Skip to main content
Breast Cancer Research : BCR logoLink to Breast Cancer Research : BCR
. 2025 Jul 6;27:124. doi: 10.1186/s13058-025-02078-7

THEM6 modulates carboplatin sensitivity by regulating ferroptosis through FDFT1 in triple-negative breast cancer

Yuexiang Zeng 1, Zhijie Xu 2, Juan Huang 3, Qiaoli Yi 2, Xi Chen 4, Jiayu Wang 4, Zhihao Du 2, Jian Tian 5,6,✉, Yuanliang Yan 4,✉
PMCID: PMC12232811  PMID: 40619388

Abstract

Background

Triple-negative breast cancer (TNBC) is an aggressive subtype with poor prognosis, as chemotherapy resistance leads to relapse in many patients. Carboplatin addition improves treatment response, but challenges persist.

Methods

To identify novel targets for TNBC, we analyzed differentially expressed proteins in patients treated with neoadjuvant chemotherapy. Cell viability was assessed using CCK-8 and colony formation assays. In vivo effects were studied in an orthotopic xenograft model using THEM6 overexpression cells. ROS, iron levels, MDA, and mitochondrial ultrastructure were assessed. Protein expression was analyzed by Western blotting and RT-PCR, and FDFT1 ubiquitination was evaluated.

Results

We identified THEM6 (co-downregulated) and PGRMC1 (co-upregulated) as survival-associated proteins. THEM6 overexpression enhanced carboplatin sensitivity in vitro and in vivo, reducing tumor weight and volume. THEM6-induced sensitivity was linked to ferroptosis, as the ferroptosis inhibitor Fer-1 reversed the effect, while apoptosis, necrosis, and autophagy inhibitors had no impact. THEM6 overexpression reduced GPX4 and SLC7A11, while increasing ACSL4. TEM revealed mitochondrial damage, and iron, MDA, and ROS levels were elevated in treated cells. Mechanistically, THEM6 stabilized FDFT1 by inhibiting its K48-linked ubiquitination, prolonging its protein half-life, and promoting ferroptosis. FDFT1 knockdown reversed THEM6-induced sensitivity to carboplatin.

Conclusions

Our findings suggest that THEM6 enhances carboplatin sensitivity in TNBC by promoting ferroptosis through regulation of FDFT1. THEM6 may serve as a novel therapeutic target to improve TNBC treatment outcomes.

Supplementary Information

The online version contains supplementary material available at 10.1186/s13058-025-02078-7.

Keywords: Triple-negative breast cancer, Ferroptosis, Carboplatin, THEM6, FDFT1

Background

Breast cancer is among the most prevalent cancers in women, with approximately 2,261,419 new cases and 684,996 deaths reported globally in 2020 [1]. Triple-negative breast cancer (TNBC), a highly aggressive subtype lacking estrogen, progesterone, and human epidermal growth factor receptor 2 receptors, is associated with a poor prognosis due to its limited treatment options. TNBC represents about 15–20% of all breast cancer cases. It has a worse prognosis, with over 50% of patients experiencing relapse within 3 to 5 years after diagnosis, and the median overall survival (OS) with current treatments being 10.2 months [2, 3]. Due to the absence of relevant receptor markers, patients with TNBC do not benefit from established endocrine or HER2-targeted therapies. Therefore, general chemotherapy remains the standard treatment for nonsurgical TNBC. Although TNBC shows a relatively good response to conventional chemotherapy, less than 30% of patients achieve a complete response [2], and both recurrence and mortality rates remain elevated compared to non-TNBC subtypes.

For patients with inoperable or locally advanced breast cancer, the American Society of Clinical Oncology (ASCO) guidelines recommend neoadjuvant therapy (NAT) [4]. Nowadays, NAT has become a critical component in managing advanced-stage TNBC by shrinking tumors before surgery, enabling breast-conserving surgery or making inoperable tumors resectable. Research findings indicate that in patients with stage IIIC/IV disease who were not candidates for optimal primary debulking surgery, six cycles of neoadjuvant carboplatin and paclitaxel were both safe and effective, without increasing perioperative or postoperative complications. This treatment approach was associated with superior overall survival compared to those who underwent interval debulking surgery [5, 6]. To increase the rate of pathological complete response, previous trials investigated adding immunotherapy or targeted therapy to neoadjuvant chemotherapy. To increase the rate of pathological complete response, previous trials investigated adding immunotherapy or targeted therapy to neoadjuvant chemotherapy. In patients with untreated stage II or III triple-negative breast cancer receiving neoadjuvant treatment with the PD-1 inhibitor pembrolizumab combined with paclitaxel and carboplatin, disease progression, local or distant recurrence, or a second primary tumor occurred in 7.4% of the pembrolizumab-chemotherapy group, compared to 11.8% in the placebo-chemotherapy group, after a median follow-up of 15.5 months [7].

Considering the heterogeneity of breast cancer, identifying novel targets for neoadjuvant chemotherapy is of critical importance for optimizing treatment outcomes [8]. Thioesterase superfamily member 6 (THEM6) is a 208-amino-acid protein within the THEM family. It may possess immune-modulating properties, positioning it as a potential target for immunotherapy in bladder cancer and breast cancer [9, 10]. THEM6 plays a critical role in triggering the endoplasmic reticulum stress response (UPR) [11]. Research by Blomme et al. revealed that THEM6 overexpression in androgen deprivation therapy promotes sustained activation of the ER UPR, which helps prostate cancer cells endure therapy-induced ER stress [12]. To identify new targets for neoadjuvant chemotherapy in TNBC using carboplatin and paclitaxel, we analyzed pre-treatment and post-treatment tissue samples from responding and non-responding patients via mass spectrometry. We discovered that THEM6 may be a promising molecular target for improving outcomes in TNBC neoadjuvant chemotherapy. Further validation through in vivo or in vitro experiments revealed that THEM6 affects carboplatin sensitivity by mediating ferroptosis regulated by farnesyl-diphosphate farnesyltransferase 1 (FDFT1).

Methods

TNBC tissue specimen

The study protocol and tissue specimen acquisition were approved by the Ethical Review Committee of Xiangya Hospital (2024121786). From 2024 to 2025, four pairs of samples from patients with histologically confirmed primary triple-negative breast cancer (TNBC) who underwent core needle biopsies at Xiangya Hospital (Hunan, China), received neoadjuvant chemotherapy with carboplatin and paclitaxel for the first time, and subsequently underwent surgery, without prior targeted or immunotherapy, were included in this study. Paraffin-embedded TNBC samples were collected for mass spectrometry analysis, with pre-treatment tissues obtained from core needle biopsies before NAT and post-treatment tissues from surgical resections. Ultimately, Eight TNBC tissue specimens were subjected to 4D-label free proteome analysis (Majorbio, China). To validate our findings, we further utilized paraffin-embedded primary triple-negative breast cancer (TNBC) surgical samples from 44 cases collected between 2023 and 2025. These samples were from patients who received neoadjuvant chemotherapy with carboplatin and paclitaxel for the first time, without prior targeted or immunotherapy, and underwent immunohistochemical analysis to investigate the relationship between THEM6 expression and prognosis. Tumor response to treatment was evaluated using RECIST 1.1, categorizing patients into responder (S) and non-responder (NS) groups. Additionally, human TNBC tissue arrays (WZ-TNBC1201) were purchased from Shanghai Outdo Biotech Co., Ltd.

