ABSTRACT
Background Aims
The leading mammary cancer in Burkina Faso, breast cancer has a variety of origins. In fact, an alteration in the MAP3K14 [GenBank: NC_000017.11, ID: 9020] and CD40 [GenBank: NC_000020.11, ID: 958] genes can lead to the development of breast cancer. The goal of this study is to highlight the possible involvement of the polymorphisms rs2074292 in the MAP3K14 gene and rs1883832 in the CD40 gene in the development of breast cancer in women in Burkina Faso.
Methods
One hundred and fifty‐two (152) participants, including 71 patients versus 81 controls, took part in this case‐control study. Real‐time PCR was used for genotyping the two polymorphisms (rs2074292 and rs1883832), and the χ 2 test was used for risk assessment by calculating odds ratios, confidence intervals, and p values.
Results
For the MAP3K14 gene, the allelic frequencies A and G, were respectively 54.40%, 35.25% in cases and 45.60%, 64.75% in controls. For the CD40 gene, the C and T allelic frequencies were 48.15% and 35.29% in the cases and 51.85% and 64.71% in the controls, respectively. The rs2074292 polymorphism of the MAP3K14 gene confers protection breast cancer with respectively the allele G (OR = 0.45 CI (95%) = 0.28–0.73; p = 0.01) and the heterozygote genotype AG (OR = 0.08 CI (95%) = 0.02–0.024; p < 0.01) while, no association was established between the rs1883832 polymorphism of the CD40 gene and the occurrence of breast cancer (OR = 0.58 CI (95%) = 0.27–1.23; p = 0.15).
Conclusion
The rs2074292 polymorphism of the MAP3K14 gene protects against progression to breast cancer in Burkina Faso. This study, therefore, contributes to an understanding of the role played by these two polymorphisms in the pathogenesis of this devastating disease.
Keywords: breast cancer, Burkina Faso, CD40, MAP3K14, polymorphism
Abbreviations
- BC
breast cancer
- CD40
cluster of differentiation
- CHB
chronic hepatitis B
- DNA
deoxyribonucleic acid
- GC
gastric cancer
- HBsAg
HBs antigen
- HBV
hepatitis B virus
- HCC
hepatocellular carcinoma
- LC
lung cancer
- MAP3K14
mitogen‐activated protein kinase 14
- SNP
single‐nucleotide polymorphism
- TGF‐β1
transforming growth factor beta 1
- WHO
world health organization
1. Introduction
Worldwide, breast cancer ranks fourth in terms of cancer mortality. It is the most frequently diagnosed cancer in women. One woman in eight will be diagnosed with breast cancer during her lifetime, it therefore represents a major public health problem. Indeed, it leads to numerous victims in developed countries as well as in developing countries [1]. In addition, the number of new cases will reach 2,296,840, with 666,103 deaths worldwide in 2022 [1]. In Burkina Faso, according to the latest Globocan data, breast cancer ranks second after liver cancer among all cancers diagnosed, and is the leading cancer among women. In 2022, the number of new cases was estimated at over 1372, or 9.4% of all cancers diagnosed, with 818 deaths, or 7.4% of all cancers. During the same period, prevalence was estimated at 2674 or 10.1% [1].
Breast cancer is a non‐communicable disease whose causes are multifactorial. There are modifiable risk factors (smoking, alcoholism, physical activity, etc.) and non‐modifiable risk factors (BRCA mutations, age, sex, etc.). Studies are still underway to elucidate its actual etiology [2, 3]. A probable causal link between certain polymorphisms and breast cancer. These polymorphisms include rs2074292 in the MAP3K14 gene and rs1883832 in the CD40 gene, which are thought to influence the progression of breast cancer in women in Burkina Faso.
Indeed, the MAP3K14 [OMIM: 604655] (Mitogen‐activated protein kinase 14) gene expresses a mitogen‐activated protein kinase 14, which is nothing other than a serine/threonine protein kinase. This kinase can stimulate nuclear factor‐kappa B (NF‐κB) activity by binding to TRAF2 (TNF receptor‐associated factor 2) [4]. Tumor development and progression can be engendered by inflammation through the NF‐κB signaling pathway [5]. In addition, the MAP3K14 gene is involved in cell signaling pathways that regulate key processes such as apoptosis, inflammation, and the stress response. Alterations in these pathways may contribute to tumor progression and resistance to treatment [5]. By studying this rs2074292 polymorphism, we can lead to the identification of genetic variations that influence breast cancer susceptibility or response to therapies.
