Abstract

eTOC Blurb:
Smith et al. reveal that CLAVATA signaling and florigen synergize to promote flower production in diverse temperatures. At cooler temperatures, CLAVATA signaling plays a dominant role, and increased florigen accumulation during thermomorphogenesis is necessary and sufficient to compensate for the loss of CLAVATA signaling at high temperatures.
Introduction
Many developmental traits are buffered against disruption by genetic and environmental perturbations. This phenomenon, originally termed “canalization” by Waddington, provides a selective advantage by ensuring that fluctuations in environmental conditions and stochastic mutations do not interfere with developmental processes essential for reproduction1,2. In plants, successful reproduction depends on robust flower production. The timing of the switch from vegetative growth to the reproductive phase, termed the floral transition, varies widely within a species in response to local environmental conditions3. In contrast, the production of normal flowers following the floral transition is remarkably invariant. This suggests that the pathways governing flower formation are highly canalized. As many agricultural yields are inherently linked to flower production, and temperature fluctuations can negatively impact crop yields, understanding the pathways that canalize flower production may enable engineering of crop species to optimize flower production and yield4,5.
Moderately elevated temperatures induce diverse developmental and growth changes in plants termed thermomorphogenesis. In Arabidopsis thaliana, thermomorphogenesis in above ground tissues includes increases in hypocotyl, leaf petiole, and stem elongation, and leaf hyponasty6. In particular, thermomorphogenic growth in hypocotyls and leaves is facilitated by increased auxin biosynthesis at elevated temperatures (ca. 27–30°C)7. Curiously, flower primordia production in SAM tissue proceeds normally across temperature ranges typically assayed during thermomorphogenesis experiments, despite flower primordia formation being critically dependent on auxin8–11. How heat impacts SAM functions, and whether thermomorphogenesis circuits operate similarly in SAMs compared to other tissues is an unresolved question.
Recent work from our lab showed that auxin-dependent primordia outgrowth at cooler temperatures requires CLAVATA3/EMBRYO SURROUNDING REGION peptide (CLEp) signaling12,13. This function is genetically separable from the well-described role of CLEp signaling in restricting stem cell proliferation in the SAM by buffering expression of WUSCHEL (WUS), a transcription factor promoting stem cell maintenance14,15. This work revealed that CLAVATA3 peptide (CLV3p) promotes primordia outgrowth by signaling through the CLEp receptors CLAVATA1 (CLV1) and the obligate dimer of CORYNE (CRN) and CLAVATA2 (CLV2), which encode a transmembrane pseudokinase and an extracellular leucine-rich repeat (LRR) receptor-like protein, respectively. In cool temperatures, crn/clv2 plants bolt and produce 2–5 normal flowers before entering a prolonged period in which floral primordia form, but primordia outgrowth ceases at floral stage 3 (before floral meristem formation) and shoot elongation stalls (FigureS1A)13,16.
After the production of approximately 30 terminated primordia during this “termination phase”, normal flower formation and shoot elongation resume for unknown reasons. Notably, high temperatures restore normal patterns of auxin-dependent floral primordia formation and outgrowth, and thus flower production, to crn/clv2 plants12,13. How elevated temperatures buffer flower formation is unclear, and whether this involves similar thermomorphogenic circuitry as in other plant tissues remains unknown. Here, we show that canalized flower production is facilitated by elevated expression levels of the mobile signal florigen induced during thermomorphogenesis, and not by auxin-mediated pathways as in other tissues. We show that elevated expression levels of FT, a component of florigen, are necessary and sufficient to bypass the requirement for CLEp signaling during flower production at both cool and hot temperatures. This reveals that sustained FT expression is essential during floral primordia initiation and outgrowth, distinct from its well-described role in triggering floral transition. Lastly, we reveal that continuous flower production requires simultaneous florigen and CLEp signaling across temperature regimes. Collectively, these data reveal that dual developmental signaling programs promote the canalization of reproductive development against environmental perturbations, raising the possibility these pathways could be engineered to buffer crop development across temperature ranges.
Results
The transcriptional circuitry required for heat-induced auxin biosynthesis is dispensable for canalized flower formation at elevated temperatures
Previously we observed that aborted floral primordia in cool-grown crn SAMs showed reduced auxin-induced gene expression, consistent with the essential role of auxin in promoting primordia specification and outgrowth11,13. Here we focus on crn/clv2 plants, as stem cell over-proliferation in other clv mutants obscures floral primordia phenotypes.12 As thermomorphogenic growth in other tissues results from increased auxin biosynthesis at high temperatures, we initially suspected that elevated levels of auxin induced during thermomorphogenesis canalized flower production in crn mutants at high temperatures7. Increased auxin biosynthesis at high temperatures is regulated by the thermosensing transcription factor EARLY FLOWERING3 (ELF3). In cooler temperatures, ELF3 transcriptionally represses PHYTOCHOROME INTERACTING FACTOR 4 (PIF4), a transcription factor that promotes the expression of YUCCA8 (YUC8), a member of the YUC family of rate-limiting auxin biosynthesis enzymes17,18. ELF3 forms condensates at high temperatures, permitting increased PIF4 and YUC8 expression, leading to auxin accumulation (FigureS1B)19. Based on our previous observation that elf3 null mutations, which mimic warmer growth conditions, restore flower formation to crn plants at cooler temperatures, we suspected that ELF3-mediated rewiring of auxin biosynthesis facilitated heat-induced flower formation in crn13. To test this, we asked whether PIF4 or YUC8 were necessary for the restoration of floral primordia outgrowth in crn elf3 double mutants grown in cooler temperatures (17–18°C). To quantify flower formation, we classified the first thirty flower attempts as normal (all floral organs present), terminated flower (pedicel forms but gynoecium is missing), or terminated primordia (no pedicel or floral organ formation), as previously described12,13. While crn elf3 pif4-2 plants displayed modestly increased rates of primordia termination when compared to crn elf3, neither crn elf3 yuc8-1 nor crn elf3 pif4-2 mutant combinations displayed terminated primordia numbers similar to crn plants, suggesting that elf3-mediated restoration of primordia formation in crn plants is largely independent of YUC8, with only minor contributions from PIF4 (Figures S1C–D).
As additional PIF and YUC paralogs can act redundantly during thermomorphogenesis, we asked whether heat could restore flower formation to crn-10A pif34578 and crn-10A yuc289 higher order mutants20–22 (see materials and methods). At cool temperatures, pif34578 did not affect primordia termination in crn-10A, while crn-10A yuc289 showed a minor increase in flower formation, indicating that neither of these sets of PIF or YUC paralogs play a major role in primordia outgrowth at cool temperatures (Figures S1E–F). Surprisingly, heat completely restored floral primordia formation to crn-10A pif34589 and crn-10A yuc289 mutants, indicating that the transcriptional circuitry required for increased auxin accumulation downstream of ELF3 thermosensing in other tissues is dispensable for heat-induced flower formation in crn plants (Figures S1G–H). This suggests that heat acts via alternative mechanisms during the canalization of flower production in the SAM.
Acceleration of the floral transition restores primordia formation to crn mutants.
As the ELF3-dependent transcriptional circuit that promotes auxin biosynthesis during thermomorphogenesis is dispensable for heat-mediated canalization of flower production, we sought to identify whether other transcriptional networks facilitate heat-mediated primordia formation. We noticed that the heat-labile MADS Box transcription factor SHORT VEGETATIVE PHASE (SVP), which represses floral transition in response to fluctuations in environmental temperature, is upregulated in crn SAMs during the primordia termination phase in previous RNA-Seq analyses (Figure1A)23,24. Mirroring this, we found modestly increased SVP accumulation in cool-grown crn SAMs using a functional pSVP::SVP-GFP reporter25. While ectopic SVP levels were low in crn SAM cells, SVP displayed apparent nuclear localization, while SVP was nearly undetectable in Col-0 SAMs proper (Figure1B). We therefore suspected that elevated SVP in crn may be associated with primordia termination, and that SVP degradation in high temperatures may be linked to the restoration of normal flower formation. To first test this, we genetically mimicked high temperatures by mutating svp in the crn background. Indeed, crn svp double mutants grown in cooler temperatures displayed normal flower production, supporting a role for SVP accumulation in blocking primordia outgrowth in crn plants, and suggesting that SVP degradation in heat may explain the restoration of floral primordia outgrowth (Figures 1C–E).
Figure 1. Loss of SVP restores primordia outgrowth to crn at cool temperatures.

(A) Expression levels of SVP from RNA-Seq analysis in Col-0 and crn SAMs grown at 17–18°C. Normalized transcripts per million (TPM) summed for all three SVP isoforms for three biological replicates are plotted from Kallisto/Sleuth RNA-Seq analysis. The line indicates the median. P values for the three isoforms of SVP were p=0.000852, p=0.000266, and p<0.0001. (B) Maximum intensity projection of pSVP::SVP-GFP (GFP signal is color-coded for intensity using the BlueToYellow LUT) with PI (Gray) and pSVP::SVP-GFP alone in Col-0 (n=8) and crn (n=7) SAMs grown at 17–18°C. Square on SAMs in middle column indicates zoomed in region shown in right column. Scale bars are 50 μM (left and middle columns) and 10 μM (right column). Brightness and contrast were adjusted identically for both images in the right column compared to the left and middle columns to illustrate difference in expression levels between Col-0 and crn. (C) Quantification of terminated floral primordia in Col-0 (n=16), crn (n=18), svp (n=16), crn svp (n=6), flm-3 (n=14), crn flm-3 (n=12), FLM-δ-GFP flm-3 (n=17), FLM-δ-GFP crn flm-3 (n=9), FLM-β-GFP flm-3 (n=16), and FLM-β-GFP crn flm-3 (n=16) grown at 17–18°C. Statistical comparisons to crn are indicated on the graph. (D) %Terminated primordia for each of the crn, crn svp, crn flm-3, FLM-δ-GFP crn flm-3 and FLM-β-GFP crn flm-3 individuals summarized in (D). Statistical comparisons to crn are indicated on the graph. Line indicates the median. Statistical significance between %terminated primordia in indicated pairwise comparisons was calculated with multiple Mann-Whitney tests using the Holm-Šídák method for correcting multiple comparisons. Significance is represented on the graph using asterisks (p < 0.05 *; p < 0.01 **; p < 0.001 ***; p < 0.0001****.) (E) Representative inflorescence images of genotypes quantified in (C) and (D). Scale bars are 1 mm. Arrowheads indicate terminated floral primordia. See also Figure S1.
To further explore this possibility, we took advantage of the MADS Box transcription factor FLOWERING LOCUS M (FLM), which directly mediates the effects of temperature on SVP stability24,26,27. At cooler temperatures, the FLM-β isoform is predominately expressed and facilitates nuclear accumulation of SVP and direct repression of the transcriptional programs that induce floral transition. At higher temperatures, SVP is targeted for proteasomal degradation by the more abundant FLM-δ isoform, thereby permitting floral transition24,26,27. To test if the regulation of SVP accumulation by FLM influences primordia formation, we first asked whether the expression of specific FLM isoforms impacts flower formation in crn plants at cooler temperatures, using previously published FLM-GFP isoforms expressed from the native FLM promoter24. Indeed, crn flm-3 expressing FLM-δ-GFP and the null flm-3 partially restored flower formation to crn, while FLM-β-GFP crn flm-3 plants were indistinguishable from crn, consistent with the roles of FLM-δ in promoting SVP degradation and FLM-β in stabilizing SVP (Figures 1C–E). These results support that the FLM/SVP module may contribute to the restoration of normal flower formation to crn at elevated temperatures.
