Skip to main content
NCBI home page
BMC Musculoskeletal Disorders logoLink to BMC Musculoskeletal Disorders
. 2025 Jul 5;26:657. doi: 10.1186/s12891-025-08903-6

Swimming exercise reduces H-type vessels by down-regulating the Hif-1α/VEGFa pathway in mice with osteoarthritis of the knee

Lingxiao Huang 1, Wanchun Du 1, Xing Jin 2, Bo Chen 3,✉, Zhaoxiang Meng 2,✉
PMCID: PMC12228181  PMID: 40618094

Abstract

Aims

The efficacy of swimming in managing knee osteoarthritis (KOA) is well documented. However, the potential of swimming to regulate the Hif-1α/VEGFa pathway and thereby hindering the formation of subchondral bone H-type vessels, remains to be fully elucidated.

Methods

A mouse model of KOA was established by intra-articular injection of papain solution, followed by a swimming intervention. Symptomatic changes were observed by measuring body weight and knee joint diameter. Behavioural tests were used to assess exercise-related functions. HE staining was used to observe bone tissue morphology, while immunofluorescence staining was used to observe variations in H-type vessels of the subchondral bone. Quantitative PCR and western blotting were used to determine the expression levels of the pathway mRNA and protein.

Results

The results obtained from this study revealed that KOA mice exhibited activation of the Hif-1α/VEGFa pathway in the tibial plateau bone, increased H-type vessels in the subchondral bone, and significant cartilage degeneration. In contrast, mice in the swimming exercise group demonstrated faster recovery from body weight and knee swelling, and exhibited superior performance in the balance beam test, rotarod test, and open field test. The swimming exercise group exhibited reduced articular cartilage destruction, diminished formation of H-type vessels in the subchondral bone, and decreased mRNA and protein expression of the Hif-1α/VEGFa pathway.

Conclusion

Articular cartilage in KOA mice exhibited signs of degradation and joint function was impaired. The findings of this study demonstrate that swimming exercise led to a down-regulation of the Hif-1α/VEGFa pathway in the tibial plateau bone of KOA mice, an inhibition of H-type vessels in the subchondral bone, and an improvement in cartilage morphology.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12891-025-08903-6.

Keywords: Knee osteoarthritis, Swimming, H-type vessels, Hif-1α, VEGFa

Introduction

Knee osteoarthritis (KOA) is a prevalent chronic degenerative joint disease characterised by the deterioration of articular cartilage and meniscus, the formation of bony protuberances at the joint margins, subchondral bone sclerosis, inflammation and fibrosis of infrapatellar fat pad and synovial membrane [1, 2]. The ageing population has led to a marked increase in the incidence of KOA, resulting in joint pain and dysfunction. This has a significant impact on the quality of life of patients and increases the burden on society [3]. Traditionally, the treatment of KOA has relied on medication, physical therapy and surgical intervention [4]. However, there is an increasing focus on non-pharmacological interventions, with exercise therapy being a particularly salient component of the fundamental treatment approach for KOA [5].

In this context, swimming exercise, as a low-impact, whole-body aerobic exercise, has gradually gained widespread attention due to its multifaceted advantages, such as the ability to reduce joint loading, improve joint flexibility, enhance muscle strength, and promote blood circulation [6, 7]. The buoyancy of water reduces weight-bearing and provides direct relief from joint pain [8]. Furthermore, swimming leads to adaptations in the cardiovascular system that increase aerobic capacity, improve blood oxygen supply to the joints’ circulation, and modulate the inflammatory response, thus positively affecting KOA [8, 9].

The pathogenesis of KOA is complex and multifactorial in nature. Typically, healthy articular cartilage is avascular, and the neovascularization in the subchondral bone is also modest [10]. Abnormal angiogenesis is also a key factor in the pathological process of KOA, causing structural damage to osteochondral bone as well as pain [11, 12]. H-type vessels are capillaries that exhibit high levels of platelet endothelial cell adhesion molecule 1 (CD31) and endothelial mucin (Emcn) [13]. These vessels modify the subchondral bone microenvironment, resulting in local hypoxia, acidification, and a disturbance in nutrient equilibrium. These alterations affect the metabolic function and regenerative capacity of cartilage cells [14]. The formation of an aberrant vascular network has been demonstrated to affect the structure of bone trabeculae, leading to the development of abnormal osteophytes during bone remodelling and the formation of bone capillaries [15]. This, in turn, has been shown to exacerbate joint pain and functional limitation [15].

Hypoxia-inducible factor 1α (Hif-1α) is not only involved in regulating cellular adaptation to hypoxia, but also exhibits its unique regulatory ability in KOA [16]. Hif-1α binds to hypoxia-inducible factor 1β (Hif-1β) to form the hypoxia-inducible factor 1 (Hif-1) complex, which in turn binds to hypoxia-responsive elements (HREs) in the promoter region of genes to activate transcription of downstream genes such as vascular endothelial growth factor a (VEGFa) [17]. VEGFa is one of the key regulators of vascular growth, which plays an important paracrine and autocrine role in inducing angiogenesis by promoting vascular endothelial cell division [18]. So does the Hif-1α/VEGFa pathway regulate H-type vessels in subchondral bone in KOA? What is the role of exercise swimming in this process? These are questions that remain to be answered by research.