The CD40 gene [OMIM: 109535] belongs to the tumor necrosis factor (TNF) superfamily and is located on chromosome 20q12‐13.2. The CD40 protein plays a crucial role in antitumor responses through Cytotoxic T lymphocytes and is also involved in T helper cell differentiation [6]. In fact, it is involved in the activation of B lymphocytes and in the modulation of the immune cell response to tumors [6]. By studying this rs1883832 polymorphism, we'll be able to better understand its real implications for the way the immune system interacts with cancer cells, which could influence prognosis and response to treatment. In Burkina Faso, no studies have been carried out on the MAP3K14 and CD40 genes to determine their real implications in the development of breast cancer. The aim of this study, conducted in Burkina Faso, is to investigate a probable link between these two polymorphisms and malignant breast tumors. This will undoubtedly lead to a better understanding and, of necessity, knowledge of the current state of knowledge of these two polymorphisms in Burkina. The latter can also be used as diagnostic markers for the prevention of this pathology.
2. Materials and Methods
2.1. Setting and Study Population
A total of 152 participants, 71 patients (those with a histopathological diagnosis) and 81 controls (those with no breast abnormality on ultrasound examination) were included in this descriptive, analytical case‐control study. Socio‐demographic, anthropometric and clinical data were collected, followed by the collection of 5 mL of venous blood using an EDTA (Ethylene‐Diamine‐Tetra‐Acetic) tube. The EDTA tube contains an anti‐coagulant (the potassium salt of EDTA), which prevents blood clotting by binding to calcium ions. The pellet and plasma were separated and aliquoted after centrifugation at 3500 rpm for 15 min and then stored at −20°C. The enrolment of participants and the collection of blood samples took place in the following health facilities: Paul VI, Bogodogo (CHU‐B), Schiphra, and Yalgado OUEDRAOGO (CHU‐YO).
Molecular analyses were carried out at the Pietro Annigoni Biomolecular Research Centre (CERBA), 01 BP 364 Ouagadougou 01, Burkina Faso, and the Laboratory of Molecular and Genetic Biology (LABIOGENE), Joseph KI‐ZERBO University, 03 BP 7021 Ouagadougou 03, Burkina Faso.
2.2. DNA Extraction
Nucleic acids (genomic DNAs) of the participants were extracted from plasma and/or pellets using the QIAampDSP DNA Blood Mini kit (QIAGEN, GmbH, Germany) according to the manufacturer's instructions, then DNA was quantified by nanodrop (7141V1.0.2) (Thermo Fisher Scientific), and extracts with good purity were diluted to 10 ng/µL.
2.3. Genotyping of rs2074292 MAP3K14 Gene and rs1883832 CD40 Gene
Real‐time PCR on the QuantStudioTM 5 Real‐Time instrument (Thermo Fisher Scientific) was used to genotype the two polymorphisms rs2074292 and rs1883832. Each sample was genotyped in a final reaction volume of 25 µL, consisting of the following components: 3 µL of DNA extract, 1.5 µL of TaqMan SNP Genotyping Assay diluted 1:5 (8X), 17.5 µL of pure water, and 3 µL of HOT FIREPol probe universal qPCR Mix 5X. The amplification program used to genotype the two polymorphisms was as follows: activation of taq polymerase at 95°C for 10 min, followed by 40 cycles of amplification (denaturation at 95°C, 15 s, hybridization at 95°C for 1 min and elongation at 60°C, 1 min) and final elongation at 60°C, 30 s. The Table 1 show the sequence of primers for SNP rs2074292 and rs1883832 used for the genotyping.
Table 1.