Mass spectrometry

Paraffin-embedded samples were deparaffinized by incubating them in xylene at 37 °C with constant shaking, followed by centrifugation at 14,000 g to remove residual paraffin. This process was repeated until no wax remained. The samples were then sequentially rehydrated with ethanol and ultrapure water. Following rehydration, lysis was performed using 5% SDT buffer (SDS, 100 mM Tris-HCl, pH 8.5) supplemented with a protease inhibitor cocktail, followed by three rounds of homogenization. Ultrasonic fragmentation was carried out for 1 h, and the lysates were subsequently heated in a boiling water bath at 95 °C for 60 min. After centrifugation, the supernatant was collected for protein quantification using a BCA assay. SDS-PAGE was performed to assess protein integrity. Protein digestion was conducted overnight in TEAB buffer (100 mM) using trypsin, following reduction with TCEP and alkylation with IAM. The resulting peptides were desalted using HLB cartridges, vacuum-dried, and quantified. Finally, data-independent acquisition (DIA) mass spectrometry was performed on a timsTOF Pro2 instrument in DIA-PASEF mode, acquiring MS data across an m/z range of 400–1200 with 64 isolation windows for comprehensive proteomic analysis. Proteins with significant differential expression were identified based on criteria of P < 0.05 and an absolute fold change > 2. The association between THEM6 expression and overall survival (OS) in TNBC patients was analyzed using the KM-Plotter online tool (http://kmplot.com) based on the GSE96058 dataset [13].

Immunohistochemical staining

The tissue sections were dehydrated, subjected to citrate antigen retrieval, and blocked with 5% goat serum for 15 min at room temperature. They were then incubated overnight at 4 °C with a diluted primary anti-THEM6 antibody. Following this, the sections were treated with DAB, counterstained with hematoxylin, and dehydrated using ethanol. Images were captured and analyzed using ImageScope software (Leica Microsystems). The histological score was calculated as Total score = Proportion score × Intensity score, and samples were classified as high or low expression based on a median score of 4.

Cell lines and reagents

The human triple-negative breast cancer cell lines MDA-MB-231 and BT-549 were cultured in Dulbecco’s Modified Eagle Medium (DMEM) and RPMI 1640, respectively, each supplemented with 10% fetal bovine serum (FBS) and penicillin/streptomycin. Cultures were maintained at 37 °C in a 5% CO2 atmosphere. Paclitaxel (HY-B0015) and Carboplatin (HY-17393) were obtained from MedChemExpress (MCE). The ferroptosis inhibitors ferrostatin (Fer-1, HY-100579) and liproxstatin-1 (Lip-1, HY-12726) were also purchased from MCE. Additionally, the pan-caspase inhibitor Z-VAD-FMK (HY-16658B), necrosis inhibitor necrostatin-1 (Nec-1, HY-15760), and autophagy inhibitor 3-methyladenine (3-MA, HY-19312) were sourced from MCE. Antibodies used in the study were acquired from the following suppliers: PGRMC1 (Zen-bio, 122868), THEM6 (Bioss, bs-15296R), FDFT1 (Proteintech, 13128-1-AP), GPX4 (Huabio, ET1706-45), SLC7A11 (Huabio, HA600098), ACSL4 (Huabio, ET7111-43), V5-tag antibody (Proteintech, 14440-1-AP), HA-tag antibody (Proteintech, 51064-2-AP), Flag-tag antibody (Proteintech, 20543-1-AP) and β-actin (Proteintech, 66009-1-Ig). lentiviral vectors including THEM6, PGRMC1 and the Negative Control, were purchased from GENERAL BIOL. Lentiviral particles containing shRNA targeting human FDFT1 (Locus ID 2222) were purchased from Origene.

Lentiviral transduction

Lentiviruses were packaged in HEK293T cells by co-transfection of the expression vector with packaging plasmids psPAX2 and pMD2.G using Lipofectamine 3000 (Invitrogen), following the manufacturer’s protocol. Viral supernatants were collected at 48 h post-transfection, filtered through a 0.45 μm membrane. Target cells (MDA-MB-231 or BT-549) were seeded in six-well plates and infected with lentivirus in the presence of 8 µg/mL polybrene. After 48 h, cells were selected with 2 µg/mL puromycin for one week. Stable expression was confirmed by Western blot analysis.

Cell viability assay

MDA-MB-231 and BT-549 cells were plated in 96-well plates at a density of 5 × 10^4 cells/ml. Following cell adherence, the cultures were treated with specified concentrations of carboplatin or paclitaxel for 48 h. Cell viability was evaluated using the Cell Counting Kit-8 (CCK-8) assay (MCE, HY-K0301), according to the manufacturer’s protocol. Absorbance at 450 nm was quantified using a microplate reader (PerkinElmer). The half-maximal inhibitory concentration (IC50) values were determined from dose-response curves generated using GraphPad Prism software.

Colony formation assay

Breast cancer cells were seeded into six-well plates and allowed to adhere overnight. They were then treated with 0, 0.5, or 1 µM carboplatin for 48 h. Following drug treatment, the medium was removed, and the cells were washed with PBS, trypsinized, and replated at a density of 2000 cells per well in new six-well plates. The cells were incubated for 14 days to allow colony formation. Colonies were subsequently stained with crystal violet, and the number of colonies in each condition was quantified.

Live/dead viability assay

Cells were seeded into 6-well plates at a density of 5 × 10^4 cells per well. After 48 h, cell viability was assessed using the Calcein AM/PI Live-Dead Cell Staining Kit I (APExBIO, K2247). Briefly, cells were incubated with 1 µM propidium iodide (PI) and 1 µM Calcein AM for 30 min at room temperature. Following staining, the cells were washed twice with PBS. Fluorescence microscopy was performed using an Axio Observer 3 fluorescence microscope (Carl Zeiss Microimaging) to visualize and differentiate live (green) and dead (red) cells.