We next asked how loss of either SVP or ELF3, two unrelated transcriptional regulators, could both restore primordia formation in crn plants. While ELF3 plays a role in auxin-mediated thermomorphogenesis, ELF3 is also a repressor of floral transition as part of the “evening complex” that entrains flowering time to circadian inputs17,28,29. A complex array of repressors and activators regulates the floral transition, each functioning in distinct and sometimes overlapping circuits30. As either svp or elf3 restores flower formation to crn at cooler temperatures, we first asked if loss of floral transition repressors in multiple floral transition pathways could similarly restore flower primordia outgrowth to crn. We therefore expanded our analysis to the floral transition repressors PHYTOCHROME B (PHYB, photoperiod pathway repressor), DELLA family transcriptional regulators (gibberellic acid (GA) pathway repressor), and the floral transition activator, CONSTANS (CO, photoperiod and circadian clock pathway activator)31–35. Indeed, loss of either PHYB or the DELLAs, or overexpression of CO, restored flower primordia formation to crn mutants at cool and ambient (22°C) temperatures, with elf3, svp, and 35S::CO displaying near complete restoration of primordia outgrowth, and phyB and the della pentuple mutants (dellaP) having an intermediate and temperature-dependent restoration of flower primordia outgrowth (Figures 2A–F, Figures S2A–B). Additionally, we accelerated floral transition by germinating crn seedlings on gibberellin (GA4)-containing media until 11 days after germination (DAG) and then transferring to soil. This treatment also restored flower formation to crn at ambient temperatures (FigureS2C). At cooler temperatures, additional GA4 sprays twice weekly until floral transition were necessary to restore flower formation (Figures 2G–H). Collectively, these results indicate that diverse genetic or pharmacological approaches to accelerating floral transition are sufficient to restore primordia formation to clv mutants in cooler environments.
Figure 2: Acceleration of the floral transition restores primordia formation to crn mutants.

(A) Quantification of floral primordia termination in Col-0 (n=15), crn (n=17), svp (n=17), crn svp (n=13), elf3 (n=17), crn elf3 (n=17), 35S::CO (n=17), crn 35S::CO (n=13), phyB (n=16), and crn phyB (n=16) grown at 17–18°C. Statistical significance of a genotype compared to crn is represented on the graph with asterisks. (B) %Terminated primordia for each of the crn and crn phyB individuals summarized in (A). Line represents the median. (C) Representative inflorescence images of genotypes quantified in (A). (D) Quantification of floral primordia termination in Col-0 (n=18), crn-10A (n=17), dellaP (n=18), and crn-10A dellaP (n=15) grown at 17–18°C. (E) %Terminated primordia for each of the crn-10A and crn-10A dellaP individuals summarized in (D). Line represents the median. (F) Representative inflorescence images of genotypes quantified in (D). (G) Quantification and (H) representative images of floral primordia termination in Col-0 and crn plants germinated on 10μM GA4 or ethanol (EtOH) containing plates for 11DAG and sprayed twice weekly with 10μM GA4 or ethanol solution until flowering. Sample sizes are Col-0 + EtOH (n=17), Col-0 + GA (n=17), crn + EtOH (n=17), and crn + GA (n=18.) Statistical significance between %terminated primordia in indicated genotypes were calculated with multiple Mann-Whitney tests using the Holm-Šídák method for correcting multiple comparisons. Significance is represented on the graph using asterisks (p < 0.05 *; p < 0.01 **; p < 0.001 ***; p < 0.0001****.) In (C), (F), and (H), terminated primordia are indicated with arrowheads, and all scale bars are 1mm. See also Figure S2.
FT buffers the loss of CLAVATA signaling during flower primordia formation
As accelerating floral transition through multiple pathways restores flower outgrowth to crn plants, we sought to identify a common effector of these diverse pathways that could mediate this. During the floral transition, many environmentally sensitive transcription factors activate the expression of FT, the main component of florigen in Arabidopsis, in leaves36. FT is then transported through the phloem to the SAM, where it induces floral transition37–39. ELF3, SVP, DELLAs, PHYB, and CO all modulate FT transcription in leaves to coordinate the timing of floral transition in response to diverse cues23,28,31,34,40. Therefore, we first confirmed that FT expression was increased in these genetic backgrounds when combined with crn mutations. We detected an increase in FT transcript levels in crn elf3, crn svp, crn phyB, and crn 35S::CO seedlings relative to both 11d Col-0 and crn seedlings grown in continuous light at ambient temperatures, consistent with previously published results (FigureS2E)41–44. We then asked whether FT in these backgrounds is necessary for the restoration of flower production by introducing a null ft allele into the appropriate crn double mutant backgrounds. Indeed, crn svp ft, crn elf3 ft, crn phyB ft, and crn 35S::CO ft displayed similar rates of primordia termination as crn plants, indicating that increased FT expression is necessary for the restoration of primordia formation in crn plants (Figures 3A–B). We next asked whether increased FT levels are sufficient to restore primordia outgrowth to crn. We therefore attempted to complement primordia defects in crn ft by expressing FT from either the phloem companion cell specific promoter (pSUC2::FT) or a SAM-active promoter (pKNAT1::FT)45,46. In both cases, this resulted in the restoration of normal flower formation in crn plants in cooler temperatures, indicating that distal expression of FT in phloem is sufficient to elicit SAM primordia, mirroring the mobile signaling functions of FT during floral transition (Figures 3C–D). Collectively, these results indicate that increased FT levels are necessary and sufficient to bypass the loss of CLEp signaling during flower formation in cooler environments and can do so as a mobile signal originating from phloem.
Figure 3: Florigen buffers the loss of CLAVATA signaling during flower primordia formation.

(A) Quantification and (B) representative inflorescence images of terminated floral primordia in Col-0 (n=18), crn (n=17), ft (n=18), crn ft (n=18), crn svp (n=16), crn svp ft (n=17), crn elf3 (n=16), crn elf3 ft (n=18), crn 35S::CO (n=17), crn 35S::CO ft (n=18), crn phyB (n=18), and crn phyB ft (n=18) grown at 17–18°C. Statistical comparisons with crn are indicated above relevant genotypes. Other pairwise comparisons are indicated on the graph. (C) Quantification and (D) representative images of terminated floral primordia in ft (n=17), crn ft (n=18), pSUC2::FT ft (n=17), pSUC2::FT crn ft (n=16), pKNAT1::FT ft (n=18), and pKNAT1::FT crn ft (n=16) grown at 17–18°C. Statistical comparisons with crn ft are indicated above relevant genotypes. Statistical significance between %terminated primordia in indicated genotypes were calculated for (A) and (C) with multiple Mann-Whitney tests using the Holm-Šídák method for correcting multiple comparisons. Significance is represented on the graph using asterisks (p < 0.05 *; p < 0.01 **; p < 0.001 ***; p < 0.0001****.) Arrowheads in (B) and (D) indicate terminated floral primordia. All scale bars are 1mm. See also Figure S3.
Aside from regulating FT expression, SVP also blocks the floral transition by repressing expression of GA biosynthesis genes, and previous work showed that increased GA levels in svp mutants accelerate floral transition47. As such, we asked whether the restoration of primordia outgrowth to crn svp required GA in addition to FT. To do this, we genetically abolished all GA biosynthesis in crn svp by mutating GA REQUIRING1 (GA1). As ga1 mutants are unable to germinate without exogenous GA supplementation, we imbibed all genotypes in GA4 for 24 hours after the transition to light before plating on normal media, a strategy we adapted from Silverstone et al48. This treatment did not restore primordia formation to crn plants but permitted germination of ga1 mutants. We observed normal flower production in crn svp ga1 plants grown at cooler temperatures, comparable to crn svp double mutants (FiguresS3A–B). As such, increased GA biosynthesis in svp mutants is dispensable for the restoration of flower primordia production in crn svp plants, contrasting with the clear requirement for FT (Figures3A–B). As GA promotes the floral transition through FT-dependent and FT-independent mechanisms, we also asked whether restoration of primordia outgrowth to crn by GA4 treatment was FT-dependent31,49,50. GA4 treatment significantly restores flower formation to crn ft plants at cooler temperatures but cannot completely restore flower formation, indicating that GA-mediated restoration of primordia outgrowth in crn plants partially depends on FT (FiguresS3C–E). Consistent with this, FT levels were not upregulated in 11d crn-10A dellaP seedlings grown at ambient temperature in continuous light conditions (Figure S2E). In summary, these results show that the acceleration of floral phase transition through diverse mechanisms is sufficient to restore primordia formation in crn plants, with FT requirements mirroring those in floral transition pathways31,49,50.
FT promotes floral primordia formation through SAM expressed transcriptional regulators.
During the floral transition, FT interacts with the basic leucine zipper (bZIP) transcription factor FD to activate the floral fate transcriptional program51–53. To test if the restoration of primordia formation in crn plants by increased FT requires FD, we generated crn svp fd mutants. These plants displayed rates of terminated primordia similar to crn, consistent with a role for FD-dependent transcriptional activity in promoting flower primordia restoration in crn mutants (Figures S4A–B). FT competes with its paralog TERMINAL FLOWER1 (TFL1), which blocks floral transition, for FD binding53–55. TFL1 expression levels are slightly elevated in crn SAMs in our RNA-Seq dataset, raising the possibility that ectopic TFL1 might block formation of FD-FT complexes to prevent normal flower primordia formation in crn plants (FigureS4C). To test this, we generated crn tfl1 double mutants. While we could not interpret the effect of the strong tfl1-1 allele on crn primordia termination due to the nature of the terminal flower phenotype associated with tfl1-1 mutants, using the weak tfl1-11 allele we observed a minor decrease in primordia termination in crn tfl1-11 compared to crn single mutants (Figures S4D–E). These results suggest that ectopic TFL1 does not substantially contribute to primordia termination in crn SAMs. Our results indicate that elevated FT levels bypass the requirement for CLEp signaling during flower formation in cool environments in an FD-dependent manner.
As part of the later floral transition phase, FT-FD promote expression of multiple floral meristem identity factors that reinforce floral fate in developing primordia (Figure 4A)43,51–53,56,57. As such, we wondered if floral meristem identity targets were genetically required for flower restoration downstream of FT. To test this, we mutated four floral identity factors—LEAFY (LFY), APELATA1 (AP1), SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1 (SOC1), and AGAMOUS-LIKE24 (AGL24)—individually in the crn svp background. Due to genetic linkage between CRN and LFY, we introgressed lfy into the clv2 svp background. As lfy and ap1 plants produce flowers with floral identity or floral reversion defects, we classified all lateral organ attempts as either a terminated primordia or “outgrown organ.” At cooler temperatures, crn svp ap1 and crn svp agl24 plants displayed slightly increased rates of primordia termination compared to crn svp, while crn svp soc1 plants were similar to crn svp mutants. In contrast, clv2 svp lfy mutants displayed levels of organ termination similar to clv2 at cooler temperatures (Figures 4B–C). At ambient temperatures, crn svp ap1 and crn svp agl24 plants showed normal flower formation, crn svp soc1 plants displayed a modest increase in primordia termination, and clv2 svp lfy plants again showed similar rates of primordia termination as clv2 (FigureS2D). Together, these results suggest that LFY plays a dominant role downstream of FT to promote flower primordia restoration to crn plants in cool environments, though the other floral integrators likely contribute quantitatively to FT-mediated primordia outgrowth redundantly with LFY.
Figure 4: Florigen promotes floral primordia formation through SAM expressed transcriptional regulators.

