Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2025 Jul 8.
Published in final edited form as: Differentiation. 2025 Jun 23;144:100883. doi: 10.1016/j.diff.2025.100883

Characterization of Pumilio gene expression during early neural crest development

Mariann Guzman-Espinoza 1,2,*, Helen M Vander Wende 1,2,*, Jessica L Pacheco 1,2,3, Alejandra Olano Roldán 1,2, Erica J Hutchins 1,2,3
PMCID: PMC12236992  NIHMSID: NIHMS2094525  PMID: 40580645

Abstract

Neural crest cells are multipotent cells present in vertebrate embryos that give rise to a wide array of cell types and tissues. A growing number of studies have identified post-transcriptional regulatory events that are essential for multiple stages of neural crest development, though a thorough characterization of the post-transcriptional regulators controlling these events is currently lacking. From single cell RNA-sequencing data, we identified members of the Pumilio family of RNA-binding proteins, PUM1 and PUM2, as candidate post-transcriptional regulators of neural crest development. Using hybridization chain reaction (HCR) in avian embryos (Gallus gallus), we characterized the spatiotemporal expression of Pumilio family mRNAs during early stages of cranial neural crest development. We show that Pum1 and Pum2, though expressed throughout the three germ layers, were enriched in ectodermally-derived tissues, and following neurulation, Pum1 and Pum2 show distinct expression patterns. We observed that Pum1 displayed a more uniform expression throughout the neural tube and neural crest during neural crest specification and the epithelial-mesenchymal transition (EMT). In contrast, Pum2 was enriched in neural crest cells poised to undergo EMT. We thus hypothesize that PUM1 and PUM2, often speculated to be functionally redundant, may play distinct roles at key steps of neural crest development.

Keywords: Neural crest, Morphogenesis, RNA-binding proteins, Chick, Pumilio

1. INTRODUCTION

The neural crest is a transient and multipotent stem cell population present during early vertebrate development that differentiates into many important derivatives, e.g. the craniofacial skeleton, enteric and peripheral nervous systems, melanocytes, and more (D’Amico-Martel and Noden, 1983; Hutchins et al., 2018; Le Douarin and Kalcheim, 1999; Mendez-Maldonado et al., 2020; Santagati and Rijli, 2003; Trainor, 2010). To generate this myriad of cell types throughout the vertebrate body, a tightly regulated sequence of cell induction, specification, epithelial-mesenchymal transition (EMT), and migration must take place prior to differentiation. Detailed mapping of gene regulatory networks (GRNs) has shed light on the transcriptional switches that orchestrate the progression of neural crest development (Martik and Bronner, 2017; Sauka-Spengler and Bronner-Fraser, 2008; Simões-Costa and Bronner, 2015; Williams et al., 2019).

Building upon our understanding of transcriptional gene regulation, studies are now increasingly showing that post-transcriptional regulatory events are also essential for neural crest development (Antonaci and Wheeler, 2022; Avellino et al., 2013; Bhattacharya et al., 2018; Cibi et al., 2019; Copeland and Simoes-Costa, 2020; Forman et al., 2021; Hutchins et al., 2022; Perfetto et al., 2021; Sanchez-Vasquez et al., 2019; Ward et al., 2018; Weiner, 2018), though the majority have focused on microRNAs and microRNA-mediated tuning of the neural crest GRNs (Guzman-Espinoza et al., 2024). Much less is currently known about the roles RNA-binding proteins play during neural crest development, and a thorough characterization of these post-transcriptional regulators is still lacking.

From single cell RNA-sequencing (scRNA-seq) data, we recently identified members of the Pumilio family of RNA-binding proteins, PUM1 and PUM2, as candidate post-transcriptional regulators of neural crest development (Hutchins et al., 2022). Pumilio proteins belong to the PUF family, a group of eukaryotic RNA-binding proteins that play roles in post-transcriptional regulation, primarily by inhibiting translation and promoting mRNA degradation (Goldstrohm et al., 2018; Nishanth and Simon, 2020; Van Etten et al., 2012). Pumilio proteins contain a conserved RNA-binding domain (Pumilio homology domain (Pum HD)) that directly binds to sequences known as Pumilio Response Elements (PREs; 5′-UGUANAUA-3′) (Bohn et al., 2018; Wang et al., 2018; White et al., 2001). Vertebrates express two canonical Pumilio paralogs, Pum1 and Pum2, which are encoded within separate genomic loci; though less conserved outside of the RNA-binding domain, the Pum HD exhibits a high degree of sequence identity between paralogs (Fig. 1A). PUM1 and PUM2 (both the full-length proteins and their respective Pum HDs) are also highly conserved across diverse vertebrate lineages, particularly among amniotes (Fig. 1B–C). Because PUM1 and PUM2 bind to the same PRE sequence, they are often assumed to have redundant functions (Bohn et al., 2018; Goldstrohm et al., 2018). However, from parsing publicly available scRNA-seq data of neural crest cells (Williams et al., 2019), we previously found that Pum2 may be upregulated in migratory versus premigratory cells whereas Pum1 expression may be more similar across premigratory/migratory neural crest (Hutchins et al., 2022), suggesting there could possibly be differing functions for PUM1 and PUM2 in neural crest.

Figure 1. PUM proteins are highly conserved and expressed broadly within the chick embryo during early neural crest development.

Figure 1.

Open in a new tab

(A) Schematic of Gallus PUM1 and PUM2 protein domains. The Pumilio homology domain (Pum HD), which binds the Pumilio Response Element (PRE) sequence (5′-UGUANAUA-3′) in RNA, is 92.1% identical between these paralogs. (B-C) Percent identity matrices for the full-length protein and Pum HD RNA-binding domain of PUM1 and PUM2 among several vertebrate model systems. (D) Relative quantitation of reverse transcription-quantitative polymerase chain reaction (RT-qPCR) data obtained from whole wild-type chick embryos spanning stages HH5–10. The ΔCT of transcripts for Pax7 (yellow), Tfap2b (green), Pum1 (cyan), and Pum2 (magenta) were calculated relative to the ΔCT of Pax7 HH5–6. Solid lines indicate mean ΔCT, dotted lines indicate SEM (n=3 biological replicates per stage).