Quantitative real-time PCR

Total RNA was isolated using TRIzol reagent (Invitrogen). cDNA was synthesized with SuperScript™ II reverse transcriptase (Invitrogen), and quantitative PCR was performed using Power SYBR Green PCR Master Mix (Takara). The primers used for the SYBR Green assays were as follows: THEM6-F:5′-GCAGCACTGGATCTCCTACAACG-3′; THEM-R: 5′- GGTCCTTGGTGACATCACTGAGC-3′; FDFT1-F:5′-GCAACGCAGTGTGCATATTTT-3′; FDFT1-R: 5′-CGCCAGTCTGGTTGGTAAAGG-3′; β-actin-F: 5′-CACCATTGGCAATGAGCGGTTC-3′; and β-actin-R: 5′- AGGTCTTTGCGGATGTCCACGT − 3′. Real-time amplification was carried out using an ABI Prism 7000 SDS (Applied Biosystems). Gene expression levels were quantified using the 2−ΔΔCT method, with normalization to β-actin as the reference gene.

Western blot and ubiquitination assays

Cells were lysed using RIPA lysis buffer (MCE, HY-K1001) supplemented with a protease inhibitor cocktail (MCE, HY-K0010). The protein concentration in the cell lysate was determined using the Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific, 23225), following the manufacturer’s protocol. Samples were then denatured with SDS-PAGE protein loading buffer (Beyotime, D0071) at 100 °C for 5 min. Proteins were separated by SDS-PAGE and transferred to PVDF membranes (Millipore, ISEQ00010). After overnight incubation with the primary antibody, the membranes were probed with the secondary antibody at 37 °C for 1 h. Protein bands were visualized using Pierce™ ECL Western Blotting Substrate (Thermo Scientific, 32106) and captured using Image Lab software version 5.0 (Bio-Rad). For Ubiquitination assays, cells were lysed with 100 µL of NETN buffer (62.5 mM Tris-HCl pH 6.8, 2% SDS, 10% glycerol, 20 mM NEM, 1 mM iodoacetamide), boiled for 15 min, and then diluted 10-fold in NETN containing protease inhibitors, NEM, and iodoacetamide. After centrifugation, the supernatant was subjected to immunoprecipitation and analyzed by Western blotting [14].

Cycloheximide (CHX) Chase assay

To evaluate protein stability, MDA-MB-231 and BT-549 cells stably expressing either THEM6 or a negative control were seeded in six-well plates and cultured to approximately 70% confluence. CHX was added to the culture medium at a final concentration of 0.1 mg/mL. Cells were harvested at designated time points (0, 2, 4, 6, and 8 h) following CHX treatment. At each time point, cells were washed with ice-cold PBS and lysed in RIPA buffer supplemented with protease inhibitors. Lysates were clarified by centrifugation at 14,000 g for 15 min at 4 °C, and protein concentrations were quantified using a BCA assay. Equal amounts of protein were subjected to SDS-PAGE, followed by Western blot analysis to assess protein degradation kinetics.

ROS measurement

Intracellular ROS levels were measured using the fluorescent probe 2′,7′-dichlorodihydrofluorescein diacetate (DCFH-DA) (Sigma, 35845). This probe diffuses into cells and is enzymatically converted to the fluorescent 2′,7′-dichlorofluorescein (DCF). Triple-negative breast cancer (TNBC) cells were plated at a density of 6 × 10^5 cells per well in 6-well plates and incubated for 24 h. The cells were then exposed to 5 µM carboplatin for 48 h. After treatment, the cells were incubated with 10 µM DCFH-DA solution at 37 °C for 30 min, followed by three washes with phosphate-buffered saline (PBS). DCF fluorescence was visualized using an Axio Observer fluorescence microscope (Carl Zeiss Microimaging) with excitation at 485 nm and emission at 535 nm.

Ferrous iron measurement

Intracellular ferrous iron (Fe²⁺) content was quantified using the Iron Assay Kit (Abcam, ab83366). Briefly, samples were incubated at 25 °C for 30 min, followed by an additional 60-minute incubation with the iron probe at 25 °C to form a stable colored complex. Standard curve and reaction solutions were prepared according to the manufacturer’s instructions. The samples were then transferred to a microplate reader (PerkinElmer), and Fe²⁺ levels were determined by measuring absorbance at 539 nm.

Malondialdehyde measurement

Malondialdehyde (MDA) levels were measured in the lysates using the Lipid Peroxidation Assay Kit (Beyotime, S0131) according to the kit’s instructions. Briefly, 0.1 mL sample was mixed with 0.2 mL of the MDA detection working solution and incubated for 15 min at 100 °C. The samples were then allowed to cool to room temperature and centrifuged at 1000 × g for 10 min to collect the supernatant. Next, 200 µL of the supernatant was transferred to a 96-well plate, and absorbance was measured at 532 nm using a microplate reader (PerkinElmer). MDA levels were expressed as the ratio of the absorbance value to that of the control group.

Transmission electron microscope assay

Briefly, cells were seeded in 6-well plates at a density of 5 × 10^4 cells per well and treated with or without 5 µM carboplatin for 48 h. After treatment, cells were collected, washed with PBS, and fixed with 2.5% glutaraldehyde. The samples were then processed according to standard procedures, and images were obtained using a transmission electron microscope (Hitachi). The proportion of mitochondria with increased bilayer membrane formation was quantified using TEM images. To determine the size of mitochondria, TEM images were analyzed using ImageJ software to measure the mitochondrial area, and the relative mitochondrial size was provided.

Xenograft mouse model

The experiments were conducted with approval from the Animal Care and Use Committee of Central South University (China) (XY20240903005). Control or THEM6-overexpressing MDA-MB-231 cells (2 × 10^6) were orthotopically implanted into the mammary fat pads of 20 BALB/c nude mice (4 weeks old). Once the tumors reached approximately 50 mm³ in size, the mice were randomly assigned to four groups, with 5 mice per group: a carboplatin treatment group, in which carboplatin was administered via intraperitoneal (IP) injections at a dose of 50 mg/kg once weekly for three cycles, and a control group. Tumor volumes were measured every 3 days using calipers from the start of treatment and calculated using the formula (length × width2) × 1/2. Mice were sacrificed for tumor dissection on day 35 post-treatment initiation. H₂O₂ levels were measured using an H₂O₂ assay kit (Beyotime). Tumor tissue was homogenized, and absorbance at 560 nm was measured using a microplate reader (PerkinElmer).

Statistical analysis

Overall survival (OS) was analyzed using Kaplan–Meier curves and compared with the log-rank test. Data are presented as mean ± SD (n ≥ 3) and were analyzed using GraphPad Prism 6 software (GraphPad Software). Differences between groups with continuous data were evaluated using the Student’s t-test. p-values less than 0.05 were considered statistically significant.

