Skip to main content
Journal of Ovarian Research logoLink to Journal of Ovarian Research
. 2025 Jul 4;18:144. doi: 10.1186/s13048-025-01719-x

The effect of aqueous Stevia rebaudiana extract and clomiphene citrate on the expression of GDF9, PTEN, BMP15 genes, and antioxidant levels in a letrozole-induced polycystic ovary syndrome model in Wistar rats

Alireza Saedi 1, Mehdi Mahmoodi 1, Reza Hosseiniara 2, Mahboubeh Vatanparast 3, Amir Hossein Fatehi Marj 4, Javad Paran Nejad 5, Moein Moradi 6, Sadegh Zarei 3,6,✉
PMCID: PMC12232178  PMID: 40615883

Abstract

This study investigates the individual and combined effects of aqueous Stevia rebaudiana extract (SAE) and clomiphene citrate (Clom) on the expression of key ovarian regulatory genes -growth differentiation factor 9 (GDF9), phosphatase and tensin homolog (PTEN), and bone morphogenetic protein 15 (BMP15)- as well as on antioxidant enzyme activities in a letrozole-induced polycystic ovary syndrome (PCOS) model in adult female Wistar rats. The estrous cycles of 50 rats were monitored and randomly divided into five groups of 10 rats each. The control group received carboxymethyl cellulose, while the remaining groups were administered letrozole (1 mg/kg) for 21 days to induce PCOS. From day 22 onward, the treatment groups received SAE (400 mg/kg), Clom (100 mg/kg), or their combination for 28 days. Gene expression levels of GDF9, BMP15, and PTEN were analyzed using real-time PCR, and antioxidant levels were assessed using diagnostic kits. Data were analyzed using SPSS software (version 21) with one-way ANOVA followed by Tukey’s post hoc test. Treatments with SAE and Clom restored normal estrous cycles. Significant differences in gene expression were observed: PTEN levels were higher in the control group compared to SAE and combined groups, while GDF9 and BMP15 were elevated in the PCOS group compared to controls. SAE and Clom treatments also significantly increased superoxide dismutase (SOD) and glutathione peroxidase (GPx) activities in ovarian tissues. The combined SAE and Clom therapy demonstrate potential as an effective strategy to manage PCOS by regulating ovarian gene expression and oxidative stress.

Supplementary Information

The online version contains supplementary material available at 10.1186/s13048-025-01719-x.

Keywords: Polycystic ovary syndrome, Wistar rats, Gene expression, Antioxidants, Stevia rebaudiana, Clomiphene citrate

Introduction

Polycystic ovary syndrome (PCOS) is one of the most common endocrine and metabolic disorders affecting women of reproductive age, with a global prevalence ranging from 5 to 15%. It is clinically characterized by menstrual irregularities, hyperandrogenism, and polycystic ovarian morphology [1, 2]. Beyond reproductive symptoms, PCOS is strongly associated with metabolic disturbances such as insulin resistance, dyslipidemia, obesity, and increased risk of type 2 diabetes and cardiovascular disease [3, 4]. Despite its high prevalence and significant impact on quality of life, its etiology remains unclear, involving a complex interplay of genetic, hormonal, inflammatory, and environmental factors [5, 6].

Recent studies have explored the role of oxidative stress and inflammatory responses in PCOS pathophysiology, suggesting that these processes may impair ovarian function and exacerbate insulin resistance. Notably, emerging literature highlights the relevance of targeted antioxidant therapy in PCOS management [7]. Additionally, recent findings highlight the molecular and epigenetic changes associated with PCOS, emphasizing the need for gene-targeted interventions [8].

Growth differentiation factor 9 (GDF9) and bone morphogenetic protein 15 (BMP15) are oocyte-specific paracrine factors that are essential for folliculogenesis, granulosa cell proliferation, and oocyte maturation [9]. Abnormal expression of these genes contributes to follicular arrest and impaired ovarian development, core features of PCOS [10]. Likewise, phosphatase and tensin homolog (PTEN) is a critical regulator of follicle development and survival, functioning through the PI3K/AKT signaling pathway, and its dysregulation is associated with ovarian dysfunction and cyst formation [11].

Oxidative stress, resulting from an imbalance between reactive oxygen species (ROS) and antioxidant defense mechanisms, plays a critical role in the pathogenesis of PCOS. Elevated ROS levels impair oocyte quality, promote follicular atresia, and compromise ovarian function [12]. Among the antioxidant defense systems, superoxide dismutase (SOD) and glutathione peroxidase (GPx) serve as key enzymes that protect against oxidative damage by neutralizing free radicals and peroxides [13, 14].

Conventional pharmacological interventions, such as clomiphene citrate (Clom) and metformin, are widely used to restore ovulation and improve insulin sensitivity in PCOS patients [15–17]. Clomiphene citrate is a selective estrogen receptor modulator that stimulates the hypothalamic-pituitary-ovarian axis and induces ovulation. However, these treatments often have limited efficacy and side effects, which has prompted interest in natural alternatives.

Stevia (Stevia rebaudiana Bertoni), a plant known for its natural sweetening properties, has attracted attention for its antioxidant, anti-inflammatory, and metabolic-modulating effects [18]. Its aqueous extract has demonstrated the ability to reduce oxidative stress, regulate insulin levels, and improve reproductive parameters in experimental models [19].