Here, we examined the spatiotemporal expression of Pum1 and Pum2 during early cranial neural crest development in HH5-HH13 embryos using Hybridization Chain Reaction (HCR) (Choi et al., 2018). Using this approach, we identified several stages between gastrulation and neural crest migration during which Pumilio mRNAs exhibited strong enrichment in the ectoderm and developing neural tube and neural crest. Though Pum1 and Pum2 expression largely overlapped at early stages of neural plate border induction and neural crest specification, as neural crest began to undergo EMT and delaminate from the neural tube, patterns of differential enrichment emerged. Our findings suggest that PUM1 and PUM2 may play important but separable roles during early cranial neural crest development.

2. METHODS

2.1. Model organism

Fertilized chicken eggs (Gallus gallus, Rhode Island Red breed) were purchased from Petaluma Farms (Petaluma, CA) and incubated in a humidified GQF incubator at 100°F to the desired Hamburger-Hamilton (HH) stage (Hamburger and Hamilton, 1951).

2.2. Multiple Sequence Alignments

Multiple sequence alignments were performed using Clustal Omega (Sievers and Higgins, 2018; Sievers et al., 2011) via the EMBL-EBI Job Dispatcher sequence analysis tools framework (https://www.ebi.ac.uk/jdispatcher) (Madeira et al., 2024). Percent identity matrices were calculated by Clustal Omega using Ensembl protein sequences for PUM1 (human, ENST00000426105.7; mouse, ENSMUST00000030315.13; chick, ENSGALT00010032391.1; frog, ENSXETT00000066811.2; zebrafish, ENSDART00000168263.2) and PUM2 (human, ENST00000361078.7; mouse, ENSMUST00000168361.8; chick, ENSGALT00010019164.1; frog, ENSXETT00000103921.2; zebrafish, ENSDART00000086578.6). Amino acid regions encompassing the Pumilio homology domain (Pum HD) were determined from the Ensembl protein summary using the Pumilio homology domain PROSITE profile (accession: PS50303; (Sigrist et al., 2013)), which defined the amino acid positions.

2.3. Reverse transcription-quantitative PCR (RT-qPCR)

Wild-type embryos were dissected into DEPC-treated PBS, pH 7.4 and all extra-embryonic tissue was removed. Total RNA was extracted using the RNAqueous-Micro Kit (Life Technologies), according to manufacturer instructions. Embryos (n=3 per biological replicate) were lysed in 100 μL of lysis solution and treated with DNaseI following column purification. RNA (2.5 μg) was reverse transcribed into cDNA using SuperScriptIII Reverse Transcriptase (Invitrogen) with oligo dT priming. Real time qPCR was then performed on cDNA (diluted 1:10) using a QuantStudio 6 Flex (Applied Biosystems/Thermo) and FastStart Universal SYBR Green Master Mix (Roche) using gene-specific primers (Table 1). RT-qPCR was performed on three biological replicates, and CT values were determined for three technical replicates per biological replicate and normalized to 18S. Statistical analyses (Mann-Whitney tests) were performed with Prism 10 (GraphPad).

Table 1.

List of RT-qPCR primer sequences.

Primer Primer sequence (5′−3′)
18S Forward CCATGATTAAGAGGGACGGC
18S Reverse TGGCAAATGCTTTCGCTTT
Pax7 Forward CAAACCAACTCGCAGCATTC
Pax7 Reverse CTGCCTCCATCTTGGGAAAT
Tfap2b Forward GACTCACTTCAGCCTCATCAC
Tfap2b Reverse GAACATCTTGTCCATGCCTTTG
Pum1 Forward GCAGGATCAGTATGGGAACTATG
Pum1 Reverse CGAGCACGTTGCCTCTAAT
Pum2 Forward GGTCCTCACAGTGCCTTATAC
Pum2 Reverse TGAGCAGGTTCAGCCATATC
Open in a new tab

2.4. Hybridization chain reaction (HCR)

Hybridization chain reaction (HCR) v3.0 was performed according to manufacturer protocol (Molecular Instruments), with minor modifications as described (Hutchins et al., 2022). Wild-type embryos were dissected into chilled DEPC-treated PBS, pH 7.4 and fixed in 4% paraformaldehyde/PBS for one hour at room temperature. Custom HCR v3.0 probes and hairpins (488/546/647) were designed by and ordered through Molecular Instruments (Choi et al., 2018). We confirmed with Molecular Instruments that the proprietary probe sets designed to target each transcript were specific to either Pum1 or Pum2 and unlikely to cross-react.

2.5. Cryosectioning

Following HCR processing and whole mount imaging, embryos were washed several times in 5% sucrose in PBS at room temperature then incubated in 15% sucrose in PBS overnight at 4°C. Embryos were then incubated in 7.5% gelatin overnight at 37°C, placed into embedding molds, flash-frozen in liquid nitrogen, and stored at −80°C until sectioning. Embryos were transversely sectioned on a Microm HM525NX cryostat at 20 μm thickness. Following sectioning, slides were placed in a coplin jar with PBS, pH 7.4 for 15 minutes in a 42°C water bath to remove gelatin. Before mounting coverslips with Fluoromount-G (SouthernBiotech), sections were stained with DAPI (4′,6-diamidino-2-phenylindole) at [14.3 μM] final concentration.