Results

Exploring new targets for neoadjuvant chemotherapy in TNBC

Analyzing pre-treatment and post-treatment tissue samples from responding and non-responding patients via mass spectrometry, we aimed to identify new targets for neoadjuvant chemotherapy in TNBC using carboplatin and paclitaxel. Quality control results are presented in Supplementary Fig. 1 A-C. As illustrated in Fig. 1A and Supplementary Tables 1, 18 proteins were found to be co-upregulated, while 20 proteins were co-downregulated in the NS groups across both pre-treatment and post-treatment tissues. The heatmap of these differentially expressed proteins is shown in Fig. 1B. To further elucidate the relationship between these proteins and TNBC prognosis, we used the TCGA dataset and performed a LASSO regression analysis on the prognostic effects of these genes. We found that PGRMC1 and THEM6 may be associated with OS in breast cancer (BRCA) (Fig. 1C-D). Kaplan-Meier plotter analysis demonstrated that the co-downregulation of THEM6 was significantly associated with improved OS in patients with BRCA, including those with the BRCA basal subtype and TNBC (Fig. 1E). In contrast, the co-upregulation of PGRMC1 was significantly linked to poor OS specifically in BRCA and TNBC patients (Supplementary Fig. 1D). To elucidate the relationship between PGRMC1 and THEM6 with carboplatin and paclitaxel, we used TNBC cell lines (MDA-MB-231 and BT549) and overexpressed PGRMC1 and THEM6 in these cells (Fig. 1F and Supplementary Fig. 1E). PGRMC1 overexpression decreased sensitivity to both carboplatin and paclitaxel (Supplementary Fig. 1F-G), while THEM6 overexpression significantly increased sensitivity to carboplatin without affecting sensitivity to paclitaxel (Fig. 1G-H). Additionally, analysis of 44 TNBC specimens from patients receiving NAC with carboplatin and paclitaxel confirmed a significant upregulation of THEM6 in the S group compared to the NS group (Fig. 1I-J). IHC analysis of a TNBC tissue microarray further demonstrated that high THEM6 expression was significantly associated with improved OS and PFS (Fig. 1K-L).

Fig. 1.

Fig. 1

Investigating Novel Targets for Neoadjuvant Chemotherapy in Triple-Negative Breast Cancer. (A) Pre- and post-treatment samples from TNBC patients who received neoadjuvant chemotherapy with carboplatin and paclitaxel were collected for mass spectrometry analysis. Patients were classified into responder (S) and non-responder (NS) groups according to RECIST 1.1 criteria. The Venn plot illustrates the co-differentially expressed proteins in NS groups from pre- and post-treatment TNBC tissues, identified using a threshold of P < 0.05 and an absolute fold change > 2. (B) The heatmap of co-differentially expressed proteins of Fig. 1A. (C-D) LASSO regression analysis was conducted using the BRCA_TCGA dataset to evaluate the prognostic effects of the co-differentially expressed genes. (E) The Kaplan-Meier plotter (GSE96058) was used to analyze the OS of the co-downregulated protein THEM6. (F) Protein expression levels in THEM6 overexpressing TNBC cells were assessed by Western blot analysis. (G-H) Cell viability of TNBC cells following treatment with carboplatin or paclitaxel after THEM6 overexpression. (I–J) IHC analysis of THEM6 expression in S and NS TNBC groups treated with neoadjuvant chemo using carboplatin and paclitaxel. (K–L) Correlation of THEM6 expression with OS and PFS in TNBC based on tissue microarray analysis. The p-values are as follows: ** indicates p < 0.01, and ns represents not significant

THEM6 correlates with increased sensitivity to carboplatin

GSEA analysis of the S and NS groups revealed that pathways related to ROS, ion transport, and immune response may be associated with sensitivity to carboplatin (Fig. 2A). To investigate the role of THEM6 in carboplatin sensitivity, we utilized a THEM6 stable overexpression cell line treated with carboplatin at different time points and various concentrations. The cell viability assay demonstrated that overexpression of THEM6 significantly enhanced sensitivity to carboplatin, as indicated by a reduced IC50 value following THEM6 overexpression (Fig. 2B-C). The colony formation assay demonstrated that THEM6 overexpression significantly decreased the colony formation ability following carboplatin treatment, while there was no significant change observed in the absence of carboplatin treatment (Fig. 2D-E). Furthermore, we conducted live and dead staining, and the results indicated that THEM6 overexpression significantly increased the dead/live ratio of TNBC cells (Fig. 2F-G). To validate the role of THEM6 in vivo, we established an orthotopic xenograft tumor model using the THEM6 stable overexpression MDA-MB-231 cell line, with or without carboplatin treatment (Fig. 2H). As expected, THEM6 overexpression significantly increased sensitivity to carboplatin. Compared to the control group, both tumor weight and volume were significantly reduced in the THEM6 overexpression group following carboplatin treatment (Fig. 2I-L). There was no significant change in body weight across the groups (Fig. 2M).

Fig. 2.

Fig. 2

THEM6 is Associated with Enhanced Sensitivity to Carboplatin. (A) GSEA analysis of S and NS groups. (B) Cell viability was assessed using the CCK8 assay after treatment with 5 µM carboplatin at different time points in THEM6 stable overexpression and control cell lines. (C) Cell viability was assessed using the CCK8 assay following treatment with various concentrations of carboplatin in THEM6 stable overexpression and control cell lines. (D-E) The colony formation ability was evaluated using the colony formation assay after treatment with various concentrations of carboplatin in THEM6 stable overexpression and control cell lines. (F-G) The dead/live ratio in each group was assessed using Calcein AM/PI staining. (H) Schematic of the in vivo experiment. The orthotopic xenograft tumor model was established using the THEM6 stable overexpression MDA-MB-231 cell line, treated with or without carboplatin. (I-J) Representative images of tumors from each group, illustrating the differences in tumor morphology and size following treatment. (K-M Quantitative analysis of tumor characteristics, including tumor weight (K), tumor volume (L), and body weight (M) for each group. The p-values are as follows: ** indicates p < 0.01