(A) Schematic of gene interactions during the floral transition and activation of floral identity in incipient floral primordia. (B) Quantification and (C) representative inflorescence images of floral primordia termination in Col-0 (n=18), clv2 (n=15), svp (n=16), clv2 svp (n=8), clv2 svp lfy (n=12), crn (n=18), crn svp (n=16), crn svp agl24 (n=16), crn svp ap1 (n=18), and crn svp soc1 (n=17) grown at 17–18°C. All outgrown organs (normal flowers, flowers with identity defects, leaves, terminated flowers) were pooled into an “outgrown organ” category distinct from terminated primordia. Statistical comparisons are indicated on the graph. (D) Expression levels of LFY from RNA-Seq analysis in Col-0 and crn SAMs grown at 17–18°C. Normalized transcripts per million (TPM) summed for LFY for three biological replicates are plotted from Kallisto/Sleuth RNA-Seq analysis. The line indicates the median. P values for the two isoforms of LFY were p=0.000171 and p=0.000934. (E) Maximum intensity projection of pLFY::LGY-GFP (GFP signal is color-coded for intensity using the BlueToYellow LUT) with PI (Gray) and pLFY::LFY-GFP alone in Col-0 (n=18), crn (n=11), crn svp (n=18), and crn svp ft (n=8) SAMs grown at 17–18°C. Statistical significance between %terminated primordia in indicated genotypes were calculated for (B) with multiple Mann-Whitney tests using the Holm-Šídák method for correcting multiple comparisons. Significance is represented on the graph using asterisks (p < 0.05 *; p < 0.01 **; p < 0.001 ***; p < 0.0001****.) Arrowheads in (C) indicate terminated floral primordia. Scale bars are 1 mm in (C) and 50 μM (E). See also Figure S4.
To further test this hypothesis, we examined pLFY::LFY-GFP accumulation in incipient primordia. We observed a decrease in pLFY::LFY-GFP accumulation in aborted primordia in crn, consistent with a loss of flower formation and reduced LFY expression levels in our RNA-Seq dataset (Figures 4D–E). Accelerating the floral transition in crn svp restored pLFY::LFY-GFP accumulation in primordia to wild type levels. This increase was dependent on FT, as pLFY::LFY-GFP levels were reduced to crn levels in crn svp ft (Figure4E). Collectively, these results support a role for LFY downstream of FT during the canalization of flower production, consistent with recent evidence demonstrating that FT-FD binds directly to the LFY promoter to activate its expression53,58. As such, in cooler environments, loss of CLEp signaling in floral primordia formation can be buffered by increased FT expression which acts via a FD/FT-LFY transcriptional circuit in SAMs.
Thermomorphogenesis-mediated canalization of flower production requires FT/TSF
Our original observation that elevated temperatures can restore floral primordia formation and outgrowth to clv mutants reveals that thermomorphogenic responses canalize floral development. The mechanistic basis of this is unknown. Our work reveals that increased FT levels are sufficient to restore primordia formation to crn plants in cooler environments. As high temperatures also accelerate floral transition by inducing FT expression, we asked whether thermomorphogenesis-induced canalization of primordia formation in SAMs is an FT and LFY-dependent process59. Indeed, crn ft plants displayed terminated primordia in the heat, indicating that FT mediates heat-induced flower primordia restoration in crn (Figures 5A–B). The FT paralog TSF can partially compensate for the loss of FT during floral transition60,61. Consistent with this, we observed increased primordia termination in heat-grown crn tsf ft plants relative to crn ft plants (Figures 5A–B). FT and TSF both interact with FD to induce the floral fate transcriptional program43. Heat-grown crn fd plants displayed lower levels of terminated primordia relative to crn tsf ft plants (Figures 5A–B), possibly due to the partial redundancy of FD with the related bZIP transcription factor FD PARALOG (FDP)62. At a minimum, our analysis reveals that primordia formation during thermomorphogenesis is canalized in a FT/TSF-dependent manner, and most likely acts through FD and associated factors.
Figure 5: Heat-mediated canalization of flower production requires florigen.

(A) Quantification and (B) representative inflorescence images of terminated floral primordia in Col-0 (n=19), crn (n=17), tsf (n=13), crn tsf (n=16), fd (n=18), crn fd (n=18), ft (n=18), crn ft (n=18), tsf ft (n=4), and crn tsf ft (n=20) plants grown at 30°C. Axillary meristems (AM) are shown in gray. Statistical comparisons with crn are indicated above the relevant genotypes. Other comparisons are indicated on the graph. Note increased magnification in crn fd to illustrate terminated primordia. (C) Quantification and (D) representative inflorescence images of terminated floral primordia in Col-0 (n=18), crn (n=18), clv2 (n=18), agl24 (n=18), crn agl24 (n=16), ap1 (n=18), crn ap1 (n=18), lfy (n=18), clv2 lfy (n=14), soc1 (n=18), crn soc1 (n=18) plants grown at 17–18°C. Statistical comparisons with crn or clv2 are noted over the relevant genotypes. (E) Quantification and (F) representative inflorescence images of terminated floral primordia in Col-0 (n=18), crn (n=16), clv2 (n=17), agl24 (n=15), crn agl24 (n=15), ap1 (n=13), crn ap1 (n=18), lfy (n=17), clv2 lfy (n=12), soc1 (n=17), crn soc1 (n=18) plants grown at 17–18°C. Statistical comparisons with crn or clv2 are noted over the relevant genotypes. Statistical significance between %terminated primordia in indicated genotypes were calculated for (A, C, E) with multiple Mann-Whitney tests using the Holm-Šídák method for correcting multiple comparisons. Significance is represented on the graph using asterisks (p < 0.05 *; p < 0.01 **; p < 0.001 ***; p < 0.0001****.) Arrowheads in (B), (D), and (F) indicate terminated floral primordia. All scale bars are 1mm. See also Figure S5.
To assess whether heat-mediated primordia restoration requires LFY, or other floral identity factors acting downstream of FT, we generated double mutants of either clv2 or crn and mutations in different individual floral identity regulators, again utilizing both clv mutants due to genetic linkage between CRN and LFY. As clv2 lfy and crn ap1 plants display flowers with various identity defects or characteristics with inflorescence reversion, we again categorized all lateral organs attempts as either an “outgrown organ” or “terminated primordia.”63,64 At cool temperatures, agl24, ap1, and lfy modestly enhanced terminated primordia numbers in crn/clv2, while soc1 had no effect (Figures 5C–D). In the heat, clv2 lfy plants displayed numerous terminated primordia, while crn soc1, crn agl24, and crn ap1 had normal organ formation (Figures 5E–F). As such, thermomorphogenesis acts to canalize floral primordia formation through FT/TSF and floral identity factors, with LFY playing a dominant role.
As FT/TSF are necessary for heat-mediated floral primordia formation, we next asked which repressors of FT might act as the thermosensors in this process. ELF3 and SVP indirectly and directly repress FT, respectively, and are inactivated by heat, through protein condensation and proteasomal degradation respectively19,24,27,28. The FLM-β isoform of FLM, which accumulates at cooler temperatures, stabilizes SVP to repress FT transcription24,27. Despite this, FLM-β-GFP crn flm-3 plants make normal flowers at high temperatures, indicating that blocking SVP degradation alone is not sufficient to prevent heat-mediated primordia outgrowth (Figures S5A–C). As such, we expressed an ELF3 variant (ELF3-BdPrD), which is insensitive to heat-mediated inactivation, under the native ELF3 promoter and introduced it into FLM-β-GFP crn flm-3 plants19. Despite this, crn flm-3 FLM-β-GFP elf3 ELF3-BdPrD-GFP plants displayed normal flower formation in heat, indicating that simultaneously blocking ELF3 and SVP thermosensing is insufficient to prevent heat-induced flower formation (Figures S5A–C). This suggests the existence of additional FT-regulating thermosensors acting in heat-mediated primordia formation.
CLAVATA and florigen signaling synergize to canalize flower formation across broad temperature environments.
Overall, our results show that the thermomorphogenically accelerated floral transition induction also canalizes flower primordia production, revealing a novel role for FT in promoting floral primordia initiation and outgrowth. We therefore asked whether CLEp signaling and FT/TSF promote primordia outgrowth in overlapping or independent pathways. We first took advantage of the negative regulator of CLEp signaling POLTERGEIST (POL), a phosphatase which dephosphorylates the CLV1 receptor to dampen signaling65. Previously, we showed that mutating POL restores floral primordia outgrowth to crn due to ectopic activation of CLV112,13. To ask whether CLV1-mediated restoration of flower formation requires FT, we generated crn pol ft mutants. At cool temperatures, these plants displayed normal primordia outgrowth, indicating that CLEp signaling promotes flower outgrowth independently of FT (Figures 6A–B). Further supporting this hypothesis is our observation that FT expression levels in 11d crn pol seedlings grown in continuous light conditions at ambient temperature are comparable to Col-0 despite the rescue of flower formation (FigureS2E). Altogether, these data suggest that florigen and CLEp signaling operate in parallel to promote flower formation.
Figure 6. CLAVATA and florigen signaling synergize to canalize flower formation across broad temperature environments.

(A) Quantification and (B) representative inflorescence images of floral primordia termination in Col-0 (n=18), crn (n=18), pol (n=16), crn pol (n=18), ft (n=16), crn ft (n=18), pol ft (n=15), and crn pol ft (n=16) plants grown at 17–18°C. Statistical comparisons indicated on the graph. (C) Quantification and (D) representative inflorescence images of the first fifty organ attempts in Col-0 (n=16), crn (n=16), tsf (n=13), crn tsf (n=16), fd (n=18), crn fd (n=17), ft (n=15), crn ft (n=14), tsf ft (n=18), and crn tsf ft (n=17) plants grown at 17–18°C. Organ attempts were classified as normal (black), terminated primordia (blue), terminated flowers (yellow), leaves (green), or axillary meristems (AM, gray.) (E) Schematic of Col-0, crn, tsf ft, and crn tsf ft organ attempts at end-of-life when grown at 17–18°C. Statistical significance between %terminated primordia in indicated genotypes were calculated for (A) with multiple Mann-Whitney tests using the Holm-Šídák method for correcting multiple comparisons. Significance is represented on the graph using asterisks (p < 0.05 *; p < 0.01 **; p < 0.001 ***; p < 0.0001****.) All scale bars are 1mm. Arrowheads indicate terminated primordia.
Even though our data reveals that FT/TSF promotes lateral organ outgrowth, we observed normal flower formation in tsf ft plants in the cooler temperatures, consistent with previously published results (Figures 6C–D)43. This suggests the presence of an additional pathway that bypasses the requirement for FT/TSF to promote primordia formation in cooler temperatures. To ask whether CLEp signaling facilitates this canalization, we inspected crn tsf ft triple mutants growing at cooler temperatures. We characterized all lateral organ attempts after bolting as normal flowers, terminated primordia, terminated flowers, cauline leaves, or axillary meristems (AMs, branch subtended by cauline leaf). In crn tsf ft plants, most lateral organs in the first fifty attempts were cauline leaves, with some terminated primordia and terminated flowers. Rarely, flowers (with or without inflorescence reversion) or normal branches were produced (Figures 6C–D). After the first fifty organ attempts, nearing when Col-0 plants senesce, crn tsf ft plant continued growth and then stochastically produce flowers intermixed with cauline leaves, terminated primordia, and terminated flowers (Figure 6E). As such, these results indicate that CLEp signaling and FT/TSF synergize to canalize flower production across a broad range of environmentally relevant temperatures, with CLEp signaling being essential in cooler environments, and both pathways contributing to primordia formation in heat (Figures 5A–B).