2.6. Image acquisition and quantification

Whole mount display images were taken on an inverted Zeiss LSM900 Airyscan 2 (EC Plan-Neofluar 5x/0.16 WD 18.5 objective lens) or an inverted Leica STELLARIS 5 (HC PL APO 10x/0.40 CS2 objective lens). Whole mount embryos for documentation (n≥3 per stage) were also imaged on an upright Nikon AZ100M (AZ Plan APO 4X NA 0.4 WD 20 objective lens). Cross sections were imaged on a Zeiss LSM900 Airyscan 2 (EC Plan-Neofluar 10x/0.30 WD 5.2 or Plan-Apochromat 20x/0.8 M27 objective lens) or a Leica STELLARIS 5 (HC PL APO 20x/0.75 CS2 objective lens). Images were minimally adjusted for brightness and contrast and pseudocolored using Fiji and Adobe Photoshop. All HCR section images used for quantification were acquired with the same gain and exposure conditions. For quantification, maximum intensity projections were generated from raw Z-stacks in Fiji. Pum1 or Pum2 integrated density was measured within circular ROIs (diameter = 20 μm) traced around premigratory neural crest (pNC), migratory neural crest (mNC; included neural crest delaminated from the neural tube neuroepithelium and those actively migrating, depending on the stage examined), medial portions of the neural tube (NT), and head mesenchyme (Mes) (Supplemental Fig. S1). Integrated density values for each region were measured from two areas of each section then averaged. Average integrated densities were measured from three non-adjacent sections of each embryo analyzed (n = 3 for each stage for Pum1 and Pum2). Premigratory neural crest ROIs were not measured for HH13, as the dorsal neural tube was largely devoid of neural crest marker expression at this stage. Neural tube average integrated density values were used for normalization for all stages measured. Statistical analyses (normality tests and two-way ANOVAs with multiple comparisons) were performed with Prism 10 (GraphPad).

3. RESULTS AND DISCUSSION

3.1. Pumilio transcripts are broadly expressed during key stages of early neural crest development

Single cell RNA-sequencing (scRNA-seq) of chick (Gallus gallus) embryos from Hamburger Hamilton (HH) stages 5–7 revealed that many RNA-binding proteins are enriched within subpopulations of neural plate/tube cells, a population that includes the presumptive neural crest (Williams et al., 2022; Supplemental Fig. S2). We previously identified the Pumilio family transcripts Pum1 and Pum2 as post-transcriptional regulators with dynamic expression patterns in premigratory and migratory neural crest cells (Williams et al., 2019; Hutchins et al., 2022). To explore Pum1 and Pum2 expression during neural plate border specification (HH5-HH7) (Williams et al., 2022), and cranial neural crest cell specification (HH8), EMT (HH9), and early migration (HH10) (Monroy et al., 2022), we performed reverse transcription-quantitative PCR (RT-qPCR) using cDNA prepared from whole chick embryos spanning HH5-HH10. Unlike the neural crest cell markers Pax7 and Tfap2b, which both show increasing expression from HH5–6 to HH9, Pum1 and Pum2 are both more highly expressed throughout these developmental stages, with similar relative expression levels across all stages examined (Fig. 1D; p ≥ 0.4, Mann-Whitney tests comparing Pum1 and Pum2). These data suggest that Pum1 and Pum2 may be active throughout early cranial neural crest formation.

3.2. Pumilio transcripts are enriched within the ectoderm during gastrulation and neurulation

To survey the spatiotemporal expression of Pumilio family transcripts during early neural crest development, we performed hybridization chain reaction (HCR) to probe for Pum1 and Pum2 mRNA in wild-type chick embryos. To track developing neural crest, we simultaneously probed for Pax7, which is an early marker of the neural plate border that is expressed in presumptive and specified neural crest throughout the stages we examined (Basch et al., 2006; Williams et al., 2022). At the gastrula stage (HH5), we found that Pum1 and Pum2 were broadly expressed throughout the three germ layers, with relative enrichment of both transcripts in the ectoderm (Fig. 2A–B). This ectodermal enrichment appeared more pronounced at HH6, when the neural plate begins to invaginate and the neural plate borders begin to elevate (Fig 2C–D). As neurulation proceeds and the neural tube begins to close (HH7), Pum1 and Pum2 remain broadly and often co-expressed throughout the ectoderm, without significant differences in relative expression levels between the neural plate, neural plate border, and non-neural ectoderm (Fig. 3A–B, Supplemental Fig. S3). This broad ectodermal expression of Pum1 and Pum2 persisted through HH8 (Fig. 3C–D) as the dorsal neural folds became more closely apposed, coinciding with the onset of neural crest specifier gene expression (Khudyakov and Bronner-Fraser, 2009; Sauka-Spengler and Bronner-Fraser, 2008).

Figure 2. Pumilio transcripts are ectodermally enriched in early avian embryos.

Figure 2.

Open in a new tab

(A-D) Representative confocal maximum intensity projection micrographs of HH5 (A-B; n=3) and HH6 (C-D; n=3) stage wild-type chick embryos, in whole mount (A, C) and cross-section (B, D). Transcripts for Pax7 (yellow), Pum1 (cyan), and Pum2 (magenta) were visualized with hybridization chain reaction (HCR). Nuclei were labeled with DAPI (blue). Dashed white line indicates level of cross-section. Boxes indicate higher magnification regions, as indicated. NP, neural plate; NPB, neural plate border; Ec, ectoderm; Me, mesoderm; En, endoderm. Scale bar, 20 μm.

Figure 3. Pumilio transcripts are broadly expressed within the ectoderm during neurulation.

Figure 3.