THEM6 participation in ferroptosis of TNBC cells

To elucidate the mechanism by which THEM6 influences carboplatin sensitivity, we employed mass spectrometry to identify differentially expressed proteins following THEM6 overexpression. The results were visualized in a volcano plot (Fig. 3A). Gene Set Enrichment Analysis (GSEA) of these differentially expressed proteins indicated that THEM6 overexpression modulates cell death-related pathways (Fig. 3B). In TNBC cells, the ferroptosis inhibitor Fer-1 effectively reversed the enhanced carboplatin sensitivity induced by THEM6 overexpression. In contrast, inhibitors of apoptosis (Z-VAD-FMK), necrosis (Nec-1), and autophagy (3-MA) did not have a similar effect (Fig. 3C). Furthermore, THEM6 overexpression led to a decrease in the protein levels of GPX4 and SLC7A11, while it increased the protein levels of ACSL4 in carboplatin-treated cells (Fig. 3D). TEM analysis revealed that THEM6 overexpression caused significant alterations in mitochondrial ultrastructure [15], including reduced mitochondrial volume and increased bilayer membrane formation (Fig. 3E-G). Ferroptosis is an iron-dependent form of regulated cell death initiated by the lethal accumulation of lipid peroxidation [16]. We found that THEM6 overexpression elevated intracellular iron levels (Fig. 3H), MDA levels (Fig. 3I), and ROS levels (Fig. 3J-K) in carboplatin-treated cells. Additionally, similar expression trends of GPX4, SLC7A11, and ACSL4 (Supplementary Fig. 2A), along with increased levels of iron, MDA, and H₂O₂ in the in vivo mouse model (Supplementary Fig. 2B-D), were observed. These findings suggest that THEM6 sensitizes cells to carboplatin through the induction of ferroptosis.

Fig. 3.

Fig. 3

THEM6 Regulates Ferroptosis and Modulates Carboplatin Sensitivity in TNBC. (A) THEM6 was overexpressed in TNBC cells, and mass spectrometry was used to identify differentially expressed proteins. (B) Gene Set Enrichment Analysis (GSEA) was performed to reveal potential pathways regulated by THEM6. (C) Stable THEM6-overexpressing and control TNBC cells were treated with ferroptosis inhibitor (1 µM Fer-1), apoptosis inhibitor (20 µM Z-VAD-FMK), necrosis inhibitor (20 µM Nec-1), and autophagy inhibitor (10 µM 3-MA) for 6 h, followed by exposure to 5 µM carboplatin for 24 h. Cell viability was assessed using the CCK-8 assay. (D) MDA-MB-231 and BT-549 cells, transfected with THEM6 or control vectors, were treated with or without 5 µM carboplatin. Cell lysates were analyzed by Western blot to determine the levels of indicated proteins. (E-G) Ultrastructural changes in mitochondria were examined by transmission electron microscopy (TEM) across the different experimental groups. (H) Relative iron levels were measured using an Iron Assay Kit. (I) Malondialdehyde (MDA) levels were assessed using a Lipid Peroxidation Assay Kit. (J-K) Reactive oxygen species (ROS) intensity was measured using the fluorescent probe 2′,7′-DCFH-DA. The p-values are as follows: *p < 0.05, **p < 0.01

To further validate the role of THEM6 in cell ferroptosis, we utilized two ferroptosis inhibitors (Fer-1 and Lip-1) to alleviate the increased ferroptosis following THEM6 overexpression under carboplatin treatment. The cell viability assay indicated that the ferroptosis inhibitors could reverse the decreased cell viability caused by THEM6 overexpression (Fig. 4A). The colony formation assay demonstrated similar results, showing that treatment with Fer-1 or Lip-1 significantly reversed the colony formation ability in TNBC cells (Fig. 4B-C). Additionally, treatment with ferroptosis inhibitors reversed the protein levels of ferroptosis regulators affected by THEM6 overexpression (Fig. 4D). Live and dead staining demonstrated that ferroptosis inhibitors reversed the increased dead/live ratio following THEM6 overexpression in carboplatin-treated TNBC cells (Fig. 4E-F). Moreover, in THEM6 stable overexpression TNBC cells, treatment with Fer-1 or Lip-1 restored the elevated levels of iron (Fig. 4G), MDA (Fig. 4H) and ROS (Fig. 4I-J) following carboplatin treatment. These results indicate that THEM6 plays an essential role in regulating ferroptosis in TNBC cells.

Fig. 4.

Fig. 4

Ferroptosis inhibitors reversed the effects of THEM6 in triple-negative breast cancer cells. (A) Cell viability of TNBC cells with stable THEM6 overexpression or control was assessed after treatment with 5 µM carboplatin for 48 h, followed by ferroptosis inhibitors (1 µM Fer-1 and 0.2 µM Lip-1) for 6 h. (B-C) The colony formation ability was evaluated using a colony formation assay for each group. (D) Protein levels of ferroptosis regulators (GPX4, SLC7A11, and ACSL4) were analyzed using Western blot. (E-F) The dead/live ratio in each group was assessed using Calcein AM/PI staining. (G) Relative iron levels were analyzed using an Iron Assay Kit. (H) MDA levels were assessed using a Lipid Peroxidation Assay Kit. (I-J) ROS intensity was measured using the fluorescent probe 2′,7′-DCFH-DA. The p-values are as follows: ** indicates p < 0.01

THEM6 inhibit K48-linked ubiquitination of FDFT1

To identify the downstream proteins of THEM6, we performed an overlap analysis between ferroptosis-related genes and differentially expressed proteins following THEM6 overexpression (Fig. 5A). In BT-549 cells, four differentially expressed proteins were identified, with FDFT1 being the only protein upregulated in both MDA-MB-231 and BT-549 cells (Fig. 5B). In TNBC cells, THEM6 overexpression did not significantly alter the mRNA levels of FDFT1 (Fig. 5C). However, it significantly increased the protein levels of FDFT1, both with and without carboplatin treatment (Fig. 5D). CHX assays demonstrated that THEM6 overexpression increased the half-life of FDFT1 in TNBC cells (Fig. 5E-F). Further, an endogenous ubiquitination assay revealed that THEM6 overexpression reduced the total ubiquitination levels of FDFT1 in HEK293T cells (Fig. 5G). Additionally, THEM6 overexpression inhibited K48-linked ubiquitination of FDFT1 (Fig. 5H), but did not affect K63-linked ubiquitination (Fig. 5I). To validate whether THEM6 regulates the stability of FDFT1 through inhibition of K48-linked ubiquitination under chemotherapeutic conditions, we performed ubiquitination assays in TNBC cell lines treated with carboplatin. As shown in Supplementary Fig. 3, THEM6 overexpression significantly decreased the K48-linked ubiquitination levels of FDFT1 following carboplatin treatment, compared to control cells. These results suggest that THEM6 stabilizes FDFT1 by inhibiting its K48-linked ubiquitination, likely contributing to ferroptosis regulation in TNBC cells.

Fig. 5.