Discussion
How organisms maintain essential developmental pathways in the face of fluctuating environmental conditions is an outstanding question in biology. For plants, ensuring robust reproduction and therefore reliable agricultural yields across broad temperature ranges is an outstanding goal, but few mechanisms that promote robust flower formation during environmental perturbation are described. Here, our work reveals that flower formation is canalized by CLEp signaling and environmentally mediated titration of florigen levels across broad temperatures ranges (Figure 7). At cooler temperatures, CLEp signaling plays a more dominant role in promoting flower production, as floral primordia terminate in cool grown crn mutants. However, our data shows that elevated FT/TSF expression levels bypass the requirement for CLEp signaling at any temperature; crn tsf ft triple mutants show a total loss of flower formation within the normal Arabidopsis lifespan at cool temperatures and have strongly compromised flower production at elevated temperatures. Curiously, while TSF plays a minor role promoting floral transition, our data suggest that it contributes to the canalization of flower production43,60. While crn ft plants can produce flowers after the termination phase, loss of tsf in this background abolishes flower production until the end of life, indicating that TSF is likely responsible for the flower formation observed in crn ft. This data highlights the role of paralogs in facilitating canalization of important traits66. The regulation of floral transition is highly complex. Based on our results here, we predict that other environmental conditions or genetic perturbations that also elevate FT/TSF expression levels would also buffer against loss of CLEp signaling in flower primordia formation. This could explain why flower formation in crn is so strongly canalized in elevated temperatures, and our data suggests that additional thermosensors besides SVP and ELF3, can upregulate FT/TSF expression during thermomorphogenesis to allow flower formation.
Figure 7. Canalization of flower production across thermal environments requires Florigen and CLAVATA signaling.

Schematic of gene interactions promoting floral primordia formation and outgrowth across temperature regimes.
Based on our analysis here of crn phyb and crn phyb ft mutants, and its known temperature sensitivity, phyB is a likely candidate67–69, although others may exist.
In cooler environments, crn plants produce 2–5 normal flowers before entering the terminated primordia phase. As no early flowers are formed in crn tsf ft plants, this implies that the first few normal flowers formed in crn plants before the termination phase are due to the FT/TSF-induced floral transition. Following this switch activity, crn plants abort later floral primordia formation. As such, there is a temporal control of normal flower production in plants grown at cooler temperatures, with FT/TSF functioning early, and CLEp signaling being essential later. Increasing FT/TSF levels, either through heat or inactivation of FT repressors, eliminates the terminated primordia phase in crn plants. This work reveals that FT/TSF can act as both a phase switch and a sustained signal molecule promoting floral primordia initiation and outgrowth in SAM morphogenesis. This sustained activity role mirrors the function of the FT-FD module in preventing floral reversion70,71. Our work shows that the function of florigen following the floral transition extends to the initiation and outgrowth of early floral primordia before the floral meristem itself is established.
Here, we show that this thermomorphogenic increase in FT/TSF expression promotes flower primordia formation, but that flower primordia formation is not sensitized to ELF3-mediated auxin biosynthesis circuits, even though ELF3 is expressed in SAMs in three published SAM RNA-Seq data sets, including SAM cell specific transcriptomes13,72,73. Previously we showed that auxin is essential for heat-mediated primordia formation, as mutating two YUCs that are integral to floral primordia formation—YUC1 and YUC4—in the clv2 background resulted in pin inflorescences in heat13,74. However, unlike YUC8, YUC1 and YUC4 do not contain PIF binding sites in their promoters and are not heat-sensitive PIF4 targets during ELF3-dependent thermomorphogenesis in other tissues20. This suggests that thermomorphogenic transcriptional and subsequent growth responses are specialized to tissue type, expanding on previous observations6. Our data also shows that thermomorphogenesis controls SAM patterning through transcriptional changes and mobile signal production in leaves. Forced auxin signaling in stem cells can have deleterious impacts on SAM functions11,75,76. While it is unclear if heat increases auxin biosynthesis rates in SAMs at high temperatures, we clearly show that the heat induced PIF4-YUC8 circuit is dispensable for primordia formation in heat (FigureS1). As finely tuned hormone signaling fields in the SAM position new organ primordia in the correct phyllotaxy, tying thermomorphogenic responses in SAMs to distal florigen, and not local YUC activation, may be a mechanism to prevent SAM patterning disruptions by temperature-induced hormone changes77–81.
After producing aborted floral primordia, crn plants at cool temperatures produce normal flowers again. Even crn tsf ft plants eventually produce flowers in older plants after extensive organ attempts. Previous work showed that the age and GA floral transition pathways can redundantly activate expression of LFY and other floral integrators independent of FT/TSF, explaining flower formation in tsf ft49,50,82. Interestingly, a florigen sextuple mutant in which age-dependent floral transition is knocked down through overexpression of miR156 still produces flowers. The authors of that study speculated the existence of a third pathway promoting floral transition, and our data suggests that CLEp signaling could function as that third pathway during both floral transition and primordia initiation and outgrowth55. Furthermore, age-dependent activation of LFY expression may explain flower formation during the recovery phase of crn plants grown at cool and ambient temperatures49,82. Further investigation into the interactions between these pathways, as well as elucidating the mechanisms by which CLEp signaling itself promotes primordia formation, will clarify our understanding of the molecular mechanisms underlying canalized flower production. Collectively, our work shows that environmental titration of FT/TSF levels buffers flower production against stochastic mutations in CLEp signaling machinery to ensure primordia formation. Many crop species were bred to have mutations in various CLEp signaling components, as defects in CLEp signaling increase cell proliferation in the floral meristem size and thereby fruit size83–88. Additionally, floral transition pathways are a major trait target in many crop plants89,90. It is possible that further genetic engineering of CLEp signaling and florigen levels could be used to help buffer crop flower formation against current and future environmental fluctuations.
Resource Availability
Lead Contact
Requests for reagents, resources, or information should be directed to and will be fulfilled by the Lead Contact, Zachary Nimchuk.
Materials Availability
Arabidopsis lines generated through this study are freely available to academic researchers through the Lead Contact.
Data and code availability
All data reported in this paper will be shared by the lead contact upon request. This paper does not report original code. Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.
Star Methods
Experimental Model and Subject Details
The Arabidopsis thaliana ecotype Col-0 was used as the primary model system throughout this work.
Plant growth conditions
Seeds were sterilized for 10 minutes in a 3% bleach 0.01% Triton solution and washed twice with sterile water. Seeds were then plated on half-strength MS (Murashige-Skoog) media buffered with MES, pH= 5.7. Seeds were stratified at 4°C in the dark for two days and transitioned to a continuous light chamber kept at 22°C. One week after transitioning to light, plants were transplanted to soil (Proline HFC/B, Proline C/B, or propagation mix combined with Perlite and supplemented with recommended levels of Peter’s 20:20:20 [N:P:K]). For T1 experiments and GA4 treatment, both controls and T1 seedlings were transplanted at 11DAG instead of 7DAG.
After transplanting, plants were transferred to continuous light growth chambers or a custom-built growth room at the relevant temperature. Assays at 17–18°C took place in one of two Percival growth chambers (9AR-75L3 and AR66L3). Assays at 22°C took place in a custom-built growth room. Assays at 30°C took place in a Percival growth chamber (AR66L3). Experiments comparing the same genotypes at 17–18°C and 30°C were grown in both AR66L3 chambers.
Plant materials
All mutant alleles in this study are in the Col-0 ecotype. All genotyping primers and instructions are listed in DataS1A–B. Antibiotic resistances for reporters are listed in DataS1C. The following genotypes and reporters have been previously described: crn-1013, elf3-113, pif4-292, yuc8-120, pif3-193, pif4-10194, pif5-395, pif7-192, pif8-196, yuc2-122,97, yuc822,97, yuc9-122,97, svp-3223, flm-324, flm-3 FLM-ß-GFP24, flm-3 FLM-δ-GFP24, pLFY::LFY-GFP53, svp-41 pSVP::SVP-GFP25, 35S::CO42, phyB98, rga-2999, gai-t6 (originally in Ler but backcrossed to Col-0 six times)99, rgl199, rgl299, rgl3-399, ap1-1063, lfy-164, soc1-2100, pol-613, ft-10101, pSUC2::FT45, pKNAT1::FT ft46, fd-343, tfl1-1 gl1-3102, tfl1-11103, rlp10–1 (clv2)13, and tsf-147. An agl24–25 allele with an insertion in the fourth exon was selected (SALKseq_2434). For ga1-25, we used SALK_027931C. This line contains an insertion in the eleventh exon and displays phenotypic traits comparable to previously published ga1 mutants (necessity for exogenous GA for germination, darker rosette leaves, smaller rosette, delayed flowering, reduced internode elongation, etc.)
crn-10A pif34578, crn-10A yuc289, and crn-10A dellaP were generated using CRISPR Cas9 (described below) to knock out crn in previously generated pif34578 (pif3-1, pif4-101, pif5-3, pif7-1, pif8-1), yuc28922,97 (yuc2-1, yuc8, yuc9-1), and dellaP99 (rga-29, gai-t6, rgl1, rgl2, rgl3-3) mutants. A single crn-10A mutant was also generated to use as a control. Several SSLPs on chromosome 1 near the GAI locus were genotyped in crn-10A dellaP T2 individuals; all loci genotyped as Col-0 in all T2 individuals tested. Progeny from one of these individuals was bulked to use in phenotyping assays.
Methods Details
CRISPR mutagenesis of crn
To expediently generate higher order knockouts, crn-10A pif34578, crn10-A yuc289, crn-10A dellaP, and a crn-10A control line were generated using the zCas9i cloning kit. This kit uses an intron-optimized and GFP tagged version of Cas9107. The previously published guide sequence aagcaaagaagaagaagaaa for crn was used104. The guide sequence was cloned into the shuttle vector pDGE331 using modified Golden Gate with BpiI. Then, the cassette containing the Arabidopsis U6 promoter, the guide sequence, and the sgRNA was cloned into pDGE667 using modified Golden Gate cloning with BsaI-HFv2. This plasmid was transformed into Agrobacterium and introduced to Arabidopsis using the floral dip method109. T1 plants were selected on hygromycin containing media and genotyped for Cas9. Plants positive for Cas9 were sequenced at the 5’ end of the CRN locus to characterize editing. Plants with homozygous insertion of a single adenine at the 21st base pair were taken to the next generation. This insertion site is the same as the published crn-10 allele, though the nucleotide inserted in crn-10A is adenine instead of the thymine in crn-10. This created an early frame-shift truncated protein of the same length with one amino acid change relative to crn-10. T2s were screened for seed coat FASTRED; seeds with no signal were plated and subsequently genotyped as previously described to ensure no Cas9 remained in the genome107. The CRN locus was sequenced to ensure homozygosity of the correct allele. Seeds from a single T2 plant were bulked and used for experiments.
GA4 treatment
For experiments germinating seedlings on GA4 plates, a 10 mM stock solution of Giberellin (GA4) (Cayman Chemical) was prepared in 100% Ethanol. This was diluted to a final concentration of 10 μM in ½ MS plates. Vehicle control plates were prepared using an equal volume of ethanol in ½ MS. A 10 μM GA4 solution was prepared for spraying by diluting the 10 mM stock in water and 0.02% Silwet. A control solution with equal volume of ethanol was also prepared. This method was adapted from Andrés et al.47
A protocol for GA4 treatment during the first 24 hours after germination was adapted from Silverstone et al.48 Seeds were sterilized normally and resuspended in a 0.1 mM GA4 solution. These were stratified for two days in the dark at 4°C. Then, seeds were transferred to light in a 22°C growth chamber. Following 24 hours of light exposure, seeds were washed four times with water, plated on ½ MS plates, and returned to the growth chamber.
Generation of transgenic lines
New transgenic lines for T1 experiments were generated by transforming the relevant plasmid to Agrobacterium and introducing the construct to Arabidopsis using the floral dip method109. T1 plants were plated on ½ MS containing selection media and selected at 11DAG.
Photography
To obtain close-up inflorescence images, a Zeiss Stemi 2000-C stereo microscope with a Zeiss Axiocam 105-color digital camera was used. Images were acquired in Zeiss Zen software and brightness contrasted adjusted in Fiji.