Sequence of primers for SNP rs2074292 and rs1883832.
| Polymorphism | Primers and probes |
|---|---|
| MAP3K14 (rs2074292) | Primers: F: 5′‐AGCCCTGGAAACCTCACC‐3′ |
| R: 5′‐TGAGATTGGCGGAATAAGAGA‐3′ | |
| Probe: 5′‐VIC‐ AGCCCTGGAAACCTCACC ‐MGB‐NFQ‐3′ | |
| 5′‐FAM‐TGAGATTGGCGGAATAAGAGA ‐MGB‐NFQ‐3′ | |
| CD40 (rs1883832) | Primers: F: 5′‐CCCCGATAGGTGGACCGCGATTGGT‐3′ |
| R: 5′‐CCCGCCCTCTGAACCCCCTACCAGT‐3′ | |
| Probe: 5′‐VIC‐CCCCGATAGGTGGACCGCGATTGGT ‐MGB‐NFQ‐3′ | |
| 5′‐FAM‐CCCGCCCTCTGAACCCCCTACCAGT ‐MGB‐NFQ‐3′ |
2.4. Ethical Approval and Informed Consent
The National Ethics Committee for Health Research (CERS) under deliberation no. 2019‐5‐067 of May 15, 2019 has issued a favorable opinion for the conduct of this study. All participants gave their free and informed consent.
2.5. Statistical Analysis
Epi Info version 7, R. Version 4.2.1 and the Statistical Package for the Social Sciences (SPSS) version 21.0 were used for statistical analysis of data previously entered in Excel 2016. Frequency comparisons were made on a chi‐square basis. Odds ratios (OR) and 95% confidence intervals (CI) were calculated to estimate risk. The significance threshold was set at p < 0.05.
3. Results
3.1. Clinical and Socio‐Demographic Characteristics
A total of 152 participants were included in the study: 71 cases and 81 controls. Participants had a mean age of 41.03 ± 11.47 years, with extremes of 19–70 years. Over 66.67% of controls were under 40, compared with 31.14% of cases. Of the cases, 68.06% were over 40, versus 33.33% of controls.
3.2. MAP3K14 Gene rs2074292 Polymorphism and Breast Cancer Risk
3.2.1. Real‐Time PCR Results
Real‐time PCR of MAP3K14 yields three types of individuals: wild homozygotes designated by AA, accompanied by red fluorescence, heterozygotes by the AG genotype marked by green fluorescence, and finally the GG mutated homozygote by blue fluorescence (Figure 1).
Figure 1.
Real‐time PCR results for the MAP3K14 gene.
3.2.2. Genotypic and Allelic Frequencies
In our study population, Hardy‐Weinberg equilibrium (HWE) between patients (χ² = 10.94 p = 0.0009) and controls (χ² = 64.50, p < 0.001) was not met for the rs2074292 polymorphism of the MAP3K14 gene, with genotype frequency values below 0.05. We found that the frequency of the mutated [G] allele in the same study population was 35.25% in cases versus 64.75% in controls. The latter [G] protects against the development of breast cancer, with an odds ratio of less than 1 and p < 0.05 (OR = 0.45 CI (95%) = 0.28–0.73 p = 0.001).
The genotypic frequencies of wild‐type AA homozygotes were 87.5% in cases and 12.5% in controls. Heterozygotes (AG) represented 36.44% of cases and 63.56% of controls, respectively. The AG heterozygote was a protective factor against the occurrence of breast cancer (OR = 0.08 CI (95%) = 0.02–0.024 p < 0.001). The GG genotype was 100% (2) in controls only (Table 2).
Table 2.
Distribution of MAP3K14 and CD40 allele and genotype frequencies.
| MAP3K14 (rs2074292) | Case | Controls | OR (95% IC) | p value |
|---|---|---|---|---|
| N = 71 (%) | N = 81 (%) | |||
| Alleles | ||||
| A | 99 (54.40) | 83 (45.60) | — | Reference |
| G | 43 (35.25) | 79 (64.75) | 0.45 (0.28–0.73) | 0.001 |
| Genotypes | ||||
| AA | 28 (87.50) | 4 (12.50) | — | Reference |
| AG | 43 (36.44) | 75 (63.56) | 0.08 (0.02–0.24) | p < 0.001 |
| GG | 0 (0.00) | 2 (100) | NA | NA |
| CD40 | ||||
| Alleles | ||||
| C | 130 (48.15) | 140 (51.85) | — | Reference |
| T | 12 (35.29) | 22 (64.71) | 0.58 (0.27–1.23) | 0.15 |
| Genotypes | ||||
| CC | 60 (50.42) | 59 (49.58) | — | Reference |
| CT | 10 (31.25) | 22 (68.75) | 0.44 (0.19–1.02) | 0.05 |
| TT | 1 (100) | 0 (0) | NA | NA |
Abbreviations: 95% CI, 95% confidence interval; N, number; NA, not applicable; OR, odds ratio; p, p value.