Fig. 5

THEM6 Inhibits K48-Linked Ubiquitination and Upregulates FDFT1. (A) Differentially expressed proteins following THEM6 overexpression were intersected with known ferroptosis-related genes. (B) Heatmap depicting the expression of ferroptosis-related proteins in response to THEM6 overexpression. (C) mRNA expression levels of FDFT1 and THEM6 were analyzed by RT-PCR. (D) Protein expression levels of FDFT1 and THEM6 were assessed by Western blot. (E) The protein half-life of FDFT1 and THEM6 was determined using a cycloheximide (CHX) chase assay. (F) Statistical analysis of the CHX chase assay results. (G–I) HEK293T cells were transfected with the indicated plasmids and treated with 10 µM MG-132 for 6 h prior to harvest. Total ubiquitination (G), K48-linked ubiquitination (H), and K63-linked ubiquitination (I) levels were analyzed by ubiquitination assays. The p-values are as follows: **p < 0.01; ns, not significant

THEM6 induced ferroptosis through FDFT1

To investigate whether THEM6 induces FDFT1-mediated ferroptosis, we knocked down FDFT1 in TNBC cells with stable THEM6 overexpression, followed by carboplatin treatment (Fig. 6A). The viability of TNBC cells was significantly reduced after THEM6 overexpression, but this effect was reversed by FDFT1 knockdown (Fig. 6B). Similarly, colony formation assays showed that the diminished colony-forming ability induced by THEM6 overexpression was restored by FDFT1 knockdown (Fig. 6C-D and Supplementary Fig. 4). Moreover, in TNBC cells with stable THEM6 overexpression, FDFT1 knockdown effectively restored the elevated levels of iron (Fig. 6E), MDA (Fig. 6F), and ROS (Fig. 6G-H) induced by carboplatin treatment. Additionally, FDFT1 knockdown reversed the alterations in the protein levels of ferroptosis regulators (GPX4, SLC7A11, and ACSL4) that were influenced by THEM6 overexpression (Fig. 6I). These results suggest that THEM6 induces ferroptosis through FDFT1, highlighting its potential as a key mediator in regulating carboplatin sensitivity in TNBC cells.

Fig. 6.

Fig. 6

THEM6 Upregulates FDFT1 to Mediate Ferroptosis in TNBC Cells. (A) THEM6 was overexpressed and FDFT1 was knocked down in TNBC cells with 5 µM carboplatin. Protein levels of FDFT1 and THEM6 were analyzed by Western blot. (B) Cell viability of TNBC cells in the indicated groups was assessed after treatment with 5 µM carboplatin for 48 h. (C-D) Colony formation ability was evaluated using a colony formation assay. (E) Relative iron levels were measured using an Iron Assay Kit. (F) MDA levels were assessed using a Lipid Peroxidation Assay Kit. (G-H) ROS) intensity was measured using the fluorescent probe 2′,7′- DCFH-DA. (I) Protein expression levels of THEM6, FDFT1, and ferroptosis-related regulators (GPX4, SLC7A11, and ACSL4) were analyzed by Western blot. The p-values are as follows: **p < 0.01

Discussion

In breast cancer, neoadjuvant treatment primarily aims to shrink unresectable tumors, enabling surgical intervention [17]. For operable tumors, it promotes breast conservation and reduces the need for mastectomy. Carboplatin has been shown to enhance disease-free survival (DFS) and overall survival in TNBC when included in (neo)adjuvant chemotherapy, resulting in a 40% improvement in DFS [18]. However, the management of TNBC remains challenging due to chemotherapy resistance, with many patients relapsing within five years [19]. Our research indicates that THEM6 may be a promising molecular target for improving outcomes in neoadjuvant chemotherapy for triple-negative breast cancer (TNBC). Further validation through in vivo and in vitro experiments showed that THEM6 modulates carboplatin sensitivity by mediating ferroptosis regulated by FDFT1.

Our findings showed the critical role of THEM6 in modulating carboplatin sensitivity in TNBC. However, elevated THEM6 expression has previously been associated with tumor progression. In breast cancer cells, THEM6 is expressed at higher levels than in adjacent noncancerous tissues, contributing to oncogenic processes [10]. This apparent inconsistency may reflect a context-dependent role of THEM6, whereby its function varies under different cellular states or therapeutic pressures. Notably, emerging evidence indicates that THEM6 may regulate macrophage recruitment, CD8⁺ T cell infiltration, and immune cell polarization within the tumor microenvironment, thereby reshaping the immune landscape [10, 20]. Consistently, our GSEA analysis of the S and NS groups revealed that pathways related to immune system development and immune response are potentially associated with carboplatin sensitivity. Moreover, ferroptosis-induced release of damage-associated molecular patterns (DAMPs) may further modulate immune cell behavior, contributing to differential chemosensitivity [21]. The involvement of THEM6 in both tumor progression and therapeutic response highlights its multifaceted role in tumor biology and warrants further investigation, particularly in relation to its interaction with the immune microenvironment and ferroptosis-related pathways.

The THEM family regulates intracellular fatty acid (FA) trafficking and influences FA production and β-oxidation based on physiological context [22]. THEM6 is a 208-amino-acid protein within this family, predicted to contain a transmembrane domain in its. While THEM6 is crucial for inducing the endoplasmic reticulum stress response, its precise function is still not fully understood [12, 23, 24]. In the context of androgen deprivation therapy (ADT), THEM6 plays a critical role by supporting the rewiring of lipid metabolism and sustaining endoplasmic reticulum stress response (UPR) activation, which can lead to ADT resistance [12]. Our study is the first to demonstrate that THEM6 is essential for maintaining sensitivity to carboplatin through the regulation of ferroptosis. Previous research has shown that the ferroptosis-related targets SLC7A11 and GPX4 are overexpressed in carboplatin-resistant retinoblastoma cells. This overexpression suggests that various ferroptosis inducers may effectively eliminate drug-resistant retinoblastoma cells, while necroptosis inducers do not have the same efficacy [25]. Furthermore, inducing ferroptosis presents a novel strategy to enhance chemosensitivity or immunotherapy response in cancer patients [26, 27]. The expression levels of ferroptosis-related genes, such as ACSL4 and GPX4, could serve as valuable predictive and prognostic biomarkers [28]. Collectively, our findings position THEM6 as a promising candidate for the development of targeted chemotherapy strategies involving carboplatin.

Downregulation of FDFT1, a tumor suppressor that negatively regulates the AKT/mTOR/HIF1α signaling pathway, is associated with malignant progression and poor prognosis in colorectal cancer [29]. FDFT1 has been identified as a potential marker associated with ferroptosis in renal cell carcinoma, where its upregulation inhibits cell proliferation, migration, and invasion, potentially through the AKT signaling pathway [30]. Additionally, FDFT1 plays a critical role in ferroptosis regulation in non-small cell lung cancer (NSCLC), with benzo(a)pyrene-induced ferroptosis dependent on its expression [31]. 3β-hydroxy-12-oleanen-27-oic acid significantly inhibited the growth of colon carcinoma xenografts and modulated FDFT1 expression in tumor tissues, accompanied by changes in biomarkers of autophagy, cell cycle, apoptosis, and ferroptosis [32]. The ubiquitination of FDFT1 has been minimally explored, with few studies reporting on its potential regulation through this post-translational modification. FDFT1 is a substrate of the deubiquitinase USP32, which removes ubiquitin from FDFT1, thereby stabilizing its expression. USP32-mediated regulation of FDFT1 promotes cell proliferation and stemness in epithelial ovarian cancer [33]. Notably, our findings reveal that THEM6 modulate the ubiquitination of FDFT1, establishing the THEM6-FDFT1 axis as a crucial regulator of carboplatin sensitivity and a promising therapeutic target.