Open in a new tab

(A-G) Representative confocal maximum intensity projection micrographs of HH7 (A-B; n=3) and HH8 (C-D; n=4) stage wild-type chick embryos, in whole mount (A, C) and cross-section (A’-B”’, C’-D”’). Transcripts for Pax7 (yellow), Pum1 (cyan), and Pum2 (magenta) were visualized with hybridization chain reaction (HCR). Nuclei were labeled with DAPI (blue). Dashed white line indicates level of cross-section. Boxes indicate higher magnification regions, as indicated. NP, neural plate; NPB, neural plate border; NT, neural tube; NC, neural crest. Scale bar, 20 μm.

Given that Pum1 and Pum2 expression is broad throughout the ectoderm at these stages, we speculate this suggests a role for Pumilio proteins in maintaining pluripotency of the ectoderm, as maintenance of ectodermal pluripotency ultimately contributes to neural crest stemness (Pajanoja et al., 2023). Notably, PUM1/2 knockdowns have previously been shown to reduce pluripotency gene expression in mammalian embryonic stem cells (Silva et al., 2020; Uyhazi et al., 2020). Thus, early expression of Pum1 and Pum2 across the ectoderm may underlie pluripotency in neural and neural crest cells.

3.3. Pumilio transcripts are differentially enriched during cranial neural crest EMT and early migration

A defining feature of neural crest cells is their ability to migrate extensively, which is achieved via a tightly regulated EMT (Leathers and Rogers, 2022). In cranial neural crest, this is driven transcriptionally [reviewed in (Piacentino et al., 2020)] as well as post-transcriptionally [reviewed in (Guzman-Espinoza et al., 2024; Rajan and Hutchins, 2024). Intriguingly, at HH9, as cranial neural crest cells begin to undergo EMT and delaminate from the neuroepithelium of the neural tube (Hutchins and Bronner, 2019), we detected differential enrichment patterns between Pum1 and Pum2 (Fig. 4A–B). To further examine Pum1 and Pum2 expression in neural crest cells around the time of EMT, we examined their expression overlap with Foxd3 and Tfap2b. Foxd3 and Tfap2b are transcription factors that are essential for various aspects of neural crest cell development; Foxd3 is a pioneer factor that underlies key neural crest specifier gene expression in premigratory neural crest (Lukoseviciute et al., 2018), and Tfap2b is a late cranial neural crest regulator that acts in the migratory neural crest GRN (Simoes-Costa and Bronner, 2016). Whereas Pum1 remained broadly enriched across the neural tube and neural crest (Fig. 4C–D), Pum2 was significantly enriched in the neural crest cells that delaminated and were poised to begin migrating (Fig. 4E–G; p = 0.001, two-way ANOVA, Šídák’s multiple comparisons test, n = 3 embryos, 3 sections/embryo). These results indicate that Pum2 activity could be important for regulating the timing or progression of neural crest EMT, though future functional studies are needed to explore this possibility.

Figure 4. Pumilio transcripts are differentially enriched during cranial neural crest EMT.

Figure 4.

Open in a new tab

(A-F) Representative confocal maximum intensity projection micrographs of HH9 (n=7) stage wild-type chick embryos, in whole mount (A, C, E) and cross-section (B, C’, D-D”, E’, F-F”). Transcripts for Pax7 (yellow), Pum1 (cyan), Pum2 (magenta), Tfap2b (red), and Foxd3 (white) were visualized with hybridization chain reaction (HCR). Nuclei were labeled with DAPI (blue). Dashed white line indicates level of cross-section. Boxes indicate higher magnification regions, as indicated. Dotted white outline emphasizes areas of premigratory and delaminating/migratory neural crest. (G) HCR quantification data for Pum1 (cyan) and Pum2 (magenta). Datapoints are averaged ROIs (two per area of interest) from individual sections, normalized to average integrated density of neural tube; sections from same embryo are displayed in same color (n = 3 embryos, 3 sections/embryo). *, p < 0.01, two-way ANOVA, Šídák’s multiple comparisons test. NT, neural tube; NC, neural crest; pNC, premigratory neural crest; mNC, migratory neural crest; Mes, mesenchyme. Scale bar, 20 μm.

As early migrating cranial neural crest cells traverse laterally away from the neural tube at HH10, we continued to observe differences in expression between Pum1 and Pum2 in these migratory cells (Fig. 5A–D). Notably, we continued to detect significantly enriched expression of Pum2 in migratory neural crest (Fig. 5E; p < 0.001, two-way ANOVA, Šídák’s multiple comparisons test, n = 3 embryos, 3 sections/embryo) relative to Pum1. Taken together, these data suggest that Pum1 and Pum2 functions may diverge following neural crest specification, and that Pum2, in particular, may have critical functions during cranial neural crest EMT and early migration.

Figure 5. Pumilio transcripts are differentially enriched during early cranial neural crest migration.

Figure 5.

Open in a new tab

(A-D) Representative confocal maximum intensity projection micrographs of HH10 (n=6) stage wild-type chick embryos, in whole mount (A, C) and cross-section (A’, B-B”, C’, D-D”). Transcripts for Pum1 (cyan), Pum2 (magenta), Tfap2b (red), and Foxd3 (white) were visualized with hybridization chain reaction (HCR). Nuclei were labeled with DAPI (blue). Dashed white line indicates level of cross-section. Boxes indicate higher magnification regions, as indicated. Dotted white outline emphasizes areas of premigratory and migratory neural crest. (E) HCR quantification data for Pum1 (cyan) and Pum2 (magenta). Datapoints are averaged ROIs (two per area of interest) from individual sections, normalized to average integrated density of neural tube; sections from same embryo are displayed in same color (n = 3 embryos, 3 sections/embryo). *, p ≤ 0.02, two-way ANOVA, Šídák’s multiple comparisons test. NT, neural tube; NC, neural crest; pNC, premigratory neural crest; mNC, migratory neural crest; Mes, mesenchyme. Scale bar, 20 μm.

3.4. Pumilio transcripts are significantly reduced and no longer differentially enriched in later migrating cranial neural crest.