3.3. CD40 Gene rs1883832 Polymorphism and Breast Cancer Risk
3.3.1. Amplification Result
Figure 2 shows the real‐time PCR results for the CD40 gene. In our study, three types of genotypes are considered: CC wild‐type homozygotes with red fluorescence, CT heterozygotes with green fluorescence and TT mutated homozygotes with blue fluorescence.
Figure 2.
Real‐time PCR results for the CD40 gene.
3.3.2. Allelic and Genotypic Frequencies
In the present study, the genotype frequencies of the population respected the Hardy‐Weinberg equilibrium (HWE) between patients (χ² = 3.13 p = 0.076) and controls (χ² = 2, p = 0.15) for the rs1883832 polymorphism of the CD40 gene (p > 0.05). In the controls, the proportion of the mutated allele [T] was 64.71%, compared with 35.29% in the cases. It was not associated with progression to breast malignancy (OR = 0.58 95% CI = 0.27–1.23 p = 0.15).
Genotypic frequencies of the wild‐type homozygote CC were 50.42% in cases versus 49.58% in controls. Genotypic frequencies for CT heterozygotes were 31.25% for cases and 68.75% for controls. No TT genotype was observed in controls, but a homozygous mutated TT genotype was reported in cases (100%). The CT heterozygote was not implicated in any manifestation of breast carcinoma (OR = 0.44 95% CI = 0.19–1.02 p = 0.05) (Table 2).
3.4. Relationship Between Gene Expression of the Two Polymorphisms and Some Characteristics of the Participants: Multivariate Analysis
In terms of premenopausal status, the AG heterozygote of the MAP3K14 gene was found to be the best candidate that provides protection against the occurrence of breast malignancy (OR = 0.08 95% CI = 0.026–0.28 p = 0.000003). For the CD40 gene, there was no significant association (OR = 0.67 95% CI = 0.26–1.70 p = 0.54).
Furthermore, family history was also associated with a risk of occurrence only at the level of the CD40 gene (OR = 2.44 95% CI = 1.02–5.82 p= 0.03). Finally, age at diagnosis and post‐menopausal status and were not significantly associated with the occurrence of breast carcinoma respectively represented by (OR = 4.20 95% CI = 0.64–27.36 p = 0.11) and (OR = 1.33 95% CI = 0.05–31.12 p= 0.85) (Table 3).
Table 3.
Relationship between menopausal status, family history, age at diagnosis, and genotypes of the two polymorphisms.
| Genotypes | Premenopausal | OR (95% IC) | p value | |
|---|---|---|---|---|
| Case (%) | Controls | |||
| MAP3K14 (rs2074292) | ||||
| AA | 16 (80) | 4 (20) | — | Reference |
| AG | 24 (25.53) | 70 (74.47) | 0.08 (0.026–0.28) | p < 0.001 |
| GG | 0 (0) | 2 (100) | NA | NA |
| CD40 (rs1883832) | ||||
| CC | 31 (36.05) | 55 (63.95) | — | Reference |
| CT | 8 (27.59) | 21 (72.41) | 0.67 (0.26–1.70) | 0.54 |
| TT | 1 (100) | 0 (00) | NA | NA |
| Post‐menopausal | ||||
| MAP3K14 (rs2074292) | ||||
| AA | 1 (100) | 0 (00) | — | Reference |
| AG | 3 (37.50) | 5 (62.50) | NA | NA |
| GG | 0 (0.0) | 0 (0.0) | NA | NA |
| CD40 (rs1883832) | ||||
| CC | 3 (42.86) | 4 (57.14) | — | Reference |
| CT | 1 (50) | 1 (50) | 1,33 (0.05–31.12) | 0.85 |
| TT | 0 (0.0) | 0 (0.0) | NA | NA |
| Genotypes | Family history | OR (95% IC) | p value | |
|---|---|---|---|---|
| Yes (%) | No (%) | |||
| MAP3K14 (rs2074292) | ||||
| AA | 4 (12.50) | 28 (87.50) | Reference | |
| AG | 28 (23.73) | 90 (76.27) | 2.17 (0.70–6.74) | 0.16 |
| GG | 0 (0.00) | 2 (0.0) | NA | NA |
| CD40 (rs1883832) | ||||
| CC | 21 (17.65) | 98 (82.35) | Reference | |
| CT | 11 (34.37) | 21 (65.63) | 2.44 (1.02–5.82) | 0.03 |
| TT | 0 (0.0) | 1 (0.0) | NA | NA |
| Genotypes | Age at diagnosis (years) | OR (95% IC) | p value | |
|---|---|---|---|---|
| Before 40 years | After 40 years | |||
| MAP3K14 (rs2074292) | ||||
| AA | 5 (25) | 23 (75) | — | Reference |
| AG | 12 (53.39) | 17 (46.61) | 3.24 (0.96–10.96) | 0.05 |
| GG | 0 (50) | 1 (50) | NA | NA |
| CD40 (rs1883832) | ||||
| CC | 5 (47.06) | 21 (52.94) | Reference | |
| CT | 3 (50) | 3 (50) | 4.20 (0.64–27.36) | 0.11 |
| TT | 0 (0.0) | 1 (0.0) | NA | NA |
Abbreviations: 95% CI, 95% confidence interval; NA, not applicable; OR, odds ratio.
