Lack of Glutamate Synthase in Streptococcus zooepidemicus makes a Natural Driving Force for Increasing Hyaluronic Acid Production

Abstract

Hyaluronic acid (HA) has many applications in the pharmaceutical and cosmetic industries. Streptococcus zooepidemicus is naturally producing HA with high yield. There have been many attempts to produce HA in GRS strains but none have been able to produce HA as much as S. zooepidemicus. This study was undertaken to prove the dependence of S. zooepidemicus life on Glutamate produced by Glutamine fructose 6-phosphate transaminase (GFAT) related to the HA pathway. The presence of Glutamate synthase (GOGAT) in S. zooepidemicus was investigated by in-silico, genome annotation, and enzymatic assay methods, respectively. Recombinant expression of GOGAT was investigated. The deletion of GFAT was done by the homologous recombination method. Recombinant expression of GOGAT and deletion of GFAT were performed simultaneously. In these last three steps, growth rate and HA production were determined. Not only the absence of GOGAT but also the presence of GFAT as the only enzyme-producing glutamate was observed. Recombinant expression of GOGAT led to alack of HA production along with any change in the bacterial growth rate. A lack of bacterial growth in the glutamate-free medium was observed. Also, no HA production was seen in the glutamate-supplemented medium. The almost natural growth rate of bacteria, as well as no HA production, was shown. Overall, the S.zooepidemicus genome lacks GOGAT leading to a natural driving force to increase HA production. Knocking out of GOGAT in recombinant HA-producing strains like those coli and B. subtilis aimed to increase HA production would be welcomed.

Introduction

Hyaluronic acid (HA) is a polysaccharide made by the repetition of N-acetyl glucosamine and glucuronic acid. It has many applications in the pharmaceutical and cosmetic industries due to its high potential in water retention [1, 2], high biocompatibility [3], non-immunogenicity and non-toxicity [4] and high hygroscopicity [5].In the past, HA was extracted from animal sources such as rooster comb, pig vitreous, but because of the low yield production, the transmission of viral diseases, and microbial sources have now replaced them.

There are a few types of microorganisms naturally producing HA, among them; S. zooepidemicus has taken great attention since it is the most producer of HA. Despite all the benefits of using S. zooepidemicus for high production of HA, it has several disadvantages including pathogenicity, molecular weight polydispersity, expensive culture, and the difficulty of genetic manipulation [6].

According to the above descriptions, by using metabolic engineering, it has been tried for recombinant expression of HA in other strains such as Lactococcus lactis, Escherichia coli, and Bacillus subtilis [7–9]. All of these are GRS and have low polydispersity and can be easily genetically modified, but their biggest drawback is the low level of HA production.

Although the pathways leading to HA production have been established in the genome of recombinant HA producing strains, they produce much less than S. zooepidemicus. This indicates the presence of differences in other metabolic pathways available in S. zooepidemicus, which results in high production of HA. Therefore, finding the possible reason for the high production of HA by S. zooepidemicus could propose an efficient approach for increased HA production in the recombinant strains.

One of the metabolic engineering strategies to increase the production of a metabolite is to make life dependent on the pathway producing the concerned metabolite [10, 11]. In this way, the strain is forced to produce a large amount of metabolite by boosting its metabolic pathways, so that it could survive. For this purpose, life is coupled with one of the vital metabolites produced in the desired pathway. HA is produced in the complex metabolic pathway, in which many metabolites are produced, and the glutamate produced by Glutamine fructose 6-phosphate transaminase (GFPT) is the only vital metabolite produced in this pathway, in natural selection, the life of bacterium may be coupled to the production of glutamate in the HA pathway.

The present study aimed to demonstrate the dependence of S. zooepidemicus life on glutamate produced by GFAT associated with the HA pathway. So, its molecular and genetic bases could be the main approach for increased production of HA in engineered bacterial (GRS) strains.

Materials and Methods

This study has been approved by the research committee at Guilan University of Medical Sciences, Rasht, Iran (No IR.GUMS.REC.1396.5).