Microscopy
Live Arabidopsis SAMs grown at 17–18°C were imaged shortly after floral transition as previously reported12,13. SAMs were inserted into a Petri dish containing 2% agarose and submerged in cold water for dissection. Following dissection, Col-0 and crn svp SAMs were inserted into another dish and 20 μL of 1.5 mM propidium iodide (PI) in PIPES buffer (35 mM PIPES, 5 mM EGTA, 2 mM magnesium sulfate, pH = 6.8) was pipetted onto the SAM110. SAMs were stained for 1–2 minutes before washing 2x with fresh water. crn and crn svp ft SAMs were submerged in 1.5 mM PI in PIPES buffer for 10–20 minutes before transferring to a water-containing dish for imaging13. A 20x water dipping objective was used to acquire a z-stack for each SAM. SAMs were imaged with a 20x/1.0 NA water-dipping objective on a Zeiss LSM 980 confocal microscope using the Airyscan Multiplex CO-8Y mode.GFP markers were excited with a 488 nm laser and emitted signal collected from 380–548 nm. PI was excited with a 561 nm laser and emitted signal collected from 449–549 nm and 573–627 nm. All images using the same reporters were acquired with identical settings. Following acquisition, each z-stack was processed using AiryScan processing (FastAiryScanSheppardSum CO-8Y: 3.7 (2D, Auto.)) Maximum intensity projections of the AiryScan processed images were generated using Zen Blue for presentation in the figures.
Images were cropped to remove excess black space at the edges; in some cases, this space included a pedicel. Brightness settings for GFP channels were set to identical values for all SAM images using the same reporter. Brightness in the PI channel was optimized to each SAM for clearest structural presentation.
Quantitative real-time PCR Analysis
For qRT-PCR, seedlings were plated on ½ MS, stratified in the dark at 4°C for two days, and grown at 22°C under continuous light until 11DAG. 100 mg tissue from 11DAG seedlings was flash-frozen in liquid nitrogen. Total RNA for three biological replicates was isolated using RNAzol RT 4-bromoanisole, and Glycoblue according to Sigma specifications and quantified using the RNA ScreenTape assay. cDNA was synthesized from 1 μg RNA using the Protoscript ii First Strand cDNA synthesis kit. An Applied Biosystems QuantStudio 6 Flex System and PowerUp SYBR Green Master Mix was used to perform qRT-PCR. Relative expression of FT was calculated using the 2−ΔΔCT method using PP2A as the housekeeping gene105 (see key resources table for primers.)
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Bacterial and virus strains | ||
| Agrobacterium tumefaciens strain Gv3101 | Widely distributed | N/A |
| E coli strain Top10 | Widely distributed | N/A |
| E coli strain Db3.1 | Widely distributed | N/A |
| Chemicals, peptides, and recombinant proteins | ||
| Propidium iodide | Fisher | AC440301000 |
| Murashige and Skoog (MS) Basal Salt Micronutrient Solution | RPI | M70300-50.0 |
| GA4 | Cayman Chemical | G7276-5MG |
| RNAzolRT | Sigma | R4533-50ML |
| 4-bromoanisole | MRC (Molecular Research Center) BN 191 | |
| Glycoblue | Thermo | AM9515 |
| Protoscript ii First Strand cDNA synthesis kit | NEB | E6560L |
| 17-505B qPCRBIO SyGreen Blue Mix Lo-RO 5 x 1mL Master Mix | Genesee | 17-505B |
| BpiI | Thermo | FD1014 |
| T4 DNA ligase | NEB | M0202S |
| BsaI-HFv2 | NEB | R3733S |
| PIPES | Sigma | P6757-100G |
| Triton X-100 | Fisher Scientific | BP151-100 |
| Critical commercial assays | ||
| RNA ScreenTape Ladder | Agilent | 5067-5578 |
| RNA ScreenTape | Agilent | 5067-5576 |
| RNA ScreenTape Buffer | Agilent | 5067-5577 |
| Deposited data | ||
| Raw RNAseq data | Jones et al.13 | SRA BioProject: PRJNA661065 |
| Code to analyze RNAseq data | Jones et al.13 | https://github.com/NimchukLab |
| Experimental models: Organisms/strains | ||
| Arabidopsis thaliana: Col-0 ecotype | N/A | |
| Arabidopsis thaliana: crn-10 | Jones et al.13 | N/A |
| Arabidopsis thaliana: elf3-1 | Jones et al.13 | N/A |
| Arabidopsis thaliana: pif4-2 | Leivar et al.92 | CS66043 |
| Arabidopsis thaliana: yuc8-1 | Sun et al.20 | SALK_096110C |
| Arabidopsis thaliana: crn-10A | This study | N/A |
| Arabidopsis thaliana: pif3-1 | Kim et al.93 | SALK_030753 |
| Arabidopsis thaliana: pif4-101 | Lorrain et al.94 | SAIL 114 G06 |
| Arabidopsis thaliana: pif5-3 | Fujimori et al.95 | SALK_087012 |
| Arabidopsis thaliana: pif7-1 | Leivar et al.92 | CS68809 |
| Arabidopsis thaliana: pif8-1 | Oh et al.96 | GABI 306G06 |
| Arabidopsis thaliana: yuc2-1 | Fiorucci et al.22 Nozue et al.97 | SALK_030199 |
| Arabidopsis thaliana: yuc8 | Fiorucci et al.22 Nozue et al.97 | CS110939 |
| Arabidopsis thaliana: yuc9-1 | Fiorucci et al.22 Nozue et al.97 | SAIL_871G01 |
| Arabidopsis thaliana: svp-41 pSVP::SVP-GFP | Kinoshita et al.25 | N/A |
| Arabidopsis thaliana: svp-32 | Lee et al.23 | SALK_072930C |
| Arabidopsis thaliana: flm-3 | Posé et al.24 | SALK_141971 |
| Arabidopsis thaliana: flm-3 FLM-ß-GFP | Posé et al.24 | N/A |
| Arabidopsis thaliana: flm-3 FLM-δ-GFP | Posé et al.24 | N/A |
| Arabidopsis thaliana: 35S::CO | Kumimoto et al.42 | N/A |
| Arabidopsis thaliana: phyB | Xiang et al.98 | SALK 069700C |
| Arabidopsis thaliana: rga-29 | Park et al.99 | SALK 089146 |
| Arabidopsis thaliana: gai-t6 (backcrossed to Col-0 6x) | Park et al.99 | N/A |
| Arabidopsis thaliana: rgl1 | Park et al.99 | SALK 136162 |
| Arabidopsis thaliana: rgl2 | Park et al.99 | SALK 027654 |
| Arabidopsis thaliana: rlg3-3 | Park et al.99 | CS16355 |
| Arabidopsis thaliana: agl24-25 | This study | CS882679 |
| Arabidopsis thaliana: ap1-10 | Mandel et al.63 | CS6230 |
| Arabidopsis thaliana: lfy-1 | Schultz et al.64 | CS6228 |
| Arabidopsis thaliana: soc1-2 | Sang et al.100 | N/A |
| Arabidopsis thaliana: pol-6 | Jones et al.13 | N/A |
| Arabidopsis thaliana: ft-10 | Yoo et al.101 | CS9869 |
| Arabidopsis thaliana: pSUC2::FT | Zhu et al.45 | N/A |
| Arabidopsis thaliana: pKNAT1::FT ft-10 | Liu et al.46 | N/A |
| Arabidopsis thaliana: ga1-25 | This study | SALK_027931C |
| Arabidopsis thaliana: fd-3 | Jang et al.43 | SALK_054421C |
| Arabidopsis thaliana: tfl1-1 gl1-3 | Shannon and Meeks-Wagner (1991)102 | CS6167 |
| Arabidopsis thaliana: tfl1-11 | Shannon and Meeks-Wagner (1993)103 | CS6235 |
| Arabidopsis thaliana: rlp10-1 (clv2) | Jones et al.13 | GABI 686A09 |
| Arabidopsis thaliana: pLFY::LFY-GFP | Zhu et al.53 | N/A |
| Arabidopsis thaliana: tsf-1 | Andres et al.47 | SALK_087522C |
| Oligonucleotides | ||
| CRISPR_crn-10A_F | Nimchuk104 | attgaagcaaagaagaagaagaaa |
| CRISPR_crn-10A_R | Nimchuk104 | aaacTTTCTTCTTCTTCTTTGCTT |
| PP2A_qPCR_F | Challa et al.105 | TATCGGATGACGATTCTTCGTGCAG |
| PP2A_qPCR_R | Challa et al.105 | GCTTGGTCGACTATCGGAATGAGAG |
| FT_qPCR_F | Martignago et al.106 | CTAGCAACCCTCACCTCCGAGAATA |
| FT_qPCR_R | Martignago et al.106 | CTGCCAAGCTGTCGAAACAATATAA |
| Genotyping primers | See Data S1 | |
| Recombinant DNA | ||
| ELF3-Q7-GFP | Jung et al.19 | N/A |
| ELF3-BdPrD-GFP | Jung et al.19 | N/A |
| pDGE667 | Stuttmann et al.107 | Addgene: 153232 |
| pDGE331 | Stuttmann et al.107 | Addgene: 153240 |
| pDGE331-gRNA(crn) | This study | N/A |
| pDGE667-gRNA(crn) | This study | N/A |
| Software and algorithms | ||
| Zen Blue 3.9.8 | Zeiss | |
| Graph Pad Prism | v10.4.1(627) | https://www.graphpad.com/ |
| indCAPS | Hodgens et al.108 | http://indcaps.kieber.cloudapps.unc.edu/ |
| Fiji 2.9.0 | NIH | https://imagej.net/software/fiji/downloads |
| Other | ||
| Proline HFC/B HydraFiber Advanced Substrate Growing Mix | Jolly Gardener | |
| Proline C/B Growing Mix | Jolly Gardener | |
| Propagation Mix | Sungro Horticulture | |
Quantification and Statistical Analysis
Unless otherwise noted, flower formation was quantified by classifying the first 30 flower attempts as normal flowers, terminated flowers, or terminated primordia as described in the Results12,13. The first flower attempt was defined as the first flower attempt after most apical axillary meristem before stable flower formation. Occasionally, plants grown at 30°C or with very strong FT upregulation in cool temperatures did not produce 30 flowers before senescing; for these individuals, the percentage of normal flowers, terminated flowers, and terminated primordia was calculated relative to the total number of flower attempts for that plant.
As we were primarily interested in specific pairwise comparisons between genotypes, we compared the percent terminated primordia between genotypes using non-parametric Mann-Whitney tests and corrected for multiple comparisons using the Holm-Sidak method, with p < 0.05 for the entire family of comparisons. We chose the more conservative Mann-Whitney test as percentages are not normally distributed but were necessary to use to compare data from plants that produced less than 30 flowers. The adjusted p value was used to report statistical significance using asterisks (p < 0.05 *; p < 0.01 **; p < 0.001 ***; p < 0.0001 ****.) The percent terminated primordia were analyzed using GraphPad Prism v10.4.1. At least two biological replicates were quantified for all experiments performed at 17–18°C and 30°C, except for the T1 experiment, which was performed once. Experiments at 22°C were quantified at least once with phenotypes qualitatively observed at least one additional time. Representative replicates are shown in the figures with sample sizes indicated in the figure legends.
Supplementary Material
Data S1. Genotyping primers and instructions for alleles used in this study. Related to Star Methods. (A) Primer combinations and genotyping specifications for alleles used in this study. (B) Primer sequences for genotyping primers used in this study. (C) Antibiotic resistances for reporters used in this study.
Highlights.