Therefore, this study aimed to evaluate the effects of aqueous Stevia rebaudiana extract (SAE) and clomiphene citrate on the expression of GDF9, PTEN, and BMP15 genes, as well as on antioxidant status, in a letrozole-induced PCOS model in Wistar rats. This investigation provides insight into the molecular and oxidative pathways involved in PCOS and explores the therapeutic potential of combining natural and pharmaceutical interventions.

Methods

Extraction of aqueous extract from Stevia rebaudiana leaves

Dried leaves of Stevia rebaudiana Bertoni were extracted using hot water at 65 °C, with a leaf-to-water ratio of 1:45 (w/v). The extraction lasted for three hours, after which the crude extract was filtered through Whatman No. 4 filter paper. To purify the extract, 5% calcium hydroxide [Ca(OH)₂] was added based on the dry leaf weight (repeated twice). The resulting filtrates were passed through an Amberlite IR-4B resin ion-exchange column (Sigma-Aldrich, USA) to remove pigmentation. After 24 h at room temperature, the filtrate was filtered and concentrated using a rotary vacuum evaporator (Jeio Tech, Model Cubic SDC-30/30U, South Korea) [20, 21].

Animals

Fifty adult female Wistar rats (180–220 g) were purchased from the Animal House, Faculty of Medicine, Rafsanjan University of Medical Sciences (RUMS). Animals were maintained under a 12:12 h light/dark cycle at 20–25 °C with free access to food and water. Animal procedures followed the NIH Guide for the Care and Use of Laboratory Animals.

Estrous cycle determination and induction of PCOS

To synchronize the estrous cycle, rats received 100 µg of estradiol valerate (Aburaihan Co., Iran) in 0.2 ml of olive oil intramuscularly. After 42 h, 50 µg of progesterone (Aburaihan Co., Iran) was injected intramuscularly. Vaginal smears were collected 6 h later and stained with crystal violet (Merck, Germany) for microscopic analysis (100×).

Letrozole (1 mg/kg/day; Iran Hormone, Iran) was administered orally for 21 days, dissolved in 0.5% carboxymethyl cellulose (CMC; Merck, Germany) to induce PCOS [8, 22]. PCOS was confirmed by vaginal smear analysis showing prolonged diestrus and cycle irregularity.

Grouping of animals

Rats were randomly divided into 5 groups (n = 10 per group):

Group 1 (Control): 1 ml of CMC orally for 49 days.

Group 2 (PCOS): Letrozole (1 mg/kg) orally for 21 days, followed by CMC for 28 days.

Group 3 (SAE): Letrozole for 21 days, then SAE (400 mg/kg) orally for 28 days.

Group 4 (Clom): Letrozole for 21 days, then clomiphene citrate (Clom, 100 mg/kg) (Razak Labs, Iran) for 28 days.

Group 5 (CS): Letrozole for 21 days, followed by a combination of Clom (100 mg/kg) and SAE (400 mg/kg) for 28 days.

Measurement of antioxidant and hormonal parameters

At study end, rats were anesthetized with ketamine (80 mg/kg) and xylazine (10 mg/kg) (Alfasan, Netherlands). Blood was collected from the retro-orbital sinus. Serum was separated and stored at − 80 °C.

Hormone levels (LH, FSH, estrogen, progesterone) were measured using Pishtaz Teb ELISA kits (Pishtaz Teb Diagnostics, Iran; Kit Nos: LH-E2010, FSH-E1010, E2-E2210, PRG-E2310).

SOD and GPx activities were measured using ZellBio kits (Germany; Kit Nos: ZB-SOD96A, ZB-GPX96A).

Histopathology

Both ovaries were excised, fixed in 10% buffered formalin, and stored at 4 °C. One ovary per animal was processed, embedded in paraffin, sectioned at 5 μm, and stained with hematoxylin and eosin (H&E) for microscopic evaluation. Histological structures including antral follicles, corpus luteum, atretic and cystic follicles were identified using light microscopy. Quantification of follicles was conducted in 3 randomly selected sections per ovary, and counting was done per entire section under 100× magnification. The number of follicles, including primordial follicles, was estimated using the physical dissector stereological method based on the entire ovary. In this approach, consecutive tissue sections were prepared and stained, and follicles were counted using a Nikon microscope. For each ovary, systematic random sampling was applied. Two consecutive sections were projected simultaneously -one as the reference and the other as the lookup section- and 13 × 13 mm counting frames were randomly placed on the images. Only oocytes that did not touch the exclusion line and were absent in the lookup section were counted. The total number of follicles in the whole ovary was then calculated using stereological formulas, accounting for the reference volume obtained by the Cavalieri principle. We have revised the Materials and Methods section to reflect this clarification and improve the reproducibility of the methodology [23].

The number of follicles was calculated using the following formula: N = Nv × V(Ref).

where N is the total number of follicles, Nv is the numerical density of follicles per unit volume, and V(Ref) is the reference volume of the tissue, which was determined using the Cavalieri principle: V = ∑P × a(p)Xt.

In this formula, V represents the volume, ∑P is the total number of points hitting the region of interest, a(p) is the area associated with each point, and t is the thickness of the sections. The term a(p) refers to the volume of space surrounding a single intersection point.

RNA extraction and cDNA synthesis

Ovaries preserved in liquid nitrogen were powdered and RNA was extracted using Parstous RNA Extraction Kit (Parstous Biotech, Iran). RNA quality was confirmed with a Nanodrop (Thermo Fisher Scientific, USA) and 1% agarose gel electrophoresis.

1 µg of RNA was reverse-transcribed using Parstous cDNA Synthesis Kit (Parstous Biotech, Iran).