3.5. Combination of Polymorphism Genotypes and Risk of Developing Breast Cancer
We analyzed the impact of the combination of these two polymorphisms, based on the effect of the association of various genotypes and their relationship with the development of breast malignancy. Potential protection was observed with the combination of the AG heterozygote of the MAP3K14 gene and the CC wild‐type homozygote of the CD40 gene with regard to breast cancer progression (OR = 0.07, 95% CI = 0.02–0.25, p < 0.001) (Table 4).
Table 4.
Combination of polymorphism genotypes and the risk of developing breast cancer.
| MAP3K14 (rs2074292) | CD40 (rs1883832) | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CC | CT | TT | ||||||||||
| C | T | OR (95% IC) | p | C | T | OR (95% IC) | p | C | T | OR (95% IC) | p | |
| N | N | N | N | n | N | |||||||
| AA | 26 | 3 | — | Réf | 1 | 1 | 0 | 0 | NA | NA | ||
| AG | 34 | 54 | 0.07 (0.02–0.25) | p < 0.001 | 9 | 21 | 0.42 (0.02–7.63) | 0.55 | 0 | 0 | NA | NA |
| GG | 0 | 2 | NA | NA | 0 | 0 | NA | NA | 0 | 0 | NA | NA |
Abbreviations: C, cases; CI, confidence interval; N, number; NA, not applicable; OR, odds ratio; Ref, reference; T, controls.
4. Discussion
4.1. Clinical and Socio‐Demographic Characteristics
The aim of our work was to investigate a probable link between the polymorphisms rs2074292 of the MAP3K14 gene and rs1883832 of the CD40 gene in the predisposition to breast cancer in Burkinabe women.
The study population included participants aged from 19 to 70 years, with an average age of 41.03 ± 11.47 years. The average age of cases in this study was 46.69 years, with a standard deviation of 9.72 years. This average was very close to those found in Burkina Faso by Traoré et al. and Somé et al. which were 46.22 ± 11.24 years and 46.6 ± 12.1 years, respectively [7, 8]. However, it differs from those found in other studies in Burkina Faso carried out by Bambara et al. by Kiendrebeogo et al. and by Zongo et al. who respectively found mean ages of 48.20 ± 12.4, 48 ± 11.53, and 49.9 ± 18.1 years [9, 10, 11]. This average age is higher than those found by Adico et al. and by Dabré et al. in Burkina Faso, who reported respective averages of 45.60 ± 8.48 and 44.51 ± 8.9 years [12, 13].
In our study, the mean age at diagnosis of breast cancer was 41.50 years, with a standard deviation of 10.54 years. This mean slightly exceeds that reported by Traoré et al. which was 40.39 ± 10.96 years [8]. It also differs from that observed in an Ivorian study by Aka et al. in 2021, as well as by Surakasula et al. in 2014, who respectively found averages of 48.27 and 47.7 years at the time [14, 15]
This difference could be attributed to the fact that the majority of Burkina Faso's population is made up of young people, representing 80% of the population, according to the latest population and demographic census carried out in Burkina Faso in 2020 [16].