In this study, we used a mouse model of KOA induced by intra-articular injection of papain solution to evaluate the effect of exercise therapy on KOA mice through a 4-week swimming exercise intervention and to investigate the effect of the Hif-1α/VEGFa signalling pathway in the knee joint. It is hoped that this study will provide theoretical insight into the mechanism of KOA and swimming exercise therapy.

Materials and methods

Animals and experimental design

Forty-five 6- to 8-week-old male C57BL/6 mice were purchased from Yangzhou University (Yangzhou, China). Mice were housed under standard laboratory conditions with free access to food and water, and maintained on a 1:1 day/night cycle at a temperature of 22 °C. All animals were acclimatised for 1 week and then randomly divided into 3 groups: normal group (N, n = 15), model group (M, n = 15) mice for KOA modelling and exercise group (E, n = 15) mice for exercise training after KOA modelling. All animal experiments were approved by the Animal Ethics Committee of Yangzhou University (No.202303840, Ethical Approval Date:2023-03-08).

Establishment of the KOA model

Modelling was performed by injecting papain solution into the right knee space of mice in the model and exercise groups [19]. L-cysteine-activated papain solution was prepared by dissolving papain (Sigma, P3375-25G) and L-cysteine (Sigma, C7352-25G) in sterile saline to produce a mixture of 4% papain and 0.03 mol/L L-cysteine, which was filtered through a 0.22 μm membrane. On days 1, 4 and 7 of the experiment, 5 µL of papain solution was injected into the right knee joint cavity of mice in the model and exercise groups; the normal group received only an equal amount of saline injected into the right knee joint cavity of mice.

Training protocol

Swimming training was started on the 8th day of the experiment for the mice in the exercise group. The mice were placed in a container (75 cm length × 55 cm width × 20 cm water depth) for swimming for 4 weeks. Acclimatisation training was performed for 20 min on the first day of week 1, increasing by 5 min per day, and 50 min per day from week 2 [20, 21].

Weight change

Mice in each group were weighed using an electronic scale, and body weight was measured once a day during the week of modelling and once every 3 days during the 4 weeks of exercise intervention. Body weight change = (body weight on day n - body weight on day 1)/body weight on day 1 × 100%.

Swelling rate

During the period of modelling and exercise training, the lateral knee diameters of each group of mice were measured bilaterally every 3 days using calipers. Three measurements were taken and averaged. The swelling rate = (mean right knee diameter - mean left knee diameter)/mean left knee diameter × 100%.

Behavioral tests

The day the last swim, the motor function of each group of mice was tested using the balance beam test, the rotarod test and the open field test. The balance beam test can assess the mice’s motor coordination and balance ability by suspending a 1 m long and 2 cm wide wooden beam in the air, with a sponge pad underneath to prevent the mice from falling. The time taken for each group of mice to pass the bar and their missteps were recorded. The rotarod test can be used to assess motor coordination and endurance in mice. The mice were placed on a rotating drum and the drum speed was increased and maintained at 25 rpm for 5 min. The time taken for the mice to fall off the drum was recorded. The open field test was used to test the spontaneous mobility of the mice by placing the mice in the centre of an open box (50 cm × 50 cm × 40 cm) and allowing them to explore freely. The distance and speed of the mice’s movements were monitored for 10 min by the camera connected to the VisuTrack analysis software (Shanghai Xinruan Informatlon Technology Co., Ltd), which was mounted on top of the box in the centre of the box.

Tissue preparation

Bone samples were collected from mice at the end of motor training and behavioural testing. The mice were euthanised with carbon dioxide gas, and the knee joints of the right hind limbs of the mice were selected to remove the attached soft tissues. After cleaning the mouse hind limb bone with 0.01 M PBS, part of the bone samples were directly frozen in liquid nitrogen for subsequent qPCR and Western blotting experiments, and the remaining samples were fixed with 4% paraformaldehyde at 4℃ for 48 h. Then they were cleaned again with 0.01 M PBS and the bone tissues were decalcified with 10% ethylenediamine tetraacetic acid (EDTA) solution for 30 days. The decalcification fluid was changed every 5 days until the bone tissue was softened for subsequent histological staining and immunofluorescence experiments.

Histological staining

Knee joints with complete decalcification were embedded in paraffin. Serial sections of 6 μm were made along the coronal surface of each knee joint. After sectioning, the bone tissues were stained according to the standard procedure for HE staining (Zhuhai Beisuo Biotechnology Co., Ltd, BA4041 and BA4024), and the sections were sealed with neutral gum. Tissue structures were observed under a microscope (Olympus, Japan) and analysed using Mankin scores (cartilage structure [0 ~ 6], chondrocytes [0 ~ 3], HE staining intensity [0 ~ 4], and junctional integrity [0 ~ 1]) [22].