Conclusions

In conclusion, our study is the first to suggest that THEM6 expression may serve as a novel target and prognostic biomarker for carboplatin neoadjuvant chemotherapy in breast cancer patients. It reveals a novel function of THEM6 in cancer chemotherapy, potentially aiding in the identification of candidate responders and the formulation of chemotherapy strategies. However, whether THEM6 plays a similar role in other platinum-based drugs, such as cisplatin, or other alkylating agents remains to be elucidated. Given the critical role of ferroptosis in chemosensitivity, further basic research is needed to clarify this relationship. Moreover, a limitation of our study is that the role of THEM6 in ferroptosis was mainly assessed using overexpression models and ferroptosis inhibitors. To comprehensively understand the function of endogenous THEM6, loss-of-function studies, including gene knockdown or knockout approaches, are essential. In addition, while we demonstrated that THEM6 stabilizes FDFT1 by inhibiting its K48-linked ubiquitination, other regulatory mechanisms remain to be elucidated. Our data show that THEM6 does not significantly alter FDFT1 mRNA expression, indicating limited involvement in transcriptional regulation. However, whether THEM6 influences FDFT1 stability through modulation of protein-protein interactions, such as affecting its binding to E3 ligases (e.g., HERC2) [34] or deubiquitinases (e.g., USP32) [35], has yet to be explored and represents an important direction for future research.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1 (598.5KB, docx)

Acknowledgements

Not applicable.

Author contributions

YX Zeng generated the experimental data and drafted the manuscript. QL Yi, J H and ZJ Xu provided pathological assessment of tissues. X Chen, JY Wang and ZH Du were involved in sample preparation and xenograft experiments. YL Yan and J Tian conceived the study, interpreted the results, and revised the manuscript.

Funding

This study was supported by grants from the National Natural Sciences Foundation of China (82473299), Natural Science Foundation of Hunan Province (2024JJ2092, 2024JJ9133).

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethical approval and consent to participate

The study protocol and tissue specimen acquisition were approved by the Ethical Review Committee of Xiangya Hospital. Xenograft Mouse Model were conducted with approval from the Animal Care and Use Committee of Central South University (China).

Consent for publication

All authors have read and approved the final manuscript.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Jian Tian, Email: jian_tian@csu.edu.cn.

Yuanliang Yan, Email: yanyuanliang@csu.edu.cn.