4.2. MAP3K14 Gene rs2074292 and CD40 Gene rs1883832 Polymorphisms and Breast Cancer Risk Factor
After careful analysis, it emerged that the allelic and genotypic frequencies of the rs2074292 polymorphism of the MAP3K14 gene were not in Hardy Weinberg equilibrium in our study population in either cases or controls (χ 2 = 10.94, p < 0.001 and χ 2 = 64.50, p < 0.001). However, this balance is respected for the rs1883832 polymorphism of the CD40 gene in cases (χ² = 3.13 p = 0.076) and controls (χ² = 2, p = 0.15) respectively. Indeed, Hardy‐Weinberg theory recommends that p > 0.05 to verify the constancy of genotypic and allelic frequencies from one generation to the next [17]. In light of these results, we can conclude that the genotypic and allelic frequencies of the CD40 gene polymorphism rs1883832 remain stable from one generation to the next in the Burkinabe population. However, this stability is not observed for the rs2074292 polymorphism of the MAP3K14 gene in the same population.
Our results concur with those of Tiofack and colleagues, who demonstrated the consistency of their study population p = 1 [18]. These similarities and differences can be explained by the homogeneity of the rs1883832 polymorphism of the CD40 gene in the study population, on the one hand, and by the heterogeneity of the rs2074292 polymorphism of the MAP3K14 gene in the study population, on the other.
We observe that the rs2074292 polymorphism of the MAP3K14 gene offers protection and reduces the risk of developing breast cancer. The p‐values for allele G and genotype AG are represented by p = 0.001 and p < 0.001, respectively. Our results differ from those found by [19], who were able to demonstrate in another study of hepatocellular carcinomas that the AG genotype was significantly correlated with the onset of carcinomas with p = 0.005. In the same study, it was shown that the A allele was associated with mRNA expression and would be a protective factor for people suffering from hepatitis B and hepatocellular carcinoma (p = 0.044). Indeed, the A allele is thought to regulate mRNA expression, hence its implication in the survival of patients suffering from hepatitis C.
However, our study also revealed that heterozygous AG and the G allele of the MAP3K14 gene would be protective factors against breast cancer, with odds ratios (OR) of 0.08 (95% confidence interval: 0.02–0.024, p < 0.001) and 0.45 (95% confidence interval: 0.28–0.73, p = 0.001). This protection of the rs2074292 polymorphism could be justified for several reasons, including the reduction of oxidative stress by modulating cellular signalling pathways, thus protecting cells from oxidative damage. This is because the rs2074292 polymorphism may improve the immune system's ability to detect and destroy cancer cells before they proliferate, and rs2074292 may improve DNA repair mechanisms, reducing the risk of mutations that can lead to cancer. In addition, this protection of rs2074292 could have clinical implications in genetic screening and personalized medicine. In fact, rs2074292 can be used as a diagnostic marker in breast cancer screening, as genetic tests can be more effectively reframed, and a person carrying this polymorphism could be considered to be at reduced risk, thus influencing screening and surveillance decisions. Also, in the field of personalized medicine, the discovery of the protective effect could make it possible to adapt treatments and preventive measures [20].
The rs1883832 polymorphism of the CD40 gene showed no significant association with the risk of developing breast cancer, with p values of 0.15 for the T allele and 0.05 for the CT genotype, respectively. Our results differ from those found by other researchers, including the study by Jiaxuan Chen et al. [21] (variant of CD40), Hamta et al. [22] Dimitrakopoulos et al. [23] and Deng et al. [24] as well as the study by Zhou et al. in 2015 [25] which found a positive association between this polymorphism and lung cancer in a Chinese population. The TT genotype presented a high risk of developing lung cancer (p = 0.002), as did the TC genotype and the occurrence of breast cancer (p = 0.027). Another study by Tian et al. revealed that the T allele is associated with HCV susceptibility [26]. Several other studies have demonstrated the link between this CT genotype and the T allele and the occurrence of other pathologies apart from breast cancer, serious diseases such as coronary syndrome, cervical cancer, and squamous cell carcinoma [27, 28, 29]. In fact, CD40 promotes immune responses by reducing tumor growth.