Exploring of the Glutamate Synthase (GOGAT) in S. zooepidemicus

Bioinformatics Method

To investigate the presence of GOGAT in S. zooepidemicus (IBRC-M 10919), we compared the sequence of GOGAT from other bacteria such as Escherichia coli, Lactococcus lactis, Bacillus subtilis, Streptococcus pneumonia, Streptococcus lutetiensis, and Streptococcus feruswithS. zooepidemicus genome. We used tBLAn (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=tblastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome) to counteract the effect of codon preference.

Genome Annotation

To further in-silicoinvestigation of S. zooepidemicus GOGAT, we used genome annotation information obtained from https://www.theseed.org/,and the presence of GOGAT and other enzymes producing glutamate was checked out.

Enzymatic Assay of GOGAT

One ml of S. zooepidemicus medium was subjected to centrifugation at 5000 g for 5 min at 4 °C. Next, the pellet was resuspended in 2 ml PBS (pH 7). The cell lysate was prepared by ultra-sonication for 15 min on ice. The GOGAT assay was performed by the method of Krog et al. with GOGAT of E.coli as a positive control [12]. Briefly, enzyme-substrate was prepared as follow: 20 mM L-glutamine, 20 mM 2-oxoglutarate, 5 mM MgSO4, 0.25 mM NADPH, 100 mM glycine- KOH. The mixture of assay material was warmed to 45 °C, then, 100 µl of cell lysate was added to the mixture and the consumption of NADPH was measured at 340 nm for 4 min. One unit of GOGAT is the amount of enzyme that consumes 1 µM NADPH per minute. The enzyme activity was expressed as µM/min/mg.

DNA Manipulation, Bacterial Growth Condition

Genome and Plasmid extraction, digestion with the restriction enzyme, DNA ligation, and transformation and electrophoresis were performed by standard procedures. Restriction enzymes and pfu were purchased from Thermo Scientific. Other chemicals were obtained from Sigma. S. zooepidemicus (IBRC-M 10919) was used as a native strain for DNA manipulation;lactococcus lactis and E. coliDH5a were used as intermediate hosts for plasmids. E. coli DH5a was grown in LB medium by 100 µg/ml ampicillin or 5 µg/ml kanamycin, and lactococcus lactis and S. zooepidemicus were cultured in TSB medium by 5 µg/ml chloramphenicol. All The PCR program consisted of 1 cycle at 95 °Cfor 5 min, followed by 30 cycles at 95 °C (30 s), 60 °C (30 s), and 68 °C (1 min) and one final extension cycle at 72 °C (5 min).The PCR products were confirmed on a 1% agarose gel.

Recombinant Expression of GOGAT in S. zooepidemicus

E. coli genome was extracted using Gene-all (Korea) kit and its GOGATgene was amplified by its specific primers (Table 1).ExtractedpNZ8148 plasmid from Lactococcus lactis, and amplified E. coliGOGATwas double digested by NcoI and XbaI. After gel purification, these two fragments were ligated and then transformed into L. lactis, extracted pNZ8148-GOGATfrom L.lactis was electroporated to S. zooepidemicus. The expression ofrecombinantGOGAT was induced using different concentrations of Nisin(10, 20, 30, 40,50, and 60 ng/ml).DNA transformation to DH5a competent E. coli was done by using the heat shock method [13]. L. lactis as another (secondary) intermediate host was electroporated for maintaining pNZ8148 and its derivatives. Construction of recombinant GOGATin S. zooepidemicus was done by electroporation as described previously [14]. Briefly, competent S. zooepidemicus was made by overnight culturing in TSB medium. The medium was incubated in 100 ml TSB until reaching OD₅₃₀ = 0.6, hyaluronidase was added to the medium before incubation at 37 °C for 30 min. After centrifuging (5000 g, 4 °C, 10 min), the pellet was suspended in 250 µl of 0.5 M sucrose. Eppendorf Multiporator®R was set at 1.5 V for 5 ms for electroporation of 50 µl of the competent cells in a 0.1 cm cuvette. Immediately, pulls, 1 ml of TSB medium was added to the cell, after one hour, cells were cultured on TSB agar supplemented with kanamycin (5 mg/ml) and then incubated at 37 °C for 24 h.