To look at a later stage of cranial neural crest cell migration, we next examined Pum1 and Pum2 expression along with Sox10 in HH13 embryos (Fig. 6A–B). Compared to our observations at earlier developmental stages (Fig. 4–5), Pum1 and Pum2 exhibited significantly less enrichment within migratory neural crest compared to relative neural tube expression (Supplemental Fig. S4; p < 0.02, two-way ANOVA, Tukey’s multiple comparisons test, n = 3 embryos, 3 sections/embryo). In addition, Pum1 and Pum2 were no longer differentially enriched, with expression levels appearing more similar between the two paralogs across each region (Fig. 6C; p > 0.5, two-way ANOVA, Šídák’s multiple comparisons test, n = 3 embryos, 3 sections/embryo). Thus, whereas Pum1 and Pum2 may have separable functions during cranial neural crest EMT and early migration, due to their more similar expression patterns by HH13 it is possible that the targets and roles of PUM1 and PUM2 converge, with more substantial and possibly redundant functions in central nervous system development. This hypothesis is consistent with previously established roles for murine PUM1 and PUM2 in neurogenesis (Zhang et al., 2017), though complete functional and target characterization will be needed to explore these possibilities.

Figure 6. Pum1 and Pum2 expression is significantly reduced and no longer differentially enriched in late migratory cranial neural crest.

Figure 6.

Open in a new tab

(A-B) Representative confocal maximum intensity projection micrographs of HH13 (n=5) stage wild-type chick embryos, in whole mount (A) and cross-section (B). Transcripts for Pum1 (cyan), Pum2 (magenta), and Sox10 (orange) were visualized with hybridization chain reaction (HCR). Nuclei were labeled with DAPI (blue). Dashed white line indicates level of cross-section. Boxes indicate higher magnification regions, as indicated. (C) HCR quantification data for Pum1 (cyan) and Pum2 (magenta). Datapoints are averaged ROIs (two per area of interest) from individual sections, normalized to average integrated density of neural tube; sections from same embryo are displayed in same color (n = 3 embryos, 3 sections/embryo). *, p < 0.01; ns, p > 0.5, two-way ANOVA, Šídák’s multiple comparisons test. NT, neural tube; NC, neural crest; mNC, migratory neural crest; Mes, mesenchyme. Scale bar, 20 μm.

4. CONCLUSIONS

Our characterization of Pum1 and Pum2 transcripts during early avian cranial neural crest development revealed dynamic and paralog-specific patterns of expression. The protein sequences of chicken and human PUM1 and PUM2 exhibit high amino acid sequence identity (Fig. 1), meaning that further interrogation of the functions these important RNA-binding proteins in avian embryos could provide insights into their activities in early human development.

Tissue culture studies mapping the transcriptome-wide targets of PUM1 and PUM2 have found that, although there is a large degree of overlap between the RNAs they bind, there are PUM1- and PUM2-specific targets (Lin et al., 2023; Sternburg et al., 2018). Pumilio binding patterns are sensitive to protein levels (Jarmoskaite et al., 2019), meaning that this differential binding could be due to their relative abundance within cells. Regardless of what causes these differences in binding, the evidence of homolog-specific targets in other contexts, in combination with our finding of homolog-specific enrichment patterns during neural crest EMT, substantiates the possibility that PUM1 and PUM2 may play separate roles in the regulation of neural crest cells. Additional in vivo investigations within early-stage embryos are needed to explore this hypothesis.

Beyond Pum1 and Pum2, scRNA-seq studies have revealed that RNA-binding proteins and other RNA-related factors show intriguing enrichment within cells of the neural plate and neural tube, as well as in premigratory and migratory neural crest cells (Hutchins et al., 2022; Williams et al., 2019; Williams et al., 2022). These patterns, along with growing evidence for the importance of various modes of RNA regulation during embryogenesis, argue that post-transcriptional regulation likely plays a much larger role in neural crest development, and EMT, than we have defined thus far (Guzman-Espinoza et al., 2024; Rajan and Hutchins, 2024). This presents an exciting avenue for future research that will undoubtedly provide many insights into neural crest development.

Supplementary Material

Supplementary Material

Supplemental Figure S1. Regions of Interest for quantification of HCR data for Pum1 and Pum2. (A-C) Representative Regions of Interest (ROIs; yellow circles), from which Pum1 or Pum2 integrated density were measured, are shown for cross-sections from HH9 (A), HH10 (B), and HH13 (C). DAPI labeled nuclei (gray) and HCR for Tfap2b (A-B) or Sox10 (C) labeled neural crest (blue). pNC, premigratory neural crest; mNC, migratory neural crest; NT, neural tube; Mes, head mesenchyme.

Supplemental Figure S2. Publicly available single cell RNA-sequencing (scRNA-seq) data revealed broad expression of Pum1 and Pum2 at early developmental stages. (A-D) Accession of scRNA-seq data (Williams et al., 2022) from: https://singlecell.broadinstitute.org/single_cell/study/SCP1570/single-cell-atlas-of-early-chick-development. (A-C) Dot plots reveal that Pum1 and Pum2 are expressed across the same embryonic tissues, though sometimes to differing levels for stages HH5 (A), HH6 (B), and HH7 (C). Transcripts associated with different stages of neural crest development (Pax7, Tfap2b, Foxd3, Sox9, and Sox10) are also shown. (D) UMAP plot of resolved HH7 clusters with feature plots of Pum1 (D’) and Pum2 (D”).