Elevated florigen bypasses the loss of CLAVATA signaling during flower outgrowth
Heat-induced florigen restores flower formation to crn plants
Continuous florigen after floral transition facilitates sustained flower production
CLAVATA signaling and florigen jointly promote flower formation across temperatures
Currently meeting the specifications: up to four highlights, each highlight cannot exceed 85 characters including spaces
Acknowledgments
The authors would like to thank Philip Wigge, George Coupland, Markus Schmid, Tai-ping Sun, Doris Wagner, Marcel Proveniers, Hao Yu, and Benjamin F Holt III for sharing seeds, vectors, and reporters. The Nimchuk lab would like to thank Jamie Winshell for assistance with lab management, James Garzoni and UNC greenhouse staff for assistance with plant growth conditions, Nathanaël Prunet and the Biology Microscopy Core for assistance with imaging, and Corbin Jones for discussions on statistical analysis. The authors wish to acknowledge FLOR-ID for helpful summaries of all flowering time pathways and related research91. Work in the lab of Z.L.N was supported by grants from the US National Institutes of Health (R35GM119614) and the National Science Foundation (IOS-1546837). E.S.S was supported by an NSF GRFP fellowship (DGE-2040435). V.C.G. was supported by an EMBO long term fellowship (ALTF 293-2013). Work in the lab of C.F. was supported by a grant from the Swiss National Science Foundation (310030_200318). Fig 7 and Graphical Abstract Arabidopsis and thermometer cartoons created in BioRender. Smith, E. (2025) https://BioRender.com/l67l924
Footnotes
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Declaration of Interests
The authors declare no competing interests.
References
- 1.Waddington CH (2014). The strategy of the genes (Routledge; ). [Google Scholar]
- 2.WADDINGTON CH (1959). Canalization of Development and Genetic Assimilation of Acquired Characters. Nature 183, 1654–1655. 10.1038/1831654a0. [DOI] [PubMed] [Google Scholar]
- 3.Maple R, Zhu P, Hepworth J, Wang J-W, and Dean C (2024). Flowering time: From physiology, through genetics to mechanism. Plant Physiology 195, 190–212. 10.1093/plphys/kiae109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Rezaei EE, Webber H, Asseng S, Boote K, Durand JL, Ewert F, Martre P, and MacCarthy DS (2023). Climate change impacts on crop yields. Nature Reviews Earth & Environment 4, 831–846. 10.1038/s43017-023-00491-0. [DOI] [Google Scholar]
- 5.Agnolucci P, Rapti C, Alexander P, De Lipsis V, Holland RA, Eigenbrod F, and Ekins P (2020). Impacts of rising temperatures and farm management practices on global yields of 18 crops. Nature Food 1, 562–571. 10.1038/s43016-020-00148-x. [DOI] [PubMed] [Google Scholar]
- 6.Delker C, Quint M, and Wigge PA (2022). Recent advances in understanding thermomorphogenesis signaling. Current Opinion in Plant Biology 68, 102231. 10.1016/j.pbi.2022.102231. [DOI] [PubMed] [Google Scholar]
- 7.Bellstaedt J, Trenner J, Lippmann R, Poeschl Y, Zhang X, Friml J, Quint M, and Delker C (2019). A Mobile Auxin Signal Connects Temperature Sensing in Cotyledons with Growth Responses in Hypocotyls. Plant Physiology 180, 757–766. 10.1104/pp.18.01377. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Galvan-Ampudia CS, Cerutti G, Legrand J, Brunoud G, Martin-Arevalillo R, Azais R, Bayle V, Moussu S, Wenzl C, Jaillais Y, et al. (2020). Temporal integration of auxin information for the regulation of patterning. eLife 9, e55832. 10.7554/eLife.55832. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Yadav S, Kumar H, Mahajan M, Sahu SK, Singh SK, and Yadav RK (2023). Local auxin biosynthesis promotes shoot patterning and stem cell differentiation in Arabidopsis shoot apex. Development 150, dev202014. 10.1242/dev.202014. [DOI] [PubMed] [Google Scholar]
- 10.Yamaguchi N, Wu M-F, Winter CM, Berns MC, Nole-Wilson S, Yamaguchi A, Coupland G, Krizek BA, and Wagner D (2013). A Molecular Framework for Auxin-Mediated Initiation of Flower Primordia. Developmental Cell 24, 271–282. 10.1016/j.devcel.2012.12.017. [DOI] [PubMed] [Google Scholar]
- 11.Smith ES, and Nimchuk ZL (2023). What a tangled web it weaves: auxin coordination of stem cell maintenance and flower production. Journal of Experimental Botany 74, 6950–6963. 10.1093/jxb/erad340. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.John A, Smith ES, Jones DS, Soyars CL, and Nimchuk ZL (2023). A network of CLAVATA receptors buffers auxin-dependent meristem maintenance. Nature Plants. 10.1038/s41477-023-01485-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Jones DS, John A, VanDerMolen KR, and Nimchuk ZL (2021). CLAVATA Signaling Ensures Reproductive Development in Plants across Thermal Environments. Current Biology 31, 220–227.e5. 10.1016/j.cub.2020.10.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Schoof H, Lenhard M, Haecker A, Mayer KFX, Jürgens G, and Laux T (2000). The Stem Cell Population of Arabidopsis Shoot Meristems Is Maintained by a Regulatory Loop between the CLAVATA and WUSCHEL Genes. Cell 100, 635–644. 10.1016/S0092-8674(00)80700-X. [DOI] [PubMed] [Google Scholar]
- 15.Brand U, Fletcher JC, Hobe M, Meyerowitz EM, and Simon R (2000). Dependence of Stem Cell Fate in Arabidopsis on a Feedback Loop Regulated by CLV3 Activity. Science 289, 617–619. 10.1126/science.289.5479.617. [DOI] [PubMed] [Google Scholar]
- 16.Smyth DR, Bowman JL, and Meyerowitz EM (1990). Early flower development in Arabidopsis. The Plant Cell 2, 755–767. 10.1105/tpc.2.8.755. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Box MS, Huang BE, Domijan M, Jaeger KE, Khattak AK, Yoo SJ, Sedivy EL, Jones DM, Hearn TJ, Webb AAR, et al. (2015). ELF3 Controls Thermoresponsive Growth in Arabidopsis. Current Biology 25, 194–199. 10.1016/j.cub.2014.10.076. [DOI] [PubMed] [Google Scholar]
- 18.Nieto C, López-Salmerón V, Davière J-M, and Prat S (2015). ELF3-PIF4 Interaction Regulates Plant Growth Independently of the Evening Complex. Current Biology 25, 187–193. 10.1016/j.cub.2014.10.070. [DOI] [PubMed] [Google Scholar]
- 19.Jung J-H, Barbosa AD, Hutin S, Kumita JR, Gao M, Derwort D, Silva CS, Lai X, Pierre E, Geng F, et al. (2020). A prion-like domain in ELF3 functions as a thermosensor in Arabidopsis. Nature 585, 256–260. 10.1038/s41586-020-2644-7. [DOI] [PubMed] [Google Scholar]
- 20.Sun J, Qi L, Li Y, Chu J, and Li C (2012). PIF4–Mediated Activation of YUCCA8 Expression Integrates Temperature into the Auxin Pathway in Regulating Arabidopsis Hypocotyl Growth. PLOS Genetics 8, e1002594. 10.1371/journal.pgen.1002594. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Lee S, Zhu L, and Huq E (2021). An autoregulatory negative feedback loop controls thermomorphogenesis in Arabidopsis. PLOS Genetics 17, e1009595. 10.1371/journal.pgen.1009595. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Fiorucci A-S, Galvão VC, Ince YÇ, Boccaccini A, Goyal A, Allenbach Petrolati L, Trevisan M, and Fankhauser C (2020). PHYTOCHROME INTERACTING FACTOR 7 is important for early responses to elevated temperature in Arabidopsis seedlings. New Phytologist 226, 50–58. 10.1111/nph.16316. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Lee JH, Yoo SJ, Park SH, Hwang I, Lee JS, and Ahn JH (2007). Role of SVP in the control of flowering time by ambient temperature in Arabidopsis. Genes & Development 21, 397–402. 10.1101/gad.1518407. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Posé D, Verhage L, Ott F, Yant L, Mathieu J, Angenent GC, Immink RGH, and Schmid M (2013). Temperature-dependent regulation of flowering by antagonistic FLM variants. Nature 503, 414–417. 10.1038/nature12633. [DOI] [PubMed] [Google Scholar]
- 25.Kinoshita A, Vayssières A, Richter R, Sang Q, Roggen A, van Driel AD, Smith RS, and Coupland G (2020). Regulation of shoot meristem shape by photoperiodic signaling and phytohormones during floral induction of Arabidopsis. eLife 9, e60661. 10.7554/eLife.60661. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Jin S, Kim SY, Susila H, Nasim Z, Youn G, and Ahn JH (2022). FLOWERING LOCUS M isoforms differentially affect the subcellular localization and stability of SHORT VEGETATIVE PHASE to regulate temperature-responsive flowering in Arabidopsis. Molecular Plant. 10.1016/j.molp.2022.08.007. [DOI] [PubMed] [Google Scholar]
- 27.Lee JH, Ryu H-S, Chung KS, Posé D, Kim S, Schmid M, and Ahn JH (2013). Regulation of Temperature-Responsive Flowering by MADS-Box Transcription Factor Repressors. Science 342, 628–632. 10.1126/science.1241097. [DOI] [PubMed] [Google Scholar]
- 28.Kim W-Y, Hicks KA, and Somers DE (2005). Independent Roles for EARLY FLOWERING 3 and ZEITLUPE in the Control of Circadian Timing, Hypocotyl Length, and Flowering Time. Plant Physiology 139, 1557–1569. 10.1104/pp.105.067173. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Lu SX, Webb CJ, Knowles SM, Kim SHJ, Wang Z, and Tobin EM (2012). CCA1 and ELF3 Interact in the Control of Hypocotyl Length and Flowering Time in Arabidopsis. Plant Physiology 158, 1079–1088. 10.1104/pp.111.189670. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Freytes SN, Canelo M, and Cerdán PD (2021). Regulation of Flowering Time: When and Where? Current Opinion in Plant Biology 63, 102049. 10.1016/j.pbi.2021.102049. [DOI] [PubMed] [Google Scholar]
- 31.Galvão VC, Horrer D, Küttner F, and Schmid M (2012). Spatial control of flowering by DELLA proteins in Arabidopsis thaliana. Development 139, 4072–4082. 10.1242/dev.080879. [DOI] [PubMed] [Google Scholar]
- 32.Porri A, Torti S, Romera-Branchat M, and Coupland G (2012). Spatially distinct regulatory roles for gibberellins in the promotion of flowering of Arabidopsis under long photoperiods. Development 139, 2198–2209. 10.1242/dev.077164. [DOI] [PubMed] [Google Scholar]
- 33.Putterill J, Robson F, Lee K, Simon R, and Coupland G (1995). The CONSTANS gene of arabidopsis promotes flowering and encodes a protein showing similarities to zinc finger transcription factors. Cell 80, 847–857. 10.1016/0092-8674(95)90288-0. [DOI] [PubMed] [Google Scholar]
- 34.Cerdán PD, and Chory J (2003). Regulation of flowering time by light quality. Nature 423, 881–885. 10.1038/nature01636. [DOI] [PubMed] [Google Scholar]