RT-PCR was conducted using SYBR Green Master Mix (Amplicon, Denmark) with the following primers:

Gdf9 (F: AGCCACTTACAGCATCCTTC / R: TCCAGTTGTCCCATTTGAGC).

Bmp15 (F: GAGGTCCTTGGCATATACAG / R: GATGAAGTTGATGGCGGTAG).

Pten (F: ATACCAGGACCAGAGGAAACC / R: TTGTCATTATCCGCACGCTC).

Actb (F: CGAGTACAACCTTCTTGCAGC / R: TCAGGGTCAGGATGCCTCTC).

Relative gene expression was calculated using the 2^(-ΔΔCt) method.

Statistical analysis

Data were analyzed using SPSS version 21. One-way ANOVA followed by Tukey’s post hoc test was used for multiple comparisons. Data are presented as mean ± SD, with P < 0.05 considered statistically significant. Normality of data distribution was assessed using the Shapiro-Wilk test.

Ethical consideration

All experimental procedures were approved by the Ethics Committee of Rafsanjan University of Medical Sciences (ID: IR.RUMS.REC.1401.235) and followed national animal care guidelines.

Results

Letrozole-induced PCOS and its effects on the estrous cycle

The induction of PCOS using letrozole (1 mg/kg for 21 days) was confirmed by significant alterations in the estrous cycle of female Wistar rats. Before induction, all rats exhibited regular estrous cycles, characterized by defined and alternating phases of proestrus, estrus, metestrus, and diestrus. However, letrozole administration disrupted this pattern, leading to prolonged diestrus phases, irregular cycles, and anovulation (Fig. 1A–D).

Fig. 1.

Fig. 1

Representative cytological images of crystal violet-stained vaginal smears illustrating the estrous cycle phases in female Wistar rats at 100x magnification. (A) Proestrus, characterized by a predominance of nucleated epithelial cells; (B) Estrus, exhibiting a predominance of cornified epithelial cells; (C) Diestrus, marked by a predominance of leukocytes; (D) Metestrus, displaying a mixture of leukocytes and epithelial cells

Body weight changes in laboratory rats during the treatment period

On day 1, there were no significant differences in baseline body weights among the groups (p = 0.82). By day 22 (post-induction), the PCOS, SAE, Clom, and CS groups exhibited significantly higher body weights compared to the control group (p < 0.01). On day 49 (post-treatment), the PCOS group maintained the highest weight (251.40 ± 6.69 g, p < 0.01 vs. control), whereas the SAE (242.30 ± 7.13 g), Clom (238.30 ± 4.90 g), and CS (233.70 ± 3.20 g) groups showed a significant decrease compared to the PCOS group (p < 0.01, Table 1).

Table 1.

Body weight changes in different treatment groups at the pre-treatment, post-induction, and post-treatment phases

Group phase Control PCOS SAE Clom CS

Pre-treatment

(Day 1)

198.51 ± 6.81 187.00 ± 4.64 187.00 ± 4.57 191.25 ± 5.03 188.40 ± 3.57
Post-induction (Day 22) 205.10 ± 7.67 224.80 ± 3.91a 212.90 ± 7.68a 2.18 ± 4.45a 209.60 ± 4.74a
Post-treatment (Day 49) 228.54 ± 4.77 251.40 ± 6.69a 242.30 ± 7.13ab 238.30 ± 4.90ab 233.70 ± 3.20ab

Values are presented as mean ± SD, with n = 10 rats per group. Statistical significance was determined by one-way analysis of variance (ANOVA) followed by Tukey’s post-hoc test, with P < 0.01. a: Significantly different from the control group; b: Significantly different from the PCOS group. PCOS, polycystic ovary syndrome; SAE, stevia aqueous extract; Clom, clomiphene; CS, SAE/Clom combination

Effect of treatments on serum hormone levels

Figure 2A–E shows hormone level comparisons. The PCOS group had a significant increase in LH (p < 0.0001) and LH/FSH ratio (p < 0.0001), and a decrease in FSH (p < 0.0001) compared to the control group. Treatment with SAE, Clom, and CS significantly reduced LH and LH/FSH ratio while increasing FSH compared to PCOS (p < 0.0001 for all comparisons).

Fig. 2.

Fig. 2

Comparison of serum LH (A), FSH (B), LH/FSH (C), estrogen (D), and progesterone (E) levels in PCOS rats treated with SAE, Clom, and CS. Values are presented as mean ± SD, with n = 10 rats per group. Statistical analysis was performed using one-way analysis of variance (ANOVA) followed by Tukey’s post-hoc test. ****P < 0.0001, significantly different from the control group; ####P < 0.0001, significantly different from the PCOS group; ▪▪▪▪P < 0.0001, significantly different from the SAE group; ●●●●P < 0.0001, significantly different from the Clom group. PCOS, polycystic ovary syndrome; SAE, stevia aqueous extract; Clom, clomiphene; CS, SAE/Clom combination

Estrogen levels were significantly lower in the PCOS group (p < 0.0001) but improved in all treatment groups (p < 0.0001 vs. PCOS).

Progesterone was reduced in all PCOS-induced groups compared to control (p < 0.0001), but SAE, Clom, and CS significantly elevated progesterone versus PCOS (p < 0.0001).

Clom and CS had higher progesterone levels than SAE (p < 0.0001), while CS was slightly lower than Clom (p < 0.0001).