Supplemental Figure S3. Analysis of scRNA-seq data at HH7 reveals Pum1 and Pum2 are expressed broadly and often in the same cells. (A-B) Data were acquired from a publicly available scRNA-seq dataset (Williams et al., 2022) via download from: https://singlecell.broadinstitute.org/single_cell/study/SCP1570/single-cell-atlas-of-early-chick-development. Cell numbers included in analyses are indicated in parentheses as fractions; the numerator is the number of cells in that cluster which have non-zero expression of Pum1 or Pum2, and the denominator is the total number of cells in the specified HH7 cluster (n = included/total). (A-B) Percentage of cells across all HH7 clusters (A) or across Pax7-expressing cells (B) expressing both Pum1 and Pum2, Pum1 only, or Pum2 only. Pax7-expressing cells (i.e. cells with non-zero expression of Pax7; n = 136 cells), serving as a proxy for presumptive neural crest cells, were present only in neural plate, neural tube, and non-neural ectoderm clusters.

Supplemental Figure S4. Combined plots of HCR quantification data for Pum1 and Pum2. (A-B) HCR quantification data for Pum1 (A) and Pum2 (B) for HH9 (circles), HH10 (triangles), and HH13 (squares). Data are reproduced from Figs. 4, 5, and 6. Error bars indicate SEM. Datapoints are averaged ROIs (two per area of interest) from individual sections, normalized to average integrated density of neural tube; sections from same embryo are displayed in same color (n = 3 embryos, 3 sections/embryo). pNC, premigratory neural crest; mNC, migratory neural crest; NT, neural tube; Mes, head mesenchyme. *, p < 0.02, two-way ANOVA, Tukey’s multiple comparisons test.

ACKNOWLEDGMENTS

This work was supported in part by the UCSF Biological Imaging Development Core (BIDC) and the National Institutes of Health (NIH) Office of the Director S10 OD021664. We thank Drs. Licia Selleri and Rich Schneider for access to critical equipment.

FUNDING INFORMATION

This work was funded by the National Institutes of Health (NIH) R00DE028592 (EJH) and R35GM150763 (EJH). JLP is supported by NIH Institutional Training Grant 5T32DE007306.

Footnotes

CRediT AUTHORSHIP CONTRIBUTION STATEMENT

Mariann Guzman-Espinoza: Writing – original draft, Visualization, Methodology, Investigation, Formal analysis, Data curation. Helen M. Vander Wende: Writing – review & editing, Visualization, Methodology, Investigation, Formal analysis, Data curation. Jessica L. Pacheco: Visualization, Investigation. Alejandra Olano Roldán: Investigation. Erica J. Hutchins: Writing – review & editing, Supervision, Resources, Methodology, Investigation, Formal analysis, Funding acquisition, Conceptualization.