Immunofluorescence staining

Paraffin sections were subjected to antigen retrieval and blocked with 5% BSA for 1 h. The primary antibodies CD31 (1:1000, proteintech, 28083-1-AP), EMCN (1:200, proteintech, 67854-1-AP) were then used overnight at 4 °C. The slides were then incubated with fluorescein-conjugated affinipure goat anti-rabbit IgG (H + L) (1:500, proteintech, SA00003-2) and Cy3-conjugated affinipure goat anti-mouse IgG (H + L) (1:500, proteintech, SA00009-1) for 50 min. And the nuclei were stained with DAPI staining solution (Beijing Boaosen Biotechnology Co., Ltd, C02-04002). Finally, the slides were examined under a confocal fluorescence microscope (Olympus, Japan). In addition, the area of blood vessels was measured using Image-Pro Plus 6.0, which is based on colour recognition.

Quantitative Real-time PCR (qPCR)

Total RNA was extracted from mouse right knee tibial plateau bone tissue using FreeZol reagent (Vazyme, R711) according to the reagent manual, and RNA concentration and purity were determined by spectrophotometer. RNA was then reverse transcribed into cDNA using the PrimeScript™ Fast RT reagent kit with gDNA Eraser (TaKaRa, RR092A). PCR amplification was performed using StepOnePlus Real-Time PCR System and the TB Green® Premix Ex Taq™ II kit (TaKaRa, RR820A). After amplification, β-actin was used as an internal reference. The corresponding primers were synthesised by Tsingke Biotechnology Co., Ltd (Hif-1α-Forward ACCTTCATCGGAAACTCCAAAG; Hif-1α-Reverse CTGTTAGGCTGGGAAAAGTTAGG; VEGFA-Forward GCACATAGAGAGAATGAGCTTCC; VEGFA-Reverse CTCCGCTCTGAACAAGGCT; β-actin-Forward CATTGCTGACAGGATGCAGAAGG; β-actin-Reverse TGCTGGAAGGTGGACAGTGAGG). The 2−ΔΔCt method was used to calculate the mRNA expression of each gene.

Western blotting

Bone tissue from the tibial plateau of the right knee joint of mice was placed in a grinding tube containing grinding beads and RIPA lysis solution and placed in a frozen tissue grinder for grinding. After centrifugation, the supernatant was collected and the total protein concentration was determined by the BCA method. The target protein was separated from the sample by polyacrylamide gel electrophoresis (30 µg/well of protein on 10% SDS-PAGE). Proteins were transferred to polyvinylidene fluoride (PVDF) membranes (Merck Millipore, ISEQ00010) and blocked with 5% skimmed milk. Antibodies used in the experiments were anti-Hif-1α (1:1000, Abcam, ab179483), anti-VEGFa (1:1000, Abcam, ab46154), anti-CD31 (1:500, ABclonal, A3181), anti-EMCN (1:1000, Proteintech, 67854-1-Ig), anti-GAPDH (1: 10000, ABclonal, AC033), anti-HSP90 (1:5000, Proteintech, 60318-1-Ig) and the corresponding secondary antibodies (1:5000, CWBIO, CW0103S and CW0102S) and washed with tris buffered saline Tween (TBST) solution. The PVDF bands were visualised, developed and photographed using the Tanon Luminescence Imaging System (Tanon 5200). The bands were analysed for grey values using Image J software, and relative protein expression was expressed as target protein grey value/inner reference protein grey value.

Statistical analysis

Microsoft Excel (Version 2504) was used to organise the data. GraphPad Prism 9.5.0 (GraphPad Software, LLC) was used for statistics and image generation. Data were expressed as mean ± standard deviation. Comparisons between the three groups were made by one-way ANOVA, and further comparison of means between groups was made by Dunnett’s multiple comparison test. Correlation was analyzed using Pearson’s correlation coefficient. A p-value less than 0.05 was defined as statistically significant.

Results

Changes in body weight and joint swelling

During the papain injection for modelling, the mice in the modelling and exercise groups showed significant weight loss, lameness and knee swelling, indicating successful modelling. Subsequently, body weight gradually recovered and knee swelling gradually improved (Fig. 1). There was a significant difference in body weight between all three groups during the experiment (P < 0.001). Further comparison between the two groups revealed that there was no significant difference in body weight loss between mice in the model and exercise groups before the exercise intervention (P > 0.05), and on day 21 of the swimming exercise intervention (day 28 of the experiment), the body weight gain of mice in the exercise group was significantly higher than that of the model group (P < 0.05) (Fig. 1B). There was a significant difference in the rate of swelling between all three groups by day 28 of the experiment (P < 0.01). Further comparison between the two groups revealed that there was no significant difference in knee swelling between the model and exercise groups of mice before the exercise intervention (P > 0.05), and the swelling began to improve significantly on the 6th day of swimming exercise (13th day of the experiment) (P < 0.05). After the 28th day of the experiment, there was no significant difference in knee swelling between all three groups of mice (P > 0.05) (Fig. 2C).