Gene expression alterations of PTEN, GDF9, and BMP15

Gene expression of BMP15, GDF9, and PTEN is presented in Fig. 3. BMP15 and GDF9 expression were significantly higher in the PCOS group compared to the control (p < 0.001). These expressions were significantly reduced in SAE, Clom, and CS groups versus PCOS (p < 0.001). PTEN was significantly reduced in PCOS and SAE groups compared to control (p < 0.001). Clom and CS significantly increased PTEN expression vs. SAE (p < 0.001).

Fig. 3.

Fig. 3

Effects of PCOS and treatment interventions on the expression of BMP15 (A), GDF9 (B), and PTEN (C) genes in ovarian tissue. Data are presented as mean ± SD (n = 10 per group). Statistical analysis was performed using one-way ANOVA followed by Tukey’s post hoc test. ***P < 0.001 vs. Control group; ###P < 0.001 vs. PCOS group; ▪▪▪P < 0.001 vs. SAE group. PCOS, Polycystic Ovary Syndrome; SAE, Stevia Aqueous Extract; Clom, Clomiphene Citrate; CS, SAE/Clom Combination

Comparative analysis of antioxidant enzyme levels (SOD and GPX)

As shown in Table 2, the PCOS and SAE groups had significantly lower SOD levels than the control (p < 0.001). Clom and CS treatments significantly increased SOD compared to PCOS (p < 0.001). GPX levels were also reduced in the PCOS group (p < 0.001) but were significantly elevated in the SAE, Clom, and CS groups compared to PCOS (p < 0.001).

Table 2.

Comparison of antioxidant parameters (SOD and GPX) across study groups

Group Variable Control PCOS SAE Clom CS
SOD (U/mL) 264.54 ± 19.57 161.15 ± 16.71a 179.54 ± 20a 181.83 ± 15.96b 182.75 ± 18.64b
GPX (mU/mL) 197.34 ± 23.7 105.54 ± 24a 160.34 ± 25.12b 164.83 ± 24.8b 158.24 ± 22.9b

The values are presented as mean ± SD, with n = 10 rats per group. Statistical analysis was performed using one-way analysis of variance (ANOVA) followed by Tukey’s post-hoc test, with P < 0.001

a: Significantly different from the control group; b: Significantly different from the PCOS group

PCOS, polycystic ovary syndrome; SAE, stevia aqueous extract; Clom, clomiphene; CS, SAE/Clom combination

Histological features of letrozole-induced PCOS

H&E-stained ovarian sections from PCOS rats (Fig. 4A–C) showed multiple cystic follicles, reduced corpora lutea, and hyperplasia of the theca layer.

Fig. 4.

Fig. 4

Histological features of ovarian tissue in a PCOS model (H&E staining, 100× magnification). (A) Ovarian section showing multiple large cystic follicles and reduced presence of corpora lutea, indicating anovulation and follicular arrest. (B) Higher magnification of a cystic follicle wall, demonstrating the presence of a thickened theca layer and vascular changes, potentially reflecting luteinization and stromal hyperplasia. C) Detailed view of stromal tissue with evident theca cell hyperplasia, characterized by increased cell density and nuclear alterations, suggestive of endocrine disruption commonly associated with PCOS pathology

Histological observations in treatment groups

Histological observations across the treatment groups are depicted in Fig. 5A–E. Control ovaries displayed normal follicles, antral follicles, and corpora lutea. In contrast, PCOS ovaries exhibited dominant cystic structures with a complete absence of ovulation markers. Ovaries from SAE-treated rats revealed a combination of atretic follicles, normal vessels, and corpora lutea. Clom-treated ovaries showed partial restoration, with emerging follicles and corpora lutea. Finally, CS-treated ovaries demonstrated improved follicular integrity, although some persistent atresia was observed, indicating partial synergy between the SAE and Clom treatments.

Fig. 5.

Fig. 5

Histological changes in ovarian tissue stained with Hematoxylin and Eosin (H&E) at 100x magnification. (A) Control; (B) PCOS; (C) SAE; (D) Clom; (E) CS. Key observations include corpora lutea (CL), normal vessels (NV), antral follicles (AF), atretic cystic follicles (A), and cystic follicles (CF). PCOS, polycystic ovary syndrome; SAE, stevia aqueous extract; Clom, clomiphene; CS, SAE/Clom combination

Quantitative analysis of ovarian follicles

Table 3 summarizes follicular counts. PCOS rats had significantly fewer follicles across all categories (except cystic follicles), compared to control (p < 0.001). SAE, Clom, and CS treatments significantly increased the number of corpus luteum and reduced cystic follicles compared to PCOS (p < 0.001).

Table 3.

Changes in different ovarian tissue layers across study groups

Number of variables Primordial follicles Primary follicles Secondary follicles Antral follicles Corpus luteum Cystic follicles
Control 12.5 ± 5.5 11.8 ± 8.3 12.4 ± 8.5 13.9 ± 8.0 13.4 ± 10.1 12.7 ± 10.5
Pcos 10.2 ± 6.7a 7.5 ± 4.9a 9.7 ± 6.0a 9.4 ± 6.3a 4.8 ± 4.1a 19.3 ± 15.1a
SAE 11.5 ± 8.7 9.0 ± 6.3 10.2 ± 8.8 11.0 ± 9.5 8.9 ± 6.7b 14.0 ± 10.6b
Clom 11.8 ± 7.6 9.9 ± 6.6 11.2 ± 9.2 11.6 ± 8.0 10.4 ± 7.3b 11.4 ± 10.8b
CS 11.4 ± 9.5 10.2 ± 5.7 10.8 ± 7.0 12.1 ± 9.0 10.9 ± 6.5b 11.0 ± 9.4b