REFERENCES

  1. Antonaci M, Wheeler GN, 2022. MicroRNAs in neural crest development and neurocristopathies. Biochem Soc Trans 50, 965–974. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Avellino R, Carrella S, Pirozzi M, Risolino M, Salierno FG, Franco P, Stoppelli P, Verde P, Banfi S, Conte I, 2013. miR-204 targeting of Ankrd13A controls both mesenchymal neural crest and lens cell migration. PLoS One 8, e61099. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Basch ML, Bronner-Fraser M, García-Castro MI, 2006. Specification of the neural crest occurs during gastrulation and requires Pax7. Nature 441, 218–222. [DOI] [PubMed] [Google Scholar]
  4. Bhattacharya D, Rothstein M, Azambuja AP, Simoes-Costa M, 2018. Control of neural crest multipotency by Wnt signaling and the Lin28/let-7 axis. eLife 7, e40556. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bohn JA, Van Etten JL, Schagat TL, Bowman BM, McEachin RC, Freddolino PL, Goldstrohm AC, 2018. Identification of diverse target RNAs that are functionally regulated by human Pumilio proteins. Nucleic Acids Research 46, 362–386. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Choi HMT, Schwarzkopf M, Fornace ME, Acharya A, Artavanis G, Stegmaier J, Cunha A, Pierce NA, 2018. Third-generation in situ hybridization chain reaction: multiplexed, quantitative, sensitive, versatile, robust. Development 145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cibi DM, Mia MM, Guna Shekeran S, Yun LS, Sandireddy R, Gupta P, Hota M, Sun L, Ghosh S, Singh MK, 2019. Neural crest-specific deletion of Rbfox2 in mice leads to craniofacial abnormalities including cleft palate. eLife 8, e45418. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Copeland J, Simoes-Costa M, 2020. Post-transcriptional tuning of FGF signaling mediates neural crest induction. Proceedings of the National Academy of Sciences 117, 33305–33316. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. D’Amico-Martel A, Noden DM, 1983. Contributions of placodal and neural crest cells to avian cranial peripheral ganglia. Am J Anat 166, 445–468. [DOI] [PubMed] [Google Scholar]
  10. Forman TE, Dennison BJC, Fantauzzo KA, 2021. The Role of RNA-Binding Proteins in Vertebrate Neural Crest and Craniofacial Development. J Dev Biol 9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Goldstrohm AC, Tanaka Hall TM, McKenney KM, 2018. Post-transcriptional Regulatory Functions of Mammalian Pumilio Proteins. Trends in genetics : TIG 34, 972–990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Guzman-Espinoza M, Kim M, Ow C, Hutchins EJ, 2024. “Beyond transcription: How post-transcriptional mechanisms drive neural crest EMT”. Genesis 62, e23553. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Hamburger V, Hamilton HL, 1951. A series of normal stages in the development of the chick embryo. J Morphol 88, 49–92. [PubMed] [Google Scholar]
  14. Hutchins EJ, Bronner ME, 2019. Draxin alters laminin organization during basement membrane remodeling to control cranial neural crest EMT. Dev Biol 446, 151–158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Hutchins EJ, Gandhi S, Chacon J, Piacentino M, Bronner ME, 2022. RNA-binding protein Elavl1/HuR is required for maintenance of cranial neural crest specification. eLife 11, e63600. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Hutchins EJ, Kunttas E, Piacentino ML, Howard A.G.A.t., Bronner ME, Uribe RA, 2018. Migration and diversification of the vagal neural crest. Dev Biol 444 Suppl 1, S98–S109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Jarmoskaite I, Denny SK, Vaidyanathan PP, Becker WR, Andreasson JOL, Layton CJ, Kappel K, Shivashankar V, Sreenivasan R, Das R, Greenleaf WJ, Herschlag D, 2019. A Quantitative and Predictive Model for RNA Binding by Human Pumilio Proteins. Molecular Cell 74, 966–981.e918. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Khudyakov J, Bronner-Fraser M, 2009. Comprehensive spatiotemporal analysis of early chick neural crest network genes. Dev Dyn 238, 716–723. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Le Douarin N, Kalcheim C, 1999. The neural crest, 2nd ed. Cambridge University Press, Cambridge, UK; New York, NY, USA. [Google Scholar]
  20. Leathers TA, Rogers CD, 2022. Time to go: neural crest cell epithelial-to-mesenchymal transition. Development 149. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Lin Y, Kwok S, Hein AE, Thai BQ, Alabi Y, Ostrowski MS, Wu K, Floor SN, 2023. RNA molecular recording with an engineered RNA deaminase. Nature Methods 20, 1887–1899. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Lukoseviciute M, Gavriouchkina D, Williams RM, Hochgreb-Hagele T, Senanayake U, Chong-Morrison V, Thongjuea S, Repapi E, Mead A, Sauka-Spengler T, 2018. From Pioneer to Repressor: Bimodal foxd3 Activity Dynamically Remodels Neural Crest Regulatory Landscape In Vivo. Dev Cell 47, 608–628.e606. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Madeira F, Madhusoodanan N, Lee J, Eusebi A, Niewielska A, Tivey ARN, Lopez R, Butcher S, 2024. The EMBL-EBI Job Dispatcher sequence analysis tools framework in 2024. Nucleic acids research 52, W521–W525. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Martik ML, Bronner ME, 2017. Regulatory Logic Underlying Diversification of the Neural Crest. Trends in genetics: TIG 33, 715–727. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Mendez-Maldonado K, Vega-Lopez GA, Aybar MJ, Velasco I, 2020. Neurogenesis From Neural Crest Cells: Molecular Mechanisms in the Formation of Cranial Nerves and Ganglia. Front Cell Dev Biol 8, 635. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Monroy BY, Adamson CJ, Camacho-Avila A, Guerzon CN, Echeverria CV, Rogers CD, 2022. Expression atlas of avian neural crest proteins: Neurulation to migration. Developmental Biology 483, 39–57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Nishanth MJ, Simon B, 2020. Functions, mechanisms and regulation of Pumilio/Puf family RNA binding proteins: a comprehensive review. Molecular Biology Reports 47, 785–807. [DOI] [PubMed] [Google Scholar]
  28. Pajanoja C, Hsin J, Olinger B, Schiffmacher A, Yazejian R, Abrams S, Dapkunas A, Zainul Z, Doyle AD, Martin D, Kerosuo L, 2023. Maintenance of pluripotency-like signature in the entire ectoderm leads to neural crest stem cell potential. Nature Communications 14, 5941. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Perfetto M, Xu X, Lu C, Shi Y, Yousaf N, Li J, Yien YY, Wei S, 2021. The RNA helicase DDX3 induces neural crest by promoting AKT activity. Development 148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Piacentino ML, Li Y, Bronner ME, 2020. Epithelial-to-mesenchymal transition and different migration strategies as viewed from the neural crest. Curr Opin Cell Biol 66, 43–50. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Rajan AAN, Hutchins EJ, 2024. Post-transcriptional regulation as a conserved driver of neural crest and cancer-cell migration. Curr Opin Cell Biol 89, 102400. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Sanchez-Vasquez E, Bronner ME, Strobl-Mazzulla PH, 2019. Epigenetic inactivation of miR-203 as a key step in neural crest epithelial-to-mesenchymal transition. Development 146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Santagati F, Rijli FM, 2003. Cranial neural crest and the building of the vertebrate head. Nat Rev Neurosci 4, 806–818. [DOI] [PubMed] [Google Scholar]
  34. Sauka-Spengler T, Bronner-Fraser M, 2008. A gene regulatory network orchestrates neural crest formation. Nature Reviews Molecular Cell Biology 9, 557–568. [DOI] [PubMed] [Google Scholar]
  35. Sievers F, Higgins DG, 2018. Clustal Omega for making accurate alignments of many protein sequences. Protein Science 27, 135–145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Sievers F, Wilm A, Dineen D, Gibson TJ, Karplus K, Li W, Lopez R, McWilliam H, Remmert M, Söding J, Thompson JD, Higgins DG, 2011. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol Syst Biol 7, 539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Sigrist CJ, de Castro E, Cerutti L, Cuche BA, Hulo N, Bridge A, Bougueleret L, Xenarios I, 2013. New and continuing developments at PROSITE. Nucleic Acids Res 41, D344–347. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Silva ILZ, Robert AW, Cabo GC, Spangenberg L, Stimamiglio MA, Dallagiovanna B, Gradia DF, Shigunov P, 2020. Effects of PUMILIO1 and PUMILIO2 knockdown on cardiomyogenic differentiation of human embryonic stem cells culture. PLoS One 15, e0222373. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Simoes-Costa M, Bronner ME, 2016. Reprogramming of avian neural crest axial identity and cell fate. Science 352, 1570–1573. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Simões-Costa M, Bronner ME, 2015. Establishing neural crest identity: a gene regulatory recipe. Development (Cambridge, England) 142, 242–257. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Sternburg EL, Estep JA, Nguyen DK, Li Y, Karginov FV, 2018. Antagonistic and cooperative AGO2-PUM interactions in regulating mRNAs. Scientific Reports 8, 15316. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Trainor PA, 2010. Craniofacial birth defects: The role of neural crest cells in the etiology and pathogenesis of Treacher Collins syndrome and the potential for prevention. Am J Med Genet A 152A, 2984–2994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Uyhazi KE, Yang Y, Liu N, Qi H, Huang XA, Mak W, Weatherbee SD, de Prisco N, Gennarino VA, Song X, Lin H, 2020. Pumilio proteins utilize distinct regulatory mechanisms to achieve complementary functions required for pluripotency and embryogenesis. Proceedings of the National Academy of Sciences 117, 7851–7862. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Van Etten J, Schagat TL, Hrit J, Weidmann CA, Brumbaugh J, Coon JJ, Goldstrohm AC, 2012. Human Pumilio proteins recruit multiple deadenylases to efficiently repress messenger RNAs. J Biol Chem 287, 36370–36383. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Wang M, Ogé L, Perez-Garcia M-D, Hamama L, Sakr S, 2018. The PUF Protein Family: Overview on PUF RNA Targets, Biological Functions, and Post Transcriptional Regulation. International Journal of Molecular Sciences 19, 410. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Ward NJ, Green D, Higgins J, Dalmay T, Munsterberg A, Moxon S, Wheeler GN, 2018. microRNAs associated with early neural crest development in Xenopus laevis. BMC Genomics 19, 59. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Weiner AMJ, 2018. MicroRNAs and the neural crest: From induction to differentiation. Mech Dev 154, 98–106. [DOI] [PubMed] [Google Scholar]
  48. White EK, Moore-Jarrett T, Ruley HE, 2001. PUM2, a novel murine puf protein, and its consensus RNA-binding site. RNA 7, 1855–1866. [PMC free article] [PubMed] [Google Scholar]
  49. Williams RM, Candido-Ferreira I, Repapi E, Gavriouchkina D, Senanayake U, Ling ITC, Telenius J, Taylor S, Hughes J, Sauka-Spengler T, 2019. Reconstruction of the Global Neural Crest Gene Regulatory Network In Vivo. Developmental Cell 51, 255–276.e257. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Williams RM, Lukoseviciute M, Sauka-Spengler T, Bronner ME, 2022. Single-cell atlas of early chick development reveals gradual segregation of neural crest lineage from the neural plate border during neurulation. eLife 11, e74464. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Zhang M, Chen D, Xia J, Han W, Cui X, Neuenkirchen N, Hermes G, Sestan N, Lin H, 2017. Post-transcriptional regulation of mouse neurogenesis by Pumilio proteins. Genes Dev 31, 1354–1369. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material