Table 1.

Sequences of gene-specific primers

Name	Sequence(5' → 3')	Restriction site
GOGAT-F	TATACCATGGGCTTGTACGATAAATCCCTTGAGAGGGATAACTG	NcoI
GOGAT-R	TATATCTAGAAACTTCCAGCCAGTTCATAATACCGTCTGCCG	XbaI
L–F	ATATAAGCTT GATGATATGTTTGAGGTAGCAGAGCGTG	HindIII
L–R	ATATGTCGACACAACTTAACACCTCAGTAAGCTAGCTTACTACTTTCTTTAATG	SalI
Kan-F	ATATGTCGACTCAAGAAGATCCTTTGATC	SalI
Kan-R	ATATGGATCCCCCCTATTTGTTTATTTTTC	BamHI
R–F	ATATGGATCCTAGTTGCCTGCTTAAAATGAGGCAGCAGGG	BamHI
R–R	ATATGAATTCCGGACTAAGCTTCAGCACCTTTGCAGCC	EcoRI

GOGAT glutamate synthase

Deletion of GFAT

Construction of puc18-5′-kana^r-3′

1 kb flanking sequences of 5′ and 3′ ofGFAT were amplified from the S. zooepidemicus genome using L–F, L–R, R–F, and R–R primers, respectively (Table 1). 5′ and 3′ flanking sequences were double digested by HindIII, SalI, BamHI, EcoRI, respectively, and gel purified, the products were ligated to puc18-kana^r made before (Pourzardosht and Rasaee, 2017) to make final construction of puc18-5′-kana^r-3′. Electroporated S. zooepidemicus by puc18-5′-kana^r-3′ was selected on TSB medium supplemented with kanamycin and glutamate.

Analysis and Confirmation of Mutant Strain

To explore the replacement ofGFAT with kana^r, selected colonies on TSB-kana^r were tested by PCR usingGOGAT andKana^rprimers (Table 1). Also, cross PCR was used for gene replacement confirmation. The knockout strain was named S. zooepidemicus ΔGFAT.

Assay of HA Production

After 24 h of S. zooepidemicus growth in TSB medium, sodium dodecyl (SDS) 1% was added to a 10% volume of medium to remove the HA capsule. Then, it was subjected to centrifugation at 10,000 g for 10 min, the supernatant was mixed with 3 volumes of ethanol and the specimen was set at 4 °C for 24 h. Following centrifugation in the same condition (10,000 g, 10 min), the dried pellet was resolved in 0.15 M NaCl. 0.2 ml of the sample was mixed with 1 mL of sulfuric acid. The resulting mixture was placed at boiling temperature for 15 min. After cooling at room temperature, 40 µl of carbazole (0.125%) was added to the solution. The resulting mixture was heated in boiling water and after cooling, the HA content was measured by the carbazole method with D-glucuronic acid as standard.

Determination of Growth Rate of S. zooepidemicus

Determination of the growth rate of S. zooepidemicuswas carried out as previously described [15]. All types of S. zooepidemicusused in this study were pre-cultured in 10 mLTSB medium, and after an overnight, they were added to 200 mLTSB medium, and then were incubated for 24 h using the shaking incubator at 37 °C and 200 rpm. At the next stage, sampling from the culture medium was carried out, the growth rate was calculated using the following equation.

$$\mu =\frac{2.303(\text{logOD}2-\text{logOD}1)}{(\text{t}2-\text{t}1)}$$

Results

Confirmation of the Lack of GOGATin S. zooepidemicus

In-Silico Analysis

A comparison of the protein sequences of GOGAT from the different strains with the translated sequence of S. zooepidemicus genome indicated that there is no GOGAT in S. zooepidemicus. Genome annotation confirmed this finding and also indicated that GFATwas the only enzyme-producing Glutamate in this bacterium.