The values are presented as mean ± SD, with n = 10 rats per group. Statistical analysis was performed using one-way analysis of variance (ANOVA) followed by Tukey’s post-hoc test. aP < 0.001 indicates a significant difference versus the control group. bP < 0.001 indicates a significant difference versus the PCOS group

Discussion

This study provides compelling evidence for the efficacy of aqueous Stevia rebaudiana extract (SAE), clomiphene citrate (Clom), and their combination (CS) in ameliorating the multifaceted pathophysiology of polycystic ovary syndrome (PCOS) in a letrozole-induced Wistar rat model. The experimental outcomes reaffirm PCOS as a condition not solely limited to reproductive dysfunction but also involving significant metabolic, hormonal, genetic, and oxidative disruptions. Notably, the combined therapeutic strategy (CS) demonstrated additive or synergistic benefits across most parameters evaluated, supporting an integrative treatment model that leverages both pharmaceutical and phytotherapeutic agents. This combination may be particularly relevant in clinical scenarios where monotherapy fails or where adjunct support is necessary to address the metabolic or oxidative dimensions of PCOS.

The letrozole-induced model successfully replicated key pathological traits of human PCOS, including hormonal imbalance, disrupted estrous cycles, and cystic follicle formation, consistent with previous models [24, 25]. By inhibiting aromatase, letrozole disrupts estrogen biosynthesis, leading to elevated androgen levels. This hormonal environment disturbs hypothalamic feedback, impairs follicular development, and causes ovulatory dysfunction. The observed prolonged diestrus and irregular estrous cycles in this study confirm the functional disruption of the hypothalamic-pituitary-ovarian (HPO) axis [26]. This makes the model suitable for investigating not only therapeutic outcomes but also underlying pathophysiological mechanisms of PCOS.

Body weight gain in the PCOS group, along with elevated LH and reduced FSH, reflects metabolic and reproductive dysfunction. Treatments with SAE, Clom, and CS effectively reduced weight and restored hormonal balance by day 49, possibly via improvements in insulin sensitivity, estrogen regulation, and androgen suppression, which aligns with prior findings [27–29]. Although weight reduction was not the primary aim, it may indirectly reflect improvements in insulin sensitivity or lipid metabolism, especially since Stevia rebaudiana is known to modulate glucose and lipid profiles. Letrozole-induced hyperandrogenism can increase visceral fat deposition and insulin resistance, contributing to weight gain. The greater weight reduction in CS-treated rats suggests a potential metabolic synergy that warrants further exploration with glucose tolerance and insulin resistance assessments. In this context, SAE may act as an insulin-sensitizing agent through bioactive compounds like stevioside, which enhance glucose uptake and modulate hepatic gluconeogenesis [30].

Progesterone levels, suppressed in PCOS due to defective luteal activity, were significantly improved post-treatment. Clom and CS showed superior restoration compared to SAE, reflecting the well-established ovulation-inducing effects of Clom, while SAE’s impact may stem from phytoestrogens and glycosides modulating hypothalamic feedback [31]. Progesterone restoration serves as an indirect biomarker for successful ovulation and corpus luteum formation. Given that progesterone plays a crucial role in endometrial receptivity and early pregnancy maintenance, the observed improvements suggest a positive trajectory for potential fertility outcomes. Interestingly, while CS improved progesterone, some histological evidence of incomplete luteinization suggests the need for dose optimization or adjunctive luteal phase support. It is possible that although ovulation was triggered, luteal phase hormonal support might still be insufficient in some cases. This is consistent with literature suggesting that clomiphene-induced ovulation does not always equate to a fully functional luteal phase [32].

Elevated GDF9 and BMP15 expression in PCOS confirms their role in follicular arrest and impaired oocyte maturation [33, 34]. Treatments reduced their expression, supporting follicular normalization. Interestingly, PTEN, downregulated in PCOS, was notably restored by Clom and CS, suggesting a mechanism involving the PI3K/AKT pathway and granulosa cell survival [35]. GDF9 and BMP15, although essential for normal folliculogenesis, appear to be dysregulated in PCOS, potentially due to aberrant upstream endocrine cues. Their overexpression may disrupt the delicate granulosa-oocyte signaling necessary for ovulation, leading to cystic degeneration. PTEN, a negative regulator of the PI3K/AKT pathway, is vital in maintaining a balance between follicular dormancy and activation. Its reduced expression in PCOS ovaries may result in premature or aberrant follicle growth. Restoration of PTEN by Clom and CS may reflect improved granulosa cell survival, regulated follicular recruitment, and reduced follicular atresia. Moreover, PTEN is increasingly being recognized for its role in regulating oocyte quality, mitochondrial dynamics, and ovarian reserve -dimensions critically affected in PCOS [36].

Oxidative stress plays a major role in PCOS. Our results show significantly reduced SOD and GPX in PCOS ovaries. SAE, Clom, and CS treatments restored these levels, with CS being most effective. SAE’s effect is attributed to flavonoids, phenolic acids, and stevioside derivatives, which scavenge ROS and improve mitochondrial efficiency [18, 19, 37]. This supports the hypothesis that oxidative stress not only exacerbates PCOS symptoms but may actively participate in its etiology by impairing oocyte quality, disrupting steroidogenesis, and inducing inflammatory cascades. The antioxidant effect of SAE likely extends beyond direct free radical neutralization, possibly influencing the expression of redox-sensitive genes such as Nuclear factor erythroid 2-related factor 2 (NRF2) and Sirtuin 1 (SIRT1). Clom and CS treatments also significantly boosted antioxidant enzyme levels, suggesting an indirect enhancement of cellular antioxidant capacity -possibly via improved endocrine balance, reduced inflammation, or modulation of mitochondrial biogenesis. These improvements may not only restore ovarian health but also enhance oocyte quality and embryonic competence, critical for successful reproduction [38].