Supplemental Figure S1. Regions of Interest for quantification of HCR data for Pum1 and Pum2. (A-C) Representative Regions of Interest (ROIs; yellow circles), from which Pum1 or Pum2 integrated density were measured, are shown for cross-sections from HH9 (A), HH10 (B), and HH13 (C). DAPI labeled nuclei (gray) and HCR for Tfap2b (A-B) or Sox10 (C) labeled neural crest (blue). pNC, premigratory neural crest; mNC, migratory neural crest; NT, neural tube; Mes, head mesenchyme.

Supplemental Figure S2. Publicly available single cell RNA-sequencing (scRNA-seq) data revealed broad expression of Pum1 and Pum2 at early developmental stages. (A-D) Accession of scRNA-seq data (Williams et al., 2022) from: https://singlecell.broadinstitute.org/single_cell/study/SCP1570/single-cell-atlas-of-early-chick-development. (A-C) Dot plots reveal that Pum1 and Pum2 are expressed across the same embryonic tissues, though sometimes to differing levels for stages HH5 (A), HH6 (B), and HH7 (C). Transcripts associated with different stages of neural crest development (Pax7, Tfap2b, Foxd3, Sox9, and Sox10) are also shown. (D) UMAP plot of resolved HH7 clusters with feature plots of Pum1 (D’) and Pum2 (D”).

Supplemental Figure S3. Analysis of scRNA-seq data at HH7 reveals Pum1 and Pum2 are expressed broadly and often in the same cells. (A-B) Data were acquired from a publicly available scRNA-seq dataset (Williams et al., 2022) via download from: https://singlecell.broadinstitute.org/single_cell/study/SCP1570/single-cell-atlas-of-early-chick-development. Cell numbers included in analyses are indicated in parentheses as fractions; the numerator is the number of cells in that cluster which have non-zero expression of Pum1 or Pum2, and the denominator is the total number of cells in the specified HH7 cluster (n = included/total). (A-B) Percentage of cells across all HH7 clusters (A) or across Pax7-expressing cells (B) expressing both Pum1 and Pum2, Pum1 only, or Pum2 only. Pax7-expressing cells (i.e. cells with non-zero expression of Pax7; n = 136 cells), serving as a proxy for presumptive neural crest cells, were present only in neural plate, neural tube, and non-neural ectoderm clusters.

Supplemental Figure S4. Combined plots of HCR quantification data for Pum1 and Pum2. (A-B) HCR quantification data for Pum1 (A) and Pum2 (B) for HH9 (circles), HH10 (triangles), and HH13 (squares). Data are reproduced from Figs. 4, 5, and 6. Error bars indicate SEM. Datapoints are averaged ROIs (two per area of interest) from individual sections, normalized to average integrated density of neural tube; sections from same embryo are displayed in same color (n = 3 embryos, 3 sections/embryo). pNC, premigratory neural crest; mNC, migratory neural crest; NT, neural tube; Mes, head mesenchyme. *, p < 0.02, two-way ANOVA, Tukey’s multiple comparisons test.

NIHMS2094525-supplement-Supplementary_Material.pdf (2.9MB, pdf)

RESOURCES