- 35.Endo M, Tanigawa Y, Murakami T, Araki T, and Nagatani A (2013). PHYTOCHROME-DEPENDENT LATE-FLOWERING accelerates flowering through physical interactions with phytochrome B and CONSTANS. Proceedings of the National Academy of Sciences 110, 18017–18022. 10.1073/pnas.1310631110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Quiroz S, Yustis JC, Chávez-Hernández EC, Martínez T, Sanchez MD, Garay-Arroyo A, Álvarez-Buylla ER, and García-Ponce B (2021). Beyond the Genetic Pathways, Flowering Regulation Complexity in Arabidopsis thaliana. International Journal of Molecular Sciences 22. 10.3390/ijms22115716. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Corbesier L, Vincent C, Jang S, Fornara F, Fan Q, Searle I, Giakountis A, Farrona S, Gissot L, Turnbull C, et al. (2007). FT Protein Movement Contributes to Long-Distance Signaling in Floral Induction of Arabidopsis. Science 316, 1030–1033. 10.1126/science.1141752. [DOI] [PubMed] [Google Scholar]
- 38.Jaeger KE, and Wigge PA (2007). FT Protein Acts as a Long-Range Signal in Arabidopsis. Current Biology 17, 1050–1054. 10.1016/j.cub.2007.05.008. [DOI] [PubMed] [Google Scholar]
- 39.Mathieu J, Warthmann N, Küttner F, and Schmid M (2007). Export of FT Protein from Phloem Companion Cells Is Sufficient for Floral Induction in Arabidopsis. Current Biology 17, 1055–1060. 10.1016/j.cub.2007.05.009. [DOI] [PubMed] [Google Scholar]
- 40.Samach A, Onouchi H, Gold SE, Ditta GS, Schwarz-Sommer Z, Yanofsky MF, and Coupland G (2000). Distinct Roles of CONSTANS Target Genes in Reproductive Development of Arabidopsis. Science 288, 1613–1616. 10.1126/science.288.5471.1613. [DOI] [PubMed] [Google Scholar]
- 41.Halliday KJ, Salter MG, Thingnaes E, and Whitelam GC (2003). Phytochrome control of flowering is temperature sensitive and correlates with expression of the floral integrator FT. The Plant Journal 33, 875–885. 10.1046/j.1365-313X.2003.01674.x. [DOI] [PubMed] [Google Scholar]
- 42.Kumimoto RW, Zhang Y, Siefers N, and Holt III BF (2010). NF–YC3, NF–YC4 and NF–YC9 are required for CONSTANS-mediated, photoperiod-dependent flowering in Arabidopsis thaliana. The Plant Journal 63, 379–391. 10.1111/j.1365-313X.2010.04247.x. [DOI] [PubMed] [Google Scholar]
- 43.Jang S, Torti S, and Coupland G (2009). Genetic and spatial interactions between FT, TSF and SVP during the early stages of floral induction in Arabidopsis. The Plant Journal 60, 614–625. 10.1111/j.1365-313X.2009.03986.x. [DOI] [PubMed] [Google Scholar]
- 44.Fukazawa J, Ohashi Y, Takahashi R, Nakai K, and Takahashi Y (2021). DELLA degradation by gibberellin promotes flowering via GAF1-TPR-dependent repression of floral repressors in Arabidopsis. The Plant Cell 33, 2258–2272. 10.1093/plcell/koab102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Zhu Y, Liu L, Shen L, and Yu H (2016). NaKR1 regulates long-distance movement of FLOWERING LOCUS T in Arabidopsis. Nature Plants 2, 16075. 10.1038/nplants.2016.75. [DOI] [PubMed] [Google Scholar]
- 46.Liu L, Zhang Y, and Yu H (2020). Florigen trafficking integrates photoperiod and temperature signals in Arabidopsis. Journal of Integrative Plant Biology 62, 1385–1398. 10.1111/jipb.13000. [DOI] [PubMed] [Google Scholar]
- 47.Andrés F, Porri A, Torti S, Mateos J, Romera-Branchat M, García-Martínez JL, Fornara F, Gregis V, Kater MM, and Coupland G (2014). SHORT VEGETATIVE PHASE reduces gibberellin biosynthesis at the Arabidopsis shoot apex to regulate the floral transition. Proceedings of the National Academy of Sciences 111, E2760–E2769. 10.1073/pnas.1409567111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Silverstone AL, Mak PYA, Martinez EC, and Sun T (1997). The New RGA Locus Encodes a Negative Regulator of Gibberellin Response in Arabidopsis thaliana. Genetics 146, 1087–1099. 10.1093/genetics/146.3.1087. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Wang J-W, Czech B, and Weigel D (2009). miR156-Regulated SPL Transcription Factors Define an Endogenous Flowering Pathway in Arabidopsis thaliana. Cell 138, 738–749. 10.1016/j.cell.2009.06.014. [DOI] [PubMed] [Google Scholar]
- 50.Yu S, Galvão VC, Zhang Y-C, Horrer D, Zhang T-Q, Hao Y-H, Feng Y-Q, Wang S, Schmid M, and Wang J-W (2012). Gibberellin Regulates the Arabidopsis Floral Transition through miR156-Targeted SQUAMOSA PROMOTER BINDING–LIKE Transcription Factors. The Plant Cell 24, 3320–3332. 10.1105/tpc.112.101014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Abe M, Kobayashi Y, Yamamoto S, Daimon Y, Yamaguchi A, Ikeda Y, Ichinoki H, Notaguchi M, Goto K, and Araki T (2005). FD, a bZIP Protein Mediating Signals from the Floral Pathway Integrator FT at the Shoot Apex. Science 309, 1052–1056. 10.1126/science.1115983. [DOI] [PubMed] [Google Scholar]
- 52.Wigge PA, Kim MC, Jaeger KE, Busch W, Schmid M, Lohmann JU, and Weigel D (2005). Integration of Spatial and Temporal Information During Floral Induction in Arabidopsis. Science 309, 1056–1059. 10.1126/science.1114358. [DOI] [PubMed] [Google Scholar]
- 53.Zhu Y, Klasfeld S, Jeong CW, Jin R, Goto K, Yamaguchi N, and Wagner D (2020). TERMINAL FLOWER 1-FD complex target genes and competition with FLOWERING LOCUS T. Nature Communications 11, 5118. 10.1038/s41467-020-18782-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Bradley D, Ratcliffe O, Vincent C, Carpenter R, and Coen E (1997). Inflorescence Commitment and Architecture in Arabidopsis. Science 275, 80–83. 10.1126/science.275.5296.80. [DOI] [PubMed] [Google Scholar]
- 55.Kim W, Park TI, Yoo SJ, Jun AR, and Ahn JH (2013). Generation and analysis of a complete mutant set for the Arabidopsis FT/TFL1 family shows specific effects on thermo-sensitive flowering regulation. Journal of Experimental Botany 64, 1715–1729. 10.1093/jxb/ert036. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Liu C, Chen H, Er HL, Soo HM, Kumar PP, Han J-H, Liou YC, and Yu H (2008). Direct interaction of AGL24 and SOC1 integrates flowering signals in Arabidopsis. Development 135, 1481–1491. 10.1242/dev.020255. [DOI] [PubMed] [Google Scholar]
- 57.Lee J, and Lee I (2010). Regulation and function of SOC1, a flowering pathway integrator. Journal of Experimental Botany 61, 2247–2254. 10.1093/jxb/erq098. [DOI] [PubMed] [Google Scholar]
- 58.Collani S, Neumann M, Yant L, and Schmid M (2019). FT Modulates Genome-Wide DNA-Binding of the bZIP Transcription Factor FD. Plant Physiology 180, 367–380. 10.1104/pp.18.01505. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Brightbill CM, and Sung S (2022). Temperature-mediated regulation of flowering time in Arabidopsis thaliana. aBIOTECH 3, 78–84. 10.1007/s42994-022-00069-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Yamaguchi A, Kobayashi Y, Goto K, Abe M, and Araki T (2005). TWIN SISTER OF FT (TSF) Acts as a Floral Pathway Integrator Redundantly with FT. Plant and Cell Physiology 46, 1175–1189. 10.1093/pcp/pci151. [DOI] [PubMed] [Google Scholar]
- 61.Michaels SD, Himelblau E, Kim SY, Schomburg FM, and Amasino RM (2005). Integration of Flowering Signals in Winter-Annual Arabidopsis. Plant Physiology 137, 149–156. 10.1104/pp.104.052811. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Romera-Branchat M, Severing E, Pocard C, Ohr H, Vincent C, Née G, Martinez-Gallegos R, Jang S, Andrés F, Madrigal P, et al. (2020). Functional Divergence of the Arabidopsis Florigen-Interacting bZIP Transcription Factors FD and FDP. Cell Reports 31, 107717. 10.1016/j.celrep.2020.107717. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Alejandra Mandel M, Gustafson-Brown C, Savidge B, and Yanofsky MF (1992). Molecular characterization of the Arabidopsis floral homeotic gene APETALA1. Nature 360, 273–277. 10.1038/360273a0. [DOI] [PubMed] [Google Scholar]
- 64.Schultz EA, and Haughn GW (1991). LEAFY, a Homeotic Gene That Regulates Inflorescence Development in Arabidopsis. The Plant Cell 3, 771–781. 10.1105/tpc.3.8.771. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.DeFalco TA, Anne P, James SR, Willoughby AC, Schwanke F, Johanndrees O, Genolet Y, Derbyshire P, Wang Q, Rana S, et al. (2022). A conserved module regulates receptor kinase signalling in immunity and development. Nature Plants 8, 356–365. 10.1038/s41477-022-01134-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Wilkins AS (1997). Canalization: A molecular genetic perspective. BioEssays 19, 257–262. 10.1002/bies.950190312. [DOI] [PubMed] [Google Scholar]
- 67.Chen D, Lyu M, Kou X, Li J, Yang Z, Gao L, Li Y, Fan L, Shi H, and Zhong S (2022). Integration of light and temperature sensing by liquid-liquid phase separation of phytochrome B. Molecular Cell 82, 3015–3029.e6. 10.1016/j.molcel.2022.05.026. [DOI] [PubMed] [Google Scholar]
- 68.Jung J-H, Domijan M, Klose C, Biswas S, Ezer D, Gao M, Khattak AK, Box MS, Charoensawan V, Cortijo S, et al. (2016). Phytochromes function as thermosensors in Arabidopsis. Science 354, 886–889. 10.1126/science.aaf6005. [DOI] [PubMed] [Google Scholar]
- 69.Legris M, Klose C, Burgie ES, Rojas CCR, Neme M, Hiltbrunner A, Wigge PA, Schäfer E, Vierstra RD, and Casal JJ (2016). Phytochrome B integrates light and temperature signals in Arabidopsis. Science 354, 897–900. 10.1126/science.aaf5656. [DOI] [PubMed] [Google Scholar]
- 70.Müller-Xing R, Clarenz O, Pokorny L, Goodrich J, and Schubert D (2014). Polycomb-Group Proteins and FLOWERING LOCUS T Maintain Commitment to Flowering in Arabidopsis thaliana. The Plant Cell 26, 2457–2471. 10.1105/tpc.114.123323. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71.Liu L, Farrona S, Klemme S, and Turck FK (2014). Post-fertilization expression of FLOWERING LOCUS T suppresses reproductive reversion. Frontiers in Plant Science 5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72.Tian C, Zhang X, He J, Yu H, Wang Y, Shi B, Han Y, Wang G, Feng X, Zhang C, et al. (2014). An organ boundary-enriched gene regulatory network uncovers regulatory hierarchies underlying axillary meristem initiation. Molecular Systems Biology 10, 755. 10.15252/msb.20145470. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73.Yadav RK, Girke T, Pasala S, Xie M, and Reddy GV (2009). Gene expression map of the Arabidopsis shoot apical meristem stem cell niche. Proceedings of the National Academy of Sciences 106, 4941–4946. 10.1073/pnas.0900843106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 74.Cheng Y, Dai X, and Zhao Y (2006). Auxin biosynthesis by the YUCCA flavin monooxygenases controls the formation of floral organs and vascular tissues in Arabidopsis. Genes & Development 20, 1790–1799. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75.Shi B, Guo X, Wang Y, Xiong Y, Wang J, Hayashi K, Lei J, Zhang L, and Jiao Y (2018). Feedback from Lateral Organs Controls Shoot Apical Meristem Growth by Modulating Auxin Transport. Developmental Cell 44, 204–216.e6. 10.1016/j.devcel.2017.12.021. [DOI] [PubMed] [Google Scholar]