Histologically, PCOS ovaries displayed theca cell hyperplasia, cystic follicles, and absent corpora lutea, while treated groups showed partial to near-complete restoration of follicular morphology, especially with CS. These findings align with studies on hormonal and metabolic corrections in PCOS rats treated with phytocompounds and ovulation agents [39]. The observed increase in antral follicles and corpora lutea in CS-treated rats strongly suggests re-established ovulation and follicular maturity. Restoration of corpus luteum formation is particularly significant, as it marks the end-point of successful follicular development and confirms the transition from a dysfunctional to a functional ovary. Nevertheless, residual atresia and incomplete luteinization in some specimens highlight inter-individual variability or perhaps limitations in treatment duration or dosing strategy. These subtle histological inconsistencies could also reflect asynchronous follicular development or the presence of unresolved systemic metabolic stress [40].

The dual modulation of hormonal and oxidative parameters by SAE and Clom offers a multifaceted approach to PCOS management. While Clom remains a gold standard for ovulation induction, its limited impact on metabolic and oxidative features is well documented. SAE, by contrast, complements this gap through its antioxidative and potentially insulin-sensitizing properties. The combination strategy may, therefore, represent a novel paradigm for treating both reproductive and metabolic dimensions of PCOS, reducing reliance on polypharmacy. This integrative strategy may be especially relevant in women with clomiphene resistance, metabolic syndrome, or contraindications to conventional pharmacotherapy [41].

Further studies are needed to establish dose–response relationships, explore underlying pathways (e.g., insulin signaling, AMPK activation), investigate long-term fertility outcomes, and evaluate the anti-inflammatory effects and immune modulation by SAE. Inclusion of parameters such as serum insulin, HOMA-IR index, inflammatory cytokines (e.g., IL-6, TNF-α), and mitochondrial markers could provide a more comprehensive picture. Additionally, omics-based approaches like transcriptomics or metabolomics could offer deeper insight into the global impact of these interventions at a systems biology level. Clinical translation would benefit from safety profiling, pharmacokinetic studies, and controlled human trials to verify efficacy, particularly in populations with varied phenotypic expressions of PCOS.

Limitations

This study used only a single dose per treatment, limiting assessment of dose–response relationships. Key metabolic and inflammatory markers, such as insulin resistance and cytokine levels, were not evaluated. Fertility outcomes and long-term effects post-treatment remain unknown. Additionally, while the letrozole-induced rat model reflects human PCOS features, species differences limit direct clinical translation. Future studies should explore varying doses, assess metabolic and reproductive endpoints, and consider translational research in human subjects.

Conclusion

This study established a reliable letrozole-induced PCOS model in Wistar rats, effectively replicating key features of human PCOS, including hormonal imbalances, ovarian dysfunction, and metabolic disturbances. Treatment with SAE, Clom, and their combination (CS) significantly improved hormonal balance, antioxidant defenses, and ovarian histology. Clom and CS exhibited superior efficacy in promoting follicular development and ovulation, while also reducing oxidative stress. SAE provided moderate benefits, whereas CS demonstrated synergistic effects in addressing both hormonal and metabolic challenges. These findings offer valuable insights into potential therapeutic strategies for managing PCOS.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1 (122.8KB, docx)

Acknowledgements

The authors express their sincere gratitude to Rafsanjan University of Medical Sciences for providing the essential facilities and equipment required for the successful completion of this study.

Abbreviations

PCOS

Polycystic Ovary Syndrome

SAE

Stevia Aqueous Extract

Clom

Clomiphene Citrate

GDF9

Growth Differentiation Factor 9

PTEN

Phosphatase and Tensin Homolog

BMP15

Bone Morphogenetic Protein 15

SOD

Superoxide Dismutase

GPx

Glutathione Peroxidase

ROS

Reactive Oxygen Species

LH

Luteinizing Hormone

FSH

Follicle-Stimulating Hormone

H&E

Hematoxylin and Eosin

Author contributions

Conceptualization: AS, SZ; Methodology: AS, MM, RH, MV, SZ; Validation: AS, MM, AHFM, JPN, MMor; Formal analysis: AS, MM, RH, SZ; Investigation: AS, MM, MV, AHFM, JPN, SZ; Resources: SZ; Data curation: AS, MM, RH, MV, AHFM; Writing– original draft: AS; Writing– review & editing: MM, RH, SZ; Visualization: AS, MM, MV, SZ; Supervision: MM, SZ; Project administration: SZ; Funding acquisition: SZ. All authors have read and approved the final version of the manuscript. They also take full responsibility for the integrity and accuracy of the data presented.

Funding

This work was financially supported by Rafsanjan University of Medical Sciences, Rafsanjan, Iran.

Data availability

The data used in this study are available from the corresponding author on request.

Declarations

Ethics approval and consent to participate

All experimental procedures were reviewed and approved by the Ethics Committee of Rafsanjan University of Medical Sciences (Ethical ID: IR.RUMS.REC.1401.235).