This discrepancy could be attributed to the fact that we did not use the same sample categories, but also by the fact that fewer studies have highlighted the role played by this polymorphism in breast cancer. But it's also linked to the size of the sample, which is not large enough. Insufficient sample size affects statistical power, making it difficult to detect a probable link. The effects of other risk factors, such as age, environmental factors, and disease heterogeneity. Finally, fewer studies have highlighted the role played by this polymorphism in breast cancer. This lack of information prevents us from making an objective analysis of its actual involvement with breast cancer.
4.3. Relationship Between Certain Demographic Characteristics and the Expression of Gene Polymorphisms rs2074292 in the MAP3K14 Gene and rs1883832 in the CD40 Gene
The results of our statistical analyses show an association between the AG and CT genotypes respectively for the MAP3K14 gene (p < 0.001) at the level of premenopausal status on the one hand, and on the other hand the family history of the CD40 gene (p = 0.03) and the occurrence of breast cancer. These results contrast with those of several other studies that failed to establish this link [26, 28]. Prolonged exposure to estrogens and carcinogens may be at the root of this link. Long‐term exposure can lead to DNA damage and mutations. No association was reported between either the GG genotypes of the rs2074292 polymorphism or the TT genotype of the rs1883832 polymorphism and parameters such as pre‐ and post‐menopausal status, family history, and age at diagnosis. These results are in line with those found by various other studies [26, 28].
4.4. Genotype Interactions of MAP3K14 Gene rs2074292 and CD40 Gene rs1883832 Polymorphisms in Relation to Breast Cancer Risk
We hypothesize that the synergistic interaction between these two polymorphisms could have a more significant impact on the risk of developing breast cancer. Probable protection was observed between the association of AG and CC genotypes respectively of the MAP3K14 and CD40 genes (OR = 0.07, %IC 95, (0.02–0.25), p < 0.001. This result is a first in Burkina Faso. No previous study has been able to demonstrate the combined effect of these two polymorphisms and a probable protection against breast cancer in Burkina Faso.
5. Limits of Our Research
The limited number of participants in our research, information bias in socio‐demographic and clinical data, and lack of resources concerning previous studies on these two polymorphisms and their involvement in the development of breast cancer would constitute some of the limitations of our study. Furthermore, our research is the first in Burkina Faso to attempt to shed light on the impact of polymorphisms rs2074292 in the MAP3K14 gene and rs1883832 in the CD40 gene on the risk of developing breast cancer in the country. Finally, it would therefore be essential and relevant to increase our sample size to objectively evaluate these two polymorphisms and the risk of breast cancer development in Burkina Faso.
6. Conclusion
Our research is the first in Burkina Faso to explore the potential link between the polymorphisms rs2074292 in the MAP3K14 gene and rs1883832 in the CD40 gene in relation to the onset of breast cancer in women in this country. A probable protection was observed between the AG genotype and the G allele of the MAP3K14 gene, on the one hand, and the combination of the AG heterozygote of the MAP3K14 gene with that of the wild‐type CC homozygote of the CD40 gene, on the other, and progression to breast cancer. However, no difference was observed between CT genotypes and the T allele of the CD40 gene in relation to the development of breast cancer. This study highlights the genetic impact of these two polymorphisms on the pathogenesis and predisposition to breast cancer in Burkinabe women. At the end of this study, we plan to carry out the study on a larger scale to draw more objective conclusions.
Author Contributions
Mousso Savadogo: writing – review and editing, writing – original draft, investigation. Lassina Traoré: conceptualization, visualization, methodology, writing – review and editing. Abdou Azaque Zouré: conceptualization, investigation, validation, supervision, methodology, writing – review and editing. Touwendpoulimdé Isabelle Kiendrebeogo: data curation and investigation. Pegdwende Abel Sorgho: visualization. Soayebo Dabre: formal analysis and visualization. Aida Djé Djénéba Traore: formal analysis and visualization. Sidonie Ilboudo: formal analysis and visualization. Nafissatou Sanon: formal analysis and visualization. Marc Donald Wilfried Adico: formal analysis and visualization. Minane Nafissa Triande: formal analysis and visualization. Teega‐Wendé Clarisse Ouedraogo: formal analysis and visualization. Rogomenoma Alice Ouedraogo: formal analysis and visualization. Alexis Yobi Sawadogo: supervision. Nayi Zongo: supervision. Hierrhum Aboubacar Bambara: supervision