References

  • 1.Yin L, Duan JJ, Bian XW, Yu SC. Triple-negative breast cancer molecular subtyping and treatment progress. Breast Cancer Res. 2020;22(1):61. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Li Y, Zhang H, Merkher Y, Chen L, Liu N, Leonov S, Chen Y. Recent advances in therapeutic strategies for triple-negative breast cancer. J Hematol Oncol. 2022;15(1):121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Garrido-Castro AC, Lin NU, Polyak K. Insights into molecular classifications of Triple-Negative breast cancer: improving patient selection for treatment. Cancer Discov. 2019;9(2):176–98. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Korde LA, Somerfield MR, Carey LA, Crews JR, Denduluri N, Hwang ES, Khan SA, Loibl S, Morris EA, Perez A, et al. Neoadjuvant chemotherapy, endocrine therapy, and targeted therapy for breast cancer: ASCO guideline. J Clin Oncol. 2021;39(13):1485–505. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.da Costa Miranda V, de Souza Fede AB, Dos Anjos CH, da Silva JR, Sanchez FB, da Silva Bessa LR, de Paula Carvalho J, Filho EA, de Freitas D. Del Pilar Estevez diz M: neoadjuvant chemotherapy with six cycles of carboplatin and Paclitaxel in advanced ovarian cancer patients unsuitable for primary surgery: safety and effectiveness. Gynecol Oncol. 2014;132(2):287–91. [DOI] [PubMed] [Google Scholar]
  • 6.Singh RB, Chander S, Mohanti BK, Pathy S, Kumar S, Bhatla N, Thulkar S, Vishnubhatla S, Kumar L. Neoadjuvant chemotherapy with weekly Paclitaxel and carboplatin followed by chemoradiation in locally advanced cervical carcinoma: a pilot study. Gynecol Oncol. 2013;129(1):124–8. [DOI] [PubMed] [Google Scholar]
  • 7.Schmid P, Cortes J, Pusztai L, McArthur H, Kummel S, Bergh J, Denkert C, Park YH, Hui R, Harbeck N, et al. Pembrolizumab for early Triple-Negative breast Cancer. N Engl J Med. 2020;382(9):810–21. [DOI] [PubMed] [Google Scholar]
  • 8.Xiong X, Zheng LW, Ding Y, Chen YF, Cai YW, Wang LP, Huang L, Liu CC, Shao ZM, Yu KD. Breast cancer: pathogenesis and treatments. Signal Transduct Target Ther. 2025;10(1):49. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Zhao X, Hu J, Li J, Gu L, Chen J, Othmane B, Gong G, Yuan J, Deng H. THEM6: A novel molecular biomarker predicts tumor microenvironment, molecular subtype, and prognosis in bladder Cancer. Dis Markers. 2022;2022:7147279. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Lu X, Chen W, Tian G, Ge F. THEM6 is a prognostic biomarker for breast cancer and is associated with immune infiltration. Sci Rep. 2023;13(1):21974. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Hu J, Rao W, Chen F, Zhou X, Wang J, Lin L, Fan G. The altered lipid composition and key lipid metabolic enzymes in Thiacloprid-Resistant Myzus persicae, with special attention paid to the function of MpTHEM6a. Int J Mol Sci 2024, 25(22). [DOI] [PMC free article] [PubMed]
  • 12.Blomme A, Peter C, Mui E, Rodriguez Blanco G, An N, Mason LM, Jamieson LE, McGregor GH, Lilla S, Ntala C, et al. THEM6-mediated reprogramming of lipid metabolism supports treatment resistance in prostate cancer. EMBO Mol Med. 2022;14(3):e14764. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Gyorffy B. Survival analysis across the entire transcriptome identifies biomarkers with the highest prognostic power in breast cancer. Comput Struct Biotechnol J. 2021;19:4101–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Yan Y, Zhou S, Chen X, Yi Q, Feng S, Zhao Z, Liu Y, Liang Q, Xu Z, Li Z, et al. Suppression of ITPKB degradation by Trim25 confers TMZ resistance in glioblastoma through ROS homeostasis. Signal Transduct Target Ther. 2024;9(1):58. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Otasevic V, Vucetic M, Grigorov I, Martinovic V, Stancic A. Ferroptosis in Different Pathological Contexts Seen through the Eyes of Mitochondria. Oxid Med Cell Longev 2021, 2021:5537330. [DOI] [PMC free article] [PubMed]
  • 16.Li D, Li Y. The interaction between ferroptosis and lipid metabolism in cancer. Signal Transduct Target Ther. 2020;5(1):108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Pradeep Prabhu P, Mohanty B, Lobo CL, Balusamy SR, Shetty A, Perumalsamy H, Mahadev M, Mijakovic I, Dubey A, Singh P. Harnessing the nutriceutics in early-stage breast cancer: mechanisms, combinational therapy, and drug delivery. J Nanobiotechnol. 2024;22(1):574. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Pathak N, Sharma A, Elavarasi A, Sankar J, Deo SVS, Sharma DN, Mathur S, Kumar S, Prasad CP, Kumar A, et al. Moment of truth-adding carboplatin to neoadjuvant/adjuvant chemotherapy in triple negative breast cancer improves overall survival: an individual participant data and trial-level Meta-analysis. Breast. 2022;64:7–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Ademuyiwa FO, Gao F, Street CR, Chen I, Northfelt DW, Wesolowski R, Arora M, Brufsky A, Dees EC, Santa-Maria CA, et al. A randomized phase 2 study of neoadjuvant carboplatin and Paclitaxel with or without Atezolizumab in triple negative breast cancer (TNBC) - NCI 10013. NPJ Breast Cancer. 2022;8(1):134. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Song XQ, Shao ZM. Identification of immune-related prognostic biomarkers in triple-negative breast cancer. Transl Cancer Res. 2024;13(4):1707–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Zeng L, Yang K, Yu G, Hao W, Zhu X, Ge A, Chen J, Sun L. Advances in research on immunocyte iron metabolism, ferroptosis, and their regulatory roles in autoimmune and autoinflammatory diseases. Cell Death Dis. 2024;15(7):481. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Furuhashi M, Hotamisligil GS. Fatty acid-binding proteins: role in metabolic diseases and potential as drug targets. Nat Rev Drug Discov. 2008;7(6):489–503. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Wang M, Kaufman RJ. The impact of the Endoplasmic reticulum protein-folding environment on cancer development. Nat Rev Cancer. 2014;14(9):581–97. [DOI] [PubMed] [Google Scholar]
  • 24.Tillander V, Alexson SEH, Cohen DE. Deactivating fatty acids: Acyl-CoA Thioesterase-Mediated control of lipid metabolism. Trends Endocrinol Metab. 2017;28(7):473–84. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Liu K, Huang J, Liu J, Klionsky DJ, Kang R, Tang D. Induction of autophagy-dependent ferroptosis to eliminate drug-tolerant human retinoblastoma cells. Cell Death Dis. 2022;13(6):521. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Meng Y, Sun HY, He Y, Zhou Q, Liu YH, Su H, Yin MZ, Zeng FR, Chen X, Deng GT. BET inhibitors potentiate melanoma ferroptosis and immunotherapy through AKR1C2 Inhibition. Mil Med Res. 2023;10(1):61. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Jia KW, Yao RQ, Fan YW, Zhang DJ, Zhou Y, Wang MJ, Zhang LY, Dong Y, Li ZX, Wang SY, et al. Interferon-alpha stimulates DExH-box helicase 58 to prevent hepatocyte ferroptosis. Mil Med Res. 2024;11(1):22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Sha R, Xu Y, Yuan C, Sheng X, Wu Z, Peng J, Wang Y, Lin Y, Zhou L, Xu S, et al. Predictive and prognostic impact of ferroptosis-related genes ACSL4 and GPX4 on breast cancer treated with neoadjuvant chemotherapy. EBioMedicine. 2021;71:103560. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Weng ML, Chen WK, Chen XY, Lu H, Sun ZR, Yu Q, Sun PF, Xu YJ, Zhu MM, Jiang N, et al. Fasting inhibits aerobic Glycolysis and proliferation in colorectal cancer via the Fdft1-mediated AKT/mTOR/HIF1alpha pathway suppression. Nat Commun. 2020;11(1):1869. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 30.Huang R, Zhang C, Wang X, Zou X, Xiang Z, Wang Z, Gui B, Lin T, Hu H. Identification of FDFT1 as a potential biomarker associated with ferroptosis in CcRCC. Cancer Med. 2022;11(21):3993–4004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Wen MG, Zheng HX, Zhao YZ, Xia P. Distinct roles and molecular mechanisms of nicotine and benzo(a)pyrene in ferroptosis of lung adenocarcinoma and lung squamous cell carcinoma. Tob Induc Dis 2024, 22. [DOI] [PMC free article] [PubMed]
  • 32.Tu J, Meng X, Wang J, Han Z, Yu Z, Sun H. 3beta-Hydroxy-12-oleanen-27-oic Acid Exerts an Antiproliferative Effect on Human Colon Carcinoma HCT116 Cells via Targeting FDFT1. Int J Mol Sci 2023, 24(19). [DOI] [PMC free article] [PubMed]
  • 33.Nakae A, Kodama M, Okamoto T, Tokunaga M, Shimura H, Hashimoto K, Sawada K, Kodama T, Copeland NG, Jenkins NA, et al. Ubiquitin specific peptidase 32 acts as an oncogene in epithelial ovarian cancer by deubiquitylating farnesyl-diphosphate farnesyltransferase 1. Biochem Biophys Res Commun. 2021;552:120–7. [DOI] [PubMed] [Google Scholar]
  • 34.Galligan JT, Martinez-Noel G, Arndt V, Hayes S, Chittenden TW, Harper JW, Howley PM. Proteomic analysis and identification of cellular interactors of the giant ubiquitin ligase HERC2. J Proteome Res. 2015;14(2):953–66. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Li S, Song Y, Wang K, Liu G, Dong X, Yang F, Chen G, Cao C, Zhang H, Wang M, et al. USP32 deubiquitinase: cellular functions, regulatory mechanisms, and potential as a cancer therapy target. Cell Death Discov. 2023;9(1):338. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 1 (598.5KB, docx)

Data Availability Statement

No datasets were generated or analysed during the current study.


Articles from Breast Cancer Research : BCR are provided here courtesy of BMC

RESOURCES