Consent for publication

The authors confirm their consent for the final version of the manuscript to be considered for publication.

Competing interests

The authors declare no competing interests.

Clinical trial number

Not applicable.

Role of the funding source

The funding body was not involved in the design of the study, data collection, analysis, interpretation, or manuscript writing.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Norman RJ, Dewailly D, Legro RS, Hickey TE. Polycystic ovary syndrome. Lancet. 2007;370(9588):685–97. [DOI] [PubMed] [Google Scholar]
  • 2.Shankhwar A, Agrawal A, Meena R, Ahlawat S, Meena M. The role of color doppler imaging in the diagnosis of polycystic ovary syndrome. J Prev Complement Med. 2024;3(2):72–80. [Google Scholar]
  • 3.Guan Y, Wang D, Bu H, Zhao T, Wang H. The effect of Metformin on polycystic ovary syndrome in overweight women: a systematic review and meta-analysis of randomized controlled trials. Int J Endocrinol. 2020;2020(1):5150684. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Lei R, Chen S, Li W. Advances in the study of the correlation between insulin resistance and infertility. Front Endocrinol. 2024;15:1288326. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Belli M, Shimasaki S. Molecular aspects and clinical relevance of GDF9 and BMP15 in ovarian function. Vitam Horm. 2018;107:317–48. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Hajam YA, Rather HA, Kumar R, Basheer M, Reshi MS. A review on critical appraisal and pathogenesis of polycystic ovarian syndrome. Endocr Metabolic Sci. 2024;14(3):100162. 10.1016/j.endmts.2024.100162
  • 7.Morsi AA, Razik EAM, A MA HFAAMA. Histomorphological changes in a rat model of polycystic ovary syndrome and the contribution of Stevia leaf extract in modulating the ovarian fibrosis, VEGF, and TGF-β immunoexpressions: comparison with Metformin. Acta Histochem Cytochem. 2022;55(1):9–23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Saedi A, Zarei S, Vatanparast M, Hajizadeh M, Hosseiniara R, Esmaeili O, et al. editors. Therapeutic effects of stevia aqueous extract alone or in combination with Metformin in induced polycystic ovary syndrome rats: gene expression, hormonal balance, and metabolomics aspects. Annales Pharmaceutiques Françaises; 2025. [DOI] [PubMed]
  • 9.Kristensen SG, Kumar A, Mamsen LS, Kalra B, Pors SE, Bøtkjær JA, et al. Intrafollicular concentrations of the oocyte-secreted factors GDF9 and BMP15 vary inversely in polycystic ovaries. J Clin Endocrinol Metabolism. 2022;107(8):e3374–83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Sayutti N, Abu MA, Ahmad MF. PCOS and role of cumulus gene expression in assessing oocytes quality. Front Endocrinol. 2022;13:843867. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Agarwal A, Gupta S, Sharma RK. Role of oxidative stress in female reproduction. Reproductive Biology Endocrinol. 2005;3:1–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Liu S, Jia Y, Meng S, Luo Y, Yang Q, Pan Z. Mechanisms of and potential medications for oxidative stress in ovarian granulosa cells: a review. Int J Mol Sci. 2023;24(11):9205. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Carillon J, Rouanet J-M, Cristol J-P, Brion R. Superoxide dismutase administration, a potential therapy against oxidative stress related diseases: several routes of supplementation and proposal of an original mechanism of action. Pharm Res. 2013;30:2718–28. [DOI] [PubMed] [Google Scholar]
  • 14.Pei J, Pan X, Wei G, Hua Y. Research progress of glutathione peroxidase family (GPX) in redoxidation. Front Pharmacol. 2023;14:1147414. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Attia GM, Almouteri MM, Alnakhli FT. Role of metformin in polycystic ovary syndrome (PCOS)-related infertility. Cureus. 2023;15(8):e44493. 10.7759/cureus.44493 [DOI] [PMC free article] [PubMed]
  • 16.Misso ML, Costello MF, Garrubba M, Wong J, Hart R, Rombauts L, et al. Metformin versus clomiphene citrate for infertility in non-obese women with polycystic ovary syndrome: a systematic review and meta-analysis. Hum Reprod Update. 2013;19(1):2–11. [DOI] [PubMed] [Google Scholar]
  • 17.Abuelghar WM, Elkady OS, Khamees AA. Clomiphene citrate alone, in combination with Metformin or in combination with Pioglitazone as first line therapy in induction of ovulation in infertile women with polycystic ovary syndrome, a randomized controlled trial. Middle East Fertility Soc J. 2013;18(3):135–41. [Google Scholar]
  • 18.Peteliuk V, Rybchuk L, Bayliak M, Storey KB, Lushchak O. Natural sweetener Stevia rebaudiana: functionalities, health benefits and potential risks. EXCLI J. 2021;20:1412. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Kim I-S, Yang M, Lee O-H, Kang S-N. The antioxidant activity and the bioactive compound content of Stevia rebaudiana water extracts. LWT-Food Sci Technol. 2011;44(5):1328–32. [Google Scholar]
  • 20.Abou-Arab AE, Abou-Arab AA, Abu-Salem MF. Physico-chemical assessment of natural sweeteners steviosides produced from Stevia rebaudiana Bertoni plant. Afr J Food Sci. 2010;4(5):269–81. [Google Scholar]