Enzymatic Assay of GOGAT

To further confirm the lack of GOGAT from the S. zooepidemicusgenome, the activity of this enzyme was assayed. The activity of this enzyme in E.coli was measured as a positive control.The result showed that there was not any activity of GOGAT in S. zooepidemicus (Table 2). This finding demonstrated the results of the in-silico experiment.

Table 2.

The activity of GOGAT of S. zooepidemicus and E. coli

strain	GOGAT activity (µmol/min/mg)
S. zooepidemicus	0
E. coli	± 0.02

Recombinant Expression of GOGAT in S. zooepidemicus

To evaluate the effect of recombinant GOGAT expression in S. zooepidemicus, the E. coli GOGAT was expressed in this bacterium under the control of Nisin inducer. By increasing Nisinconcentration, the production of HA was decreased while there was no significant difference in the growth rate of S.zooepidemicus(Fig. 1).

Fig. 1.

The effect of recombinant expression of Glutamate synthase (GOGAT)under the different indicated concentrations of Nisin inducer on growth rate (●) and hyaluronic acid (HA) production (■) in S. zooepidemicus

Knockout of GFAT

To investigate the effect of the GFAT gene (the only enzyme-producing Glutamate) in S.zooepidemicus on the growth rate and HA production, this gene was knocked out by homologous recombination and was approved by PCR (Fig. 2) S. zooepidemicusΔGFATonly grew in TSB medium enriched by glutamate, and no growth was seen in the Glutamate free medium. Also, this bacterium did not produce HA in the medium supplemented with glutamate.

Fig. 2.

PCR confirmation of S. zooepidemicusknockout mutant. Lane 1 primers GOGAT -F/ GOGAT -R, wild type; 2 primers kana-F/kana-R, wild type; 3 ladder mix; 4 primers kana-F/kana- R, recombinant strain; 5 primers GOGAT -F/ GOGAT–R, recombinant strain; 6 primer L-F/kana-R,recombinant strain; 7 primers kana-F/R-R, recombinant strain

Expression of GOGAT inS. zooepidemicus ΔGFAT

To evaluate the behavior of S. zooepidemicus ΔGFATin the presence of recombinant GOGAT, pNZ8148-GOGAT was transformed into this strain and the expression of GOGAT under different concentrations of the inducer (Nisin) took place, as presented in Fig. 3. Along with the increase in the inducer concentration, the bacterial growth rate was increased, but there was no HA production under each concentration of Nisin.

Fig. 3.

The effect of recombinant expression of Glutamate synthase (GOGAT) under the different indicated concentrations of Nisin inducer on growth rate (●) and hyaluronic acid (HA) production (■) in S. zooepidemicus ΔGFAT

Discussion

Considering the different applications of HA as a natural biopolymer and its high economic value, many studies have been directed towards its different aspects. One of the most important aspects is finding the appropriate source for its production with features such as non-pathogenicity, high efficiency, and low cost. Since s.zooepidemicus could naturally produce HA with a high level, it has been received great attention [11]. However, this bacterium is among pathogen bacteria, using HA as a virulence factor for running away from the host immune system [16]. Also, it produces HA with polydispersity in molecular weight [17, 18]. By using metabolic engineering, some GRS recombinant strains producing HA were developed [6, 8, 19, 20] (Table 3) [21].

Table 3.