Fig. 1.

Fig. 1

Open in a new tab

Effects of swimming exercise on body weight and knee swelling, n = 15. A Flow diagram of the experiment. B Changes in body weight of mice during modelling and exercise training. C Changes in knee swelling rate of mice during modelling and exercise training. Normal control and exercise groups, respectively, compared with the modelling group.▲P < 0.001, ■P < 0.01, ●P < 0.05

Fig. 2.

Fig. 2

Open in a new tab

Behavioural effects of swimming exercise, n = 6. A Balance beam test, time for mice to pass a 1 m balance beam. B Balance beam test, number of times that mice appeared to slip while passing through the beam. C Rotarod test, time from start of rotation of the drum until mice were dropped. D Open field test, total distance of spontaneous activity of the mice. E Open field test, average speed of movement of the mice. F Open field test, time the mice stayed still. G Trajectory and heat maps of three groups of mice in open boxes. H Correlation of the rotarod test with the total distance of the open field test. I Correlation of the balance beam test with the total distance of the open field test. J Correlation of rotarod test with open field test immobility time. K Correlation of balance beam test with open field immobility time

Changes in motor function

After 4 weeks of swimming exercise, we performed a series of exercise-related behavioural tests on the mice. Overall, the three groups of mice differed in the balance beam test (P < 0.001, P < 0.001), rotarod test (P < 0.001) and open field test (P < 0.001, P < 0.001 and P < 0.001) (Fig. 2). Swimming exercise showed beneficial effects on various behavioural tests in mice, as evidenced by the fact that mice in the exercise group slipped less (P < 0.001) and took less time (P < 0.001) to cross the balance beam than mice in the model group (Fig. 2A, B), suggesting improvements in motor coordination and balance. Motor coordination and endurance were assessed between the different groups of mice using the rotarod test and it was found that the mice in the exercise group remained on the rotating drum for a significantly longer time than the mice in the model group (P < 0.001) (Fig. 2C). Similarly, in the open field test, mice in the exercise group spent less time immobilised (P < 0.001), travelled a greater total distance in spontaneous activity (P < 0.001) and had a greater average speed (P < 0.001) compared to mice in the model group (Fig. 2D-G). We further performed correlation analysis between each behavioural test and found that there was a strong correlation between the rotarod test and the total distance of the open field test (p < 0.001), and a strong correlation between the balance beam test and the total distance of the open field test (p < 0.001). Similarly, there was a correlation between the rotarod test and the immobility time of the open field test (p < 0.001), and a correlation between the balance beam test and the immobility time of the open field test (p < 0.001) (Figs. 2H-K).

Changes in bone histological morphology

We assessed articular cartilage damage in three groups of mice by HE staining of pathological sections of mouse knee joints (Fig. 3). In the normal control group, the cartilage surface was smooth and the thickness was normal. The cartilage showed a more regular layered structure from the superficial to the deep layers with intact tide lines. The color of matrix staining was normal (Mankin score 0.33 ± 0.58). In the model group, the articular cartilage was severely damaged, the surface of the articular cartilage was rough and had large defects, and the thickness of the cartilage was obviously thinned. The layered structure of the cartilage was damaged, with a large number of flat cells missing from the superficial layer. The distribution of the remaining cells was disorganised, and cell degeneration and necrosis were common. The matrix around the cells was pale. The tide line is incomplete (Mankin score 7.67 ± 1.53). The articular cartilage surface of the mice in the exercise group was slightly rough with a few small defects. The layered structure of the cartilage was still clear, but the cells in the superficial layer were slightly reduced and arranged in a slightly disorganised manner. Matrix staining was basically uniform, but there were localised areas of light staining. The morphology of the deep chondrocytes was basically normal, with occasional cellular degeneration and no obvious abnormality in matrix staining. Tide lines are discontinuous and appear blurred or repetitive (Mankin score 4.33 ± 0.58) (Fig. 3A, B). There was a significant difference in Mankin scores between the three groups (P < 0.001). The Mankin scores of the model group were significantly up-regulated compared to those of the normal control group (P < 0.001), suggesting that the model group successfully modelled the destruction of bone tissue. After 4 weeks of swimming exercise intervention, there was a significant decrease in Mankin score in the exercise group compared to the model group (P < 0.05), suggesting that swimming exercise reduced KOA cartilage damage (Fig. 3C).

Fig. 3.

Fig. 3

Open in a new tab

Effect of swimming exercise on bone histomorphology of mouse knee joints, n = 3. A HE staining of mouse knee joint sections, scale bar: 100 μm. B Rectangular area in Fig. 3A, scale bar: 50 μm. C Mankin scores of knee joints from three groups of mice

Changes in the expression of H-type vessels

To determine the expression of H-type vessels (CD31hi, Emcnhi) in the subchondral bone of the mouse knee joint, samples of the tibial plateau were taken from each group of mice and subjected to Western blotting and immunofluorescence using antibodies against CD31 and Emcn (Fig. 4). There were significant differences in CD31 and Emcn protein expression in the bone tissues of mice in the three groups (p < 0.01; p < 0.01). In the model group, the protein expression levels of CD31 and Emcn were significantly increased (p < 0.01; p < 0.01) compared with those in the normal control group, and after 4 weeks of swimming exercise, the exercise group showed a significant increase in the protein expression levels of CD31 and Emcn compared with the model group (p < 0.05; p < 0.05) (Fig. 4A-C). The volume of H-type vessels in the tibial metaphysis was normalised to the volume of CD31 and/or Emcn-positive signals (total vasculature), termed HV/TV, according to the protocol of a previous study [23]. The percentage of HV/TV in normal control mice was 1.59 ± 0.29%, in the model group 10.09 ± 0.69% and in the exercise group 5.12 ± 0.71%. By one-way ANOVA, the differences between these groups were significant (P < 0.001), and in the model group, the HV/TV percentage was significantly increased (P < 0.001) compared to the normal control group, and after 4 weeks of swimming exercise, the exercise group showed a significant decrease in HV/TV percentage (P < 0.0001) compared to the model group (Fig. 4D, E).

Fig. 4.

Fig. 4

Open in a new tab

Effect of swimming exercise on the expression of H-type vessels in the subchondral bone of the knee joint in mice, n = 3. A Western blot of CD31, EMCN. B Protein expression level of CD31. C Protein expression level of EMCN. D Immunofluorescence staining of subchondral bone of mouse knee joints, scale bar: 100 μm. E Quantification of the percentage of H-type vessels in mouse knee joints (HV/TV%)

examined the expression levels of relevant factors in the Hif-1α/VEGFa

We examined the expression levels of relevant factors in the Hif-1α/VEGFa pathway in the tibial plateau of the mouse knee to investigate the mechanisms of exercise on KOA cartilage injury and H-type vessel formation. In the model group, the protein expression levels of Hif-1α and VEGFa were significantly increased (P < 0.001; P < 0.01) compared to the normal group, and after 4 weeks of swimming exercise, the exercise group showed a significant increase in the protein expression levels of Hif-1α and VEGFa (P < 0.001; P < 0.01) compared to the model group (Fig. 5A-C). Similarly, the model group showed a significant increase in the mRNA expression levels of Hif-1α and VEGFa compared to the normal group (P < 0.001; P < 0.01), whereas the mRNA expression levels of Hif-1α and VEGFa in the exercise group were significantly decreased compared to the model group (P < 0.01; P < 0.05) (Fig. 5D, E). These results suggest that the Hif-1α/VEGFa pathway is activated in KOA mice and that swimming exercise inhibits the Hif-1α/VEGFa pathway in the bones of KOA mice.

Fig. 5.

Fig. 5

Open in a new tab

Protein and mRNA expression levels in the Hif-1α/VEGFa signalling pathway, n = 3. A Western blotting of Hif-1α, VEGFa. B Protein expression level of Hif-1α. C Protein expression level of VEGFa. D Hif-1α mRNA expression level. E VEGFa mRNA expression level

Discussion

Functional disability due to knee osteoarthritis (KOA) has become a major problem for healthcare systems worldwide, and the 2019 American College of Rheumatology emphasises prevention and symptom relief through increased exercise [4, 24]. Previous studies have shown that aquatic exercise improves symptoms of pain and stiffness, increases muscle strength, and improves physical function in patients with KOA [25, 26]. Similarly, our results showed that mice in the swimming group regained weight faster, had faster reduction of knee swelling, and performed better in behavioural tests related to exercise capacity. We chose a variety of behavioural tests, such as the balance beam test, the rotarod test and the open field test, in the hope of evaluating the mice’s exercise and mobility from more perspectives. Swimming exercise was shown to benefit various aspects of speed, coordination and balance, as well as aerobic endurance in mice. Correlation analyses of the balance beam test, rotarod test and open field test showed that the mice’s good performance in the rotarod and balance beam tests correlated with their spontaneous activity level in the open field test. These results suggest that swimming exercise effectively alleviates the symptoms of KOA and enhances an individual’s willingness to move autonomously. Under the condition of increased voluntary mobility, appropriate exercise can further improve movement-related abilities and reduce joint dysfunction.

Articular cartilage degeneration is a typical pathological manifestation of osteoarthritis of the knee [27]. Histological staining of articular cartilage helps to assess the extent of cartilage damage. The HE staining results in this study showed that the articular cartilage surface was smoother, with more chondrocytes and lower Mankin scores in the exercise group compared with the experimental group, suggesting that swimming exercise could partially alleviate cartilage degeneration of the knee joint in mice. The pathogenesis of KOA is complex and involves a variety of pathological processes such as cartilage degeneration, bone remodelling, synovial inflammation and angiogenic abnormalities [28]. However, previous studies have focused more on cartilage degeneration in KOA, and the role of exercise such as swimming in KOA angiogenesis has been less studied. The onset and progression of osteoarthritis is often accompanied by significant vascular proliferation and growth in [15, 28, 29]. CD31 is an endothelial cell marker that is mainly used to demonstrate the presence of endothelial cell tissue and to assess angiogenesis [30, 31]. H-type vessels are a specific vascular subtype found predominantly in the metaphysis of bone [13]. The formation of H-type vessels in subchondral bone has been shown to be closely associated with bone mineral formation, joint pain and cartilage degeneration in the KOA mouse model [32]. Increased expression of CD31 protein and EMCN protein in the tibial plateau of the knee joint of KOA model mice in this study indicated vascular proliferation in the cartilage and subchondral bone region of KOA. Swimming for 4 weeks reduced this phenomenon, which in turn reduced the symptoms of swelling and pain exacerbated by vascular proliferation and cartilage destruction. We also co-labelled as H-type vessels by CD31 and EMCN immunofluorescence and counted the percentage of H-type vessels in the subchondral bone to the total vessels. The results showed that the expression of H-type vessels was higher in KOA model mice, while swimming exercise had the same inhibitory effect on the expression of H-type vessels in subchondral bone.

Previous studies have confirmed that Hif-1α plays an important role in the development of osteoarthritis. Chu et al. found that serum and synovial Hif-1α levels in KOA patients correlated positively with the imaging severity of OA [33]. However, the mechanism of action of Hif-1α in the KOA model is unclear and the results are contradictory. Hu et al. found that Hif-1α mediated mitochondrial autophagy to alleviate OA [34]. Whereas GUAN et al. found that the gut microbiota metabolite capsaicin inhibits Hif-1α expression and reduces the progression of iron-death-associated osteoarthritis through activation of SLC2A1 [35]. In addition, Hif-1α also activates the transcription of the downstream vascular endothelial growth factor (VEGFa), which in turn induces angiogenesis [36]. Therefore, in this study, we examined tibial plateau samples from knee joints and used qPCR and Western blotting to detect the mRNA and protein expression levels of the Hif-1α/VEGFa signalling pathway in the bones of KOA mice, to investigate the effect of the Hif-1α/VEGFa signalling pathway on H-type angiogenesis in subchondral bone. The results showed that the expression of Hif-1α/VEGFa pathway-related factors was upregulated in the model group, promoting angiogenesis and H-type vessel differentiation. In contrast, swimming exercise negatively regulated the expression of the Hif-1α/VEGFa pathway in the tibial plateau, consistent with the reduction of H-type vessels.

In conclusion, we show that swimming exercise has an effect on KOA swelling and mobility improvement by inhibiting the Hif-1α/VEGFa pathway, which in turn inhibits H-type vessels and ultimately improves joint function. This mechanism not only highlights the importance of exercise in the treatment of KOA, but also provides a new theoretical basis for non-pharmacological interventions.

Our study also has some limitations. First, the 4% papain injection method was used to construct a mouse model of KOA in this study, which can simulate articular cartilage injury but cannot fully cover the complex and diverse etiology of human KOA. Future studies may explore other modeling methods to more closely characterize the human disease. Second, in this study, the swimming intervention lasted only 4 weeks, and future studies are needed to optimize the swimming protocol, extend the observation period, and compare the efficacy with other exercises through animal experiments and clinical trials. In addition, we were limited by experimental resources and the sample size of each group was small, which may reduce statistical validity. Follow-up studies will reasonably expand the sample size to improve data reliability.

Conclusion

KOA mice have degenerated articular cartilage and impaired joint function. Swimming exercise downregulated the Hif-1α/VEGFa signalling pathway in the tibial plateau bone of KOA mice, reduces H-type vessels in the subchondral bone and improved cartilage morphology.

Supplementary Information

Supplementary Material 1. (1.3MB, docx)

Acknowledgements

We thank Prof. Wenbin Bao of the College of Animal Science and Technology, Yangzhou University for technical assistance. We also thank all the personnel involved in the experiments for their efforts.

Clinical trial number

Not applicable.

Abbreviations

KOA

Knee osteoarthritis

CD31

Platelet endothelial cell adhesion molecule 1

Emcn

Endothelial mucin

Hif-1α

Hypoxia-inducible factor 1α

Hif-1β

Hypoxia-inducible factor 1β

Hif-1

Hypoxia-inducible factor 1

HREs

Hypoxia-responsive elements

VEGFa

Vascular endothelial growth factor a

EDTA

Ethylenediamine tetraacetic acid

PVDF

Polyvinylidene fluoride

TBST

Tris buffered saline Tween

Authors’ contributions

Z.M. and B.C. were responsible for topic selection and experimental design; L.H. was responsible for writing the paper; L.H. and W.D. were responsible for completing the experiments; X.J. was responsible for analyzing and organizing the experimental data. All authors reviewed the manuscript.

Funding

The authors disclose receipt of the following financial or material support for the research, authorship, and/or publication of this article: Yangzhou Basic Research Program (Joint Special Project) (NO.2024-2-16), Major Sports Science Research Project of Jiangsu Provincial Sports Bureau (NO.ST231207), and General project of Jiangsu Provincial Health Commission (NO. H2023006).

Data availability

The data and materials supporting this study are available to other researchers from the corresponding author upon reasonable request.

Declarations

Ethics approval and consent to participate

The experimental procedures involving animals were ethically approved by the the Animal Ethics Committee of Yangzhou University (No.202303840).

Consent for publication

Not Applicable.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Bo Chen, Email: 346927706@qq.com.

Zhaoxiang Meng, Email: yzmzx001@163.com.

References

  1. Zhu S, Qu W, He C. Evaluation and management of knee osteoarthritis. J Evid Based Med. 2024;17(3):675–87. [DOI] [PubMed] [Google Scholar]
  2. Giorgino R, Albano D, Fusco S, Peretti GM, Mangiavini L, Messina C. Knee osteoarthritis: epidemiology, pathogenesis, and mesenchymal stem cells: what else is new? An update. Int J Mol Sci. 2023;24(7):6405. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Sun X, Zhen X, Hu X, Li Y, Gu S, Gu Y, et al. Osteoarthritis in the middle-aged and elderly in China: prevalence and influencing factors. Int J Environ Res Public Health. 2019;16(23):4701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Kolasinski SL, Neogi T, Hochberg MC, Oatis C, Guyatt G, Block J, et al. 2019 American College of Rheumatology/Arthritis Foundation Guideline for the Management of Osteoarthritis of the Hand, Hip, and Knee. Arthritis Care Res (Hoboken). 2020;72(2):149–62. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Hall M, van der Esch M, Hinman RS, Peat G, de Zwart A, Quicke JG, et al. How does hip osteoarthritis differ from knee osteoarthritis? Osteoarthr Cartilage. 2022;30(1):32–41. [DOI] [PubMed] [Google Scholar]
  6. Bartels EM, Juhl CB, Christensen R, Hagen KB, Danneskiold-Samsoe B, Dagfinrud H, et al. Aquatic exercise for the treatment of knee and hip osteoarthritis. Cochrane Database Syst Rev. 2016;3(3):CD005523. [DOI] [PubMed] [Google Scholar]
  7. Lo GH, Ikpeama UE, Driban JB, Kriska AM, McAlindon TE, Petersen NJ, et al. Evidence that swimming may be protective of knee osteoarthritis: data from the osteoarthritis initiative. PM R. 2020;12(6):529–37. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Becker BE. Aquatic therapy: scientific foundations and clinical rehabilitation applications. PM R. 2009;1(9):859–72. [DOI] [PubMed] [Google Scholar]
  9. Hall J, Swinkels A, Briddon J, McCabe CS. Does aquatic exercise relieve pain in adults with neurologic or musculoskeletal disease? A systematic review and meta-analysis of randomized controlled trials. Arch Phys Med Rehabil. 2008;89(5):873–83. [DOI] [PubMed] [Google Scholar]
  10. Walsh DA, Bonnet CS, Turner EL, Wilson D, Situ M, McWilliams DF. Angiogenesis in the synovium and at the osteochondral junction in osteoarthritis. Osteoarthritis Cartilage. 2007;15(7):743–51. [DOI] [PubMed] [Google Scholar]
  11. Walsh DA, McWilliams DF, Turley MJ, Dixon MR, Franses RE, Mapp PI, et al. Angiogenesis and nerve growth factor at the osteochondral junction in rheumatoid arthritis and osteoarthritis. Rheumatology (Oxford). 2010;49(10):1852–61. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Mapp PI, Walsh DA. Mechanisms and targets of angiogenesis and nerve growth in osteoarthritis. Nat Rev Rheumatol. 2012;8(7):390–8. [DOI] [PubMed] [Google Scholar]
  13. Kusumbe AP, Ramasamy SK, Adams RH. Coupling of angiogenesis and osteogenesis by a specific vessel subtype in bone. Nature. 2014;507(7492):323–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Hu W, Chen Y, Dou C, Dong S. Microenvironment in subchondral bone: predominant regulator for the treatment of osteoarthritis. Ann Rheum Dis. 2021;80(4):413–22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Liu Y, Xie HQ, Shen B. Type H vessels-a bridge connecting subchondral bone remodelling and articular cartilage degeneration in osteoarthritis development. Rheumatology (Oxford). 2023;62(4):1436–44. [DOI] [PubMed] [Google Scholar]
  16. Pfander D, Cramer T, Swoboda B. Hypoxia and HIF-1alpha in osteoarthritis. Int Orthop. 2005;29(1):6–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Tao J, Miao R, Liu G, Qiu X, Yang B, Tan X, et al. Spatiotemporal correlation between HIF-1alpha and bone regeneration. FASEB J. 2022;36(10):e22520. [DOI] [PubMed] [Google Scholar]