  • 21.Nishiyama P, Alvarez M, Vieira LG. Quantitative analysis of stevioside in the leaves of Stevia rebaudiana by near infrared reflectance spectroscopy. J Sci Food Agric. 1992;59(3):277–81. [Google Scholar]
  • 22.Prajapati DP, Patel M, Dharamsi A. Beneficial effect of polyherbal formulation in letrozole induced polycystic ovarian syndrome (PCOS). J Traditional Complement Med. 2022;12(6):575–83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Mirzakhani Z, Hosseini S. Effects of chamomile hydro-alcoholic extract (Matricaria chamomilla) on the aborted fetuses, serum sex hormones and ovarian follicles in adult female rats. J Ardabil Univ Med Sci. 2017;17(1):22–31. [Google Scholar]
  • 24.Kafali H, Iriadam M, Ozardalı I, Demir N. Letrozole-induced polycystic ovaries in the rat: a new model for cystic ovarian disease. Arch Med Res. 2004;35(2):103–8. [DOI] [PubMed] [Google Scholar]
  • 25.Yang A-M, Cui N, Sun Y-F, Hao G-M. Letrozole for female infertility. Front Endocrinol. 2021;12:676133. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Chaiyamoon A, Bunsueb S, Reabroi S, Iamsaard S. Letrozole modulates tyrosine phosphorylation in liver and kidney of polycystic ovarian syndrome rats. FASEB J. 2020;34(S1):1. 10.1096/fasebj.2020.34.s1.06954
  • 27.Chang RJ. The reproductive phenotype in polycystic ovary syndrome. Nat Clin Pract Endocrinol Metab. 2007;3(10):688–95. [DOI] [PubMed] [Google Scholar]
  • 28.Chen W, Pang Y. Metabolic syndrome and PCOS: pathogenesis and the role of metabolites. Metabolites. 2021;11(12):869. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Patel S. Disruption of aromatase homeostasis as the cause of a multiplicity of ailments: A comprehensive review. J Steroid Biochem Mol Biol. 2017;168:19–25. [DOI] [PubMed] [Google Scholar]
  • 30.Samuel P, Ayoob K, Magnuson B, Wölwer-Rieck U, Jeppesen P, Rogers P, et al. Stevia leaf to Stevia sweetener: exploring its science, benefits, and future potential. J Nutr. 2018;148 7:1186–205. [DOI] [PubMed] [Google Scholar]
  • 31.Chen S, Cho M, Karlsberg K, Zhou D, Yuan Y-C. Biochemical and biological characterization of a novel anti-aromatase coumarin derivative. J Biol Chem. 2004;279(46):48071–8. [DOI] [PubMed] [Google Scholar]
  • 32.Duncan WC. The inadequate corpus luteum. Reprod Fertility. 2021;2(1):C1–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Karagül Mİ, Aktaş S, Yılmaz BC, Yılmaz M, Temel GÖ. GDF9 and BMP15 expressions and fine structure changes during folliculogenesis in polycystic ovary syndrome. Balkan Med J. 2018;35(1):43–54. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Yeo CX, Gilchrist RB, Thompson JG, Lane M. Exogenous growth differentiation factor 9 in oocyte maturation media enhances subsequent embryo development and fetal viability in mice. Hum Reprod. 2008;23(1):67–73. [DOI] [PubMed] [Google Scholar]
  • 35.Namlı Kalem M, Anadol E, Kalem Z, Sezginer PY, Elmas C, Yılmaz C, et al. A rat study on the PTEN expression in ovarian tissue in PCOS and folliculogenesis. Sci Rep. 2023;13(1):20774. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Wei L-N, Huang R, Li L-L, Fang C, Li Y, Liang X-Y. Reduced and delayed expression of GDF9 and BMP15 in ovarian tissues from women with polycystic ovary syndrome. J Assist Reprod Genet. 2014;31:1483–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Vaziripour M, Faghihi M, Ranjbaran M, Asadi B, Abdi A, Kianian F, et al. Exploring the therapeutic potential of sodium hydrosulfide in alleviating oxidative stress and ovarian dysfunction in a rat model of polycystic ovary syndrome. J Reprod Infertility. 2024;25(2):133. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Mancini A, Bruno C, Vergani E, d’Abate C, Giacchi E, Silvestrini A. Oxidative stress and Low-Grade inflammation in polycystic ovary syndrome: controversies and new insights. Int J Mol Sci. 2021;22(4):1667. 10.3390/ijms22041667 [DOI] [PMC free article] [PubMed]
  • 39.Alahmadi AA, Alzahrani AA, Ali SS, Alahmadi BA, Arab RA, El-Shitany NAE-A. Both Matricaria chamomilla and Metformin extract improved the function and histological structure of thyroid gland in polycystic ovary syndrome rats through antioxidant mechanism. Biomolecules. 2020;10(1):88. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Salehi R, Mazier H, Nivet A, Reunov A, Lima P, Wang Q et al. Ovarian mitochondrial dynamics and cell fate regulation in an androgen-induced rat model of polycystic ovarian syndrome. Sci Rep. 2020;10(1):1021. 10.1038/s41598-020-57672-w [DOI] [PMC free article] [PubMed]
  • 41.Peteliuk V, Rybchuk L, Bayliak M, Storey K, Lushchak O. Natural sweetener Stevia rebaudiana: functionalities, health benefits and potential risks. EXCLI J. 2021;20:1412–30. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 1 (122.8KB, docx)

Data Availability Statement

The data used in this study are available from the corresponding author on request.


Articles from Journal of Ovarian Research are provided here courtesy of BMC

RESOURCES