Comparison of hyaluronic acid (HA) produced by native S.zooemidemicus and recombinant strains

Microorganism	Concentration (g/l)	References
Streptococcus zooepidemicus	~10	[21]
Escherichia coli	0.19	[7]
Lactococcus lactis	0.89	[19]
Bacillus subtilis	6.8	[20]
Pichia pastoris	1.7	[6]

In the present study, the absence of GOGAT in S. zooepidemicus was found as indicated by tBLASTn.For confirmation of this finding, two more works were performed; first, the enzymatic activity of GOGAT was measured and no activity of the enzyme was observed. Second, by using genome annotation from the seed database, not only the absence of GOGAT but also the presence of GFAT as the only enzyme-producing glutamate was determined. Taken together, for the first time, the absence of GOGAT in S.zooepidemicus was confirmed.

After proving the lack of GOGAT in S. zooepidemicus, in the next step, the effect of recombinant expression of this enzyme was investigated, so that E. coli GOGAT was expressed in S. zooepidemicus under control of Nisin promoter, the results indicated that with the increase in the inducer concentration, the production rate of HA was decreased. Because by increasing Nisin inducer, as expected, GOGAT expression, and consequently, the production rate of glutamate was increased.It has been indicated that glutamate has a negative feedback effect on GFAT [22]. On the other hand, GFAT activity results in the production of N-acetyl-D-glucosamine [23]; one of two constituents of HA, it can be concluded that an increase in Nisin concentration might lead to a decrease in HA production.

In this study, under different concentrations of Nisin, the growth rate of S.zooepidemicus was not remarkably different.

According to the results of the previous stages, the only enzyme-producing glutamate in S. zooepidemicuswasGFAT, to demonstrate this finding, the GFATgene was deleted by homologous recombination. Since the lack of growth in the glutamate-free medium and growth in the medium supplemented with glutamate under this condition, it was further confirmed that GFAT is the only enzyme-producing glutamate and importantly, this enzyme is critical for S.zooepidemicus.On the other hand, no HA production in the medium supplemented with glutamate was observed. Since one of the two constituents of HA (N-acetyl D-glucosamine) is produced in the pathway including this enzyme [24] it was evident that its deletion led to no production of HA.

Recombinant expression of GOGAT under control of Nisin inducer and deletion of GFAT simultaneously in S.zooepidemicus led to the growth of bacteria associated with Nisin concentration as well as no HA production. This finding indicated the production of glutamate and the dependence of bacteria′s life on the GFAT. The remarkable point in the latter finding was that even under the highest concentration of the inducer for GOGAT, the growth rate was lower than baseline (native condition of bacteria); demonstrating the high strength of GFATin the production of glutamate.

Knockout of GOGAT in recombinant strains producing HA like E. coli and B. subtilis aimed to increase HA production would be welcomed. Also, the study of the presence of natural-driving force in other strains producing high valuable metabolites with high yield should be considered.

In Shen et al. study [11] first, the genes of the last four enzymes of 1- butanol production pathway (not naturally present in E. coli) were artificially inserted into the bacterial genome which resulted in a limited titer of 1- butanol. Since the last enzyme in this pathway produces 1-butanol with an NAD⁺ molecule, then a driving force was created in which the bacterial life became dependent on NAD⁺production leading to a higher titer of this valuable product(about tenfold); thus, the three main NAD⁺producing enzymes (lactate dehydrogenase, succinate dehydrogenase, and alcohol dehydrogenase) were eliminated and then this recombinant bacterium was placed under anaerobic conditions to allow the glycolysis pathway to be the only ATP-producing pathway. Since the activity of Glyceraldehyde 3-phosphate dehydrogenase in the glycolysis pathway requires NAD⁺on the other hand, in this situation, the only enzyme-producing NAD⁺ was Aldehyde-alcohol dehydrogenase, this recombinant strain inevitably shifted the carbon flux toward this enzyme to increase NAD⁺ production and consequently 1-butanol (30 g/l). This study demonstrated the importance of creating an artificial driving force in the high-titer production of a product in a new host. But in the present study, the natural driving force led to the high production of HA.

Conclusion

Taken all together, it was found that the S.zooepidemicus genome lacks glutamate synthase and this condition has led to a natural driving force for this bacterium to increase HA production.

Declarations

Conflict of interest

The authors declare that they have no conflict of interest.