  18. Wiszniak S, Schwarz Q. Exploring the intracrine functions of VEGF-A. Biomolecules. 2021;11(1):128. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Liu C, Du W, Zhang L, Wang J. Natural synergy: Oleanolic acid-curcumin co-assembled nanoparticles combat osteoarthritis. Colloids Surf B Biointerfaces. 2025;245:114286. [DOI] [PubMed] [Google Scholar]
  20. Chen X, Yang K, Sun P, Zhao R, Liu B, Lu P. Exercise improves bone formation by upregulating the Wnt3a/beta-catenin signalling pathway in type 2 diabetic mice. Diabetol Metab Syndr. 2021;13(1):116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Qian J, Zhao P, Xu Q, Yang W, Cai R. Swimming prevents cell death of chondrocytes via PI3K/AKT pathway in an experimental model. J Orthop Surg Res. 2023;18(1):439. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. van der Sluijs JA, Geesink RG, van der Linden AJ, Bulstra SK, Kuyer R, Drukker J. The reliability of the Mankin score for osteoarthritis. J Orthop Res. 1992;10(1):58–61. [DOI] [PubMed] [Google Scholar]
  23. Wang L, Zhou F, Zhang P, Wang H, Qu Z, Jia P, et al. Human type H vessels are a sensitive biomarker of bone mass. Cell Death Dis. 2017;8(5):e2760. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Li Y, Xie W, Xiao W, Dou D. Progress in osteoarthritis research by the National Natural Science Foundation of China. Bone Res. 2022;10(1):41. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Xu Z, Wang Y, Zhang Y, Lu Y, Wen Y. Efficacy and safety of aquatic exercise in knee osteoarthritis: a systematic review and meta-analysis of randomized controlled trials. Clin Rehabil. 2023;37(3):330–47. [DOI] [PubMed] [Google Scholar]
  26. Alkatan M, Baker JR, Machin DR, Park W, Akkari AS, Pasha EP, et al. Improved function and reduced pain after swimming and cycling training in patients with osteoarthritis. J Rheumatol. 2016;43(3):666–72. [DOI] [PubMed] [Google Scholar]
  27. Chen D, Shen J, Zhao W, Wang T, Han L, Hamilton JL, et al. Osteoarthritis: toward a comprehensive understanding of pathological mechanism. Bone Res. 2017;5:16044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Lv Z, Yang YX, Li J, Fei Y, Guo H, Sun Z, et al. Molecular classification of knee osteoarthritis. Front Cell Dev Biol. 2021;9:725568. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Xu M, Tu J, Yang Y, Zou W. Study on the relationship between the expression of S100A12, CaSR, and IL-7R in the synovium of knee osteoarthritis and angiogenesis. Ann Palliat Med. 2021;10(12):12775–81. [DOI] [PubMed] [Google Scholar]
  30. Liu L, Shi GP. CD31: beyond a marker for endothelial cells. Cardiovasc Res. 2012;94(1):3–5. [DOI] [PubMed] [Google Scholar]
  31. Tenyi A, Milutinovic A, Nemeth L. Expression of CD31, CD34, and smooth muscle actin (SMA) in endothelial cells of dental pulp vessels. Biomol Biomed. 2023;24(4):821–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Wang R, Xu B. TGFbeta1-modified MSC-derived exosome attenuates osteoarthritis by inhibiting PDGF-BB secretion and H-type vessel activity in the subchondral bone. Acta Histochem. 2022;124(7):151933. [DOI] [PubMed] [Google Scholar]
  33. Chu H, Xu ZM, Yu H, Zhu KJ, Huang H. Association between hypoxia-inducible factor-1a levels in serum and synovial fluid with the radiographic severity of knee osteoarthritis. Genet Mol Res. 2014;13(4):10529–36. [DOI] [PubMed] [Google Scholar]
  34. Hu S, Zhang C, Ni L, Huang C, Chen D, Shi K, et al. Stabilization of HIF-1alpha alleviates osteoarthritis via enhancing mitophagy. Cell Death Dis. 2020;11(6):481. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Guan Z, Jin X, Guan Z, Liu S, Tao K, Luo L. The gut microbiota metabolite capsiate regulate SLC2A1 expression by targeting HIF-1alpha to inhibit knee osteoarthritis-induced ferroptosis. Aging Cell. 2023;22(6):e13807. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Fang T, Lin L, Ye ZJ, Fang L, Shi S, Yu KD, et al. Dexmedetomidine promotes angiogenesis and vasculogenic mimicry in human hepatocellular carcinoma through alpha (2)-AR/HIF-1alpha/VEGFA pathway. Biomed Environ Sci. 2022;35(10):931–42. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 1. (1.3MB, docx)

Data Availability Statement

The data and materials supporting this study are available to other researchers from the corresponding author upon reasonable request.

Articles from BMC Musculoskeletal Disorders are provided here courtesy of BMC

RESOURCES