- 76.Ma Y, Miotk A, Šutiković Z, Ermakova O, Wenzl C, Medzihradszky A, Gaillochet C, Forner J, Utan G, Brackmann K, et al. (2019). WUSCHEL acts as an auxin response rheostat to maintain apical stem cells in Arabidopsis. Nature Communications 10, 5093. 10.1038/s41467-019-13074-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 77.Reinhardt D, Pesce E-R, Stieger P, Mandel T, Baltensperger K, Bennett M, Traas J, Friml J, and Kuhlemeier C (2003). Regulation of phyllotaxis by polar auxin transport. Nature 426, 255–260. 10.1038/nature02081. [DOI] [PubMed] [Google Scholar]
- 78.Heisler MG, Ohno C, Das P, Sieber P, Reddy GV, Long JA, and Meyerowitz EM (2005). Patterns of Auxin Transport and Gene Expression during Primordium Development Revealed by Live Imaging of the Arabidopsis Inflorescence Meristem. Current Biology 15, 1899–1911. 10.1016/j.cub.2005.09.052. [DOI] [PubMed] [Google Scholar]
- 79.Besnard F, Refahi Y, Morin V, Marteaux B, Brunoud G, Chambrier P, Rozier F, Mirabet V, Legrand J, Lainé S, et al. (2014). Cytokinin signalling inhibitory fields provide robustness to phyllotaxis. Nature 505, 417–421. 10.1038/nature12791. [DOI] [PubMed] [Google Scholar]
- 80.Besnard F, Rozier F, and Vernoux T (2014). The AHP6 cytokinin signaling inhibitor mediates an auxin-cytokinin crosstalk that regulates the timing of organ initiation at the shoot apical meristem. Plant Signaling & Behavior 9, e28788. 10.4161/psb.28788. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 81.Dai Y, Luo L, and Zhao Z (2023). Genetic robustness control of auxin output in priming organ initiation. Proceedings of the National Academy of Sciences 120, e2221606120. 10.1073/pnas.2221606120. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 82.Hyun Y, Richter R, Vincent C, Martinez-Gallegos R, Porri A, and Coupland G (2016). Multi-layered Regulation of SPL15 and Cooperation with SOC1 Integrate Endogenous Flowering Pathways at the Arabidopsis Shoot Meristem. Developmental Cell 37, 254–266. 10.1016/j.devcel.2016.04.001. [DOI] [PubMed] [Google Scholar]
- 83.Lindsay P, Swentowsky KW, and Jackson D (2024). Cultivating potential: Harnessing plant stem cells for agricultural crop improvement. Molecular Plant 17, 50–74. 10.1016/j.molp.2023.12.014. [DOI] [PubMed] [Google Scholar]
- 84.Tuncel A, Pan C, Clem JS, Liu D, and Qi Y (2025). CRISPR–Cas applications in agriculture and plant research. Nature Reviews Molecular Cell Biology. 10.1038/s41580-025-00834-3. [DOI] [PubMed] [Google Scholar]
- 85.Cheng F, Song M, Zhang M, Cheng C, Chen J, and Lou Q (2022). A SNP mutation in the CsCLAVATA1 leads to pleiotropic variation in plant architecture and fruit morphogenesis in cucumber (Cucumis sativus L). Plant Science 323, 111397. 10.1016/j.plantsci.2022.111397. [DOI] [PubMed] [Google Scholar]
- 86.Xu C, Liberatore KL, MacAlister CA, Huang Z, Chu Y-H, Jiang K, Brooks C, Ogawa-Ohnishi M, Xiong G, Pauly M, et al. (2015). A cascade of arabinosyltransferases controls shoot meristem size in tomato. Nature Genetics 47, 784–792. 10.1038/ng.3309. [DOI] [PubMed] [Google Scholar]
- 87.Liu L, Gallagher J, Arevalo ED, Chen R, Skopelitis T, Wu Q, Bartlett M, and Jackson D (2021). Enhancing grain-yield-related traits by CRISPR–Cas9 promoter editing of maize CLE genes. Nature Plants 7, 287–294. 10.1038/s41477-021-00858-5. [DOI] [PubMed] [Google Scholar]
- 88.Yuste-Lisbona FJ, Fernández-Lozano A, Pineda B, Bretones S, Ortíz-Atienza A, García-Sogo B, Müller NA, Angosto T, Capel J, Moreno V, et al. (2020). ENO regulates tomato fruit size through the floral meristem development network. Proceedings of the National Academy of Sciences 117, 8187–8195. 10.1073/pnas.1913688117. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 89.Kishchenko O, Zhou Y, Jatayev S, Shavrukov Y, and Borisjuk N (2020). Gene editing applications to modulate crop flowering time and seed dormancy. aBIOTECH 1, 233–245. 10.1007/s42994-020-00032-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 90.Niu F, Rehmani MS, and Yan J (2024). Multilayered regulation and implication of flowering time in plants. Plant Physiology and Biochemistry 213, 108842. 10.1016/j.plaphy.2024.108842. [DOI] [PubMed] [Google Scholar]
- 91.Bouché F, Lobet G, Tocquin P, and Périlleux C (2016). FLOR-ID: an interactive database of flowering-time gene networks in Arabidopsis thaliana. Nucleic Acids Research 44, D1167–D1171. 10.1093/nar/gkv1054. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 92.Leivar P, Monte E, Al-Sady B, Carle C, Storer A, Alonso JM, Ecker JR, and Quail PH (2008). The Arabidopsis Phytochrome-Interacting Factor PIF7, Together with PIF3 and PIF4, Regulates Responses to Prolonged Red Light by Modulating phyB Levels. The Plant Cell 20, 337–352. 10.1105/tpc.107.052142. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 93.Kim J, Yi H, Choi G, Shin B, Song P-S, and Choi G (2003). Functional Characterization of Phytochrome Interacting Factor 3 in Phytochrome-Mediated Light Signal Transduction. The Plant Cell 15, 2399–2407. 10.1105/tpc.014498. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 94.Lorrain S, Allen T, Duek PD, Whitelam GC, and Fankhauser C (2008). Phytochrome-mediated inhibition of shade avoidance involves degradation of growth-promoting bHLH transcription factors. The Plant Journal 53, 312–323. 10.1111/j.1365-313X.2007.03341.x. [DOI] [PubMed] [Google Scholar]
- 95.Fujimori T, Yamashino T, Kato T, and Mizuno T (2004). Circadian-Controlled Basic/Helix-Loop-Helix Factor, PIL6, Implicated in Light-Signal Transduction in Arabidopsis thaliana. Plant and Cell Physiology 45, 1078–1086. 10.1093/pcp/pch124. [DOI] [PubMed] [Google Scholar]
- 96.Oh J, Park E, Song K, Bae G, and Choi G (2020). PHYTOCHROME INTERACTING FACTOR8 Inhibits Phytochrome A-Mediated Far-Red Light Responses in Arabidopsis. The Plant Cell 32, 186–205. 10.1105/tpc.19.00515. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 97.Nozue K, Tat AV, Kumar Devisetty U, Robinson M, Mumbach MR, Ichihashi Y, Lekkala S, and Maloof JN (2015). Shade Avoidance Components and Pathways in Adult Plants Revealed by Phenotypic Profiling. PLOS Genetics 11, e1004953. 10.1371/journal.pgen.1004953. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 98.Xiang S, Wu S, Jing Y, Chen L, and Yu D (2022). Phytochrome B regulates jasmonic acid-mediated defense response against Botrytis cinerea in Arabidopsis. Plant Diversity 44, 109–115. 10.1016/j.pld.2021.01.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 99.Park J, Nguyen KT, Park E, Jeon J-S, and Choi G (2013). DELLA Proteins and Their Interacting RING Finger Proteins Repress Gibberellin Responses by Binding to the Promoters of a Subset of Gibberellin-Responsive Genes in Arabidopsis. The Plant Cell 25, 927–943. 10.1105/tpc.112.108951. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 100.Sang Q, Pajoro A, Sun H, Song B, Yang X, Stolze SC, Andrés F, Schneeberger K, Nakagami H, and Coupland G (2020). Mutagenesis of a Quintuple Mutant Impaired in Environmental Responses Reveals Roles for CHROMATIN REMODELING4 in the Arabidopsis Floral Transition[OPEN]. The Plant Cell 32, 1479–1500. 10.1105/tpc.19.00992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 101.Yoo SK, Chung KS, Kim J, Lee JH, Hong SM, Yoo SJ, Yoo SY, Lee JS, and Ahn JH (2005). CONSTANS Activates SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 through FLOWERING LOCUS T to Promote Flowering in Arabidopsis. Plant Physiology 139, 770–778. 10.1104/pp.105.066928. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 102.Shannon S, and Meeks-Wagner DR (1991). A Mutation in the Arabidopsis TFL1 Gene Affects Inflorescence Meristem Development. The Plant Cell 3, 877–892. 10.1105/tpc.3.9.877. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 103.Shannon S, and Meeks-Wagner DR (1993). Genetic Interactions That Regulate Inflorescence Development in Arabidopsis. The Plant Cell 5, 639–655. 10.1105/tpc.5.6.639. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 104.Nimchuk ZL (2017). CLAVATA1 controls distinct signaling outputs that buffer shoot stem cell proliferation through a two-step transcriptional compensation loop. PLOS Genetics 13, e1006681. 10.1371/journal.pgen.1006681. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 105.Challa KR, Rath M, and Nath U (2019). The CIN-TCP transcription factors promote commitment to differentiation in Arabidopsis leaf pavement cells via both auxin-dependent and independent pathways. PLOS Genetics 15, e1007988. 10.1371/journal.pgen.1007988. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 106.Martignago D, da Silveira Falavigna V, Lombardi A, Gao H, Korwin Kurkowski P, Galbiati M, Tonelli C, Coupland G, and Conti L (2023). The bZIP transcription factor AREB3 mediates FT signalling and floral transition at the Arabidopsis shoot apical meristem. PLOS Genetics 19, e1010766. 10.1371/journal.pgen.1010766. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 107.Stuttmann J, Barthel K, Martin P, Ordon J, Erickson JL, Herr R, Ferik F, Kretschmer C, Berner T, Keilwagen J, et al. (2021). Highly efficient multiplex editing: one-shot generation of 8× Nicotiana benthamiana and 12× Arabidopsis mutants. The Plant Journal 106, 8–22. 10.1111/tpj.15197. [DOI] [PubMed] [Google Scholar]
- 108.Hodgens C, Nimchuk ZL, and Kieber JJ (2017). indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events. PLOS ONE 12, e0188406. 10.1371/journal.pone.0188406. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 109.Clough SJ, and Bent AF (1998). Floral dip: a simplified method for -mediated transformation of. The Plant Journal 16, 735–743. 10.1046/j.1365-313x.1998.00343.x. [DOI] [PubMed] [Google Scholar]
- 110.Prunet N, Jack TP, and Meyerowitz EM (2016). Live confocal imaging of Arabidopsis flower buds. Developmental Biology 419, 114–120. 10.1016/j.ydbio.2016.03.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data S1. Genotyping primers and instructions for alleles used in this study. Related to Star Methods. (A) Primer combinations and genotyping specifications for alleles used in this study. (B) Primer sequences for genotyping primers used in this study. (C) Antibiotic resistances for reporters used in this study.
Data Availability Statement
All data reported in this paper will be shared by the lead contact upon request. This paper does not report original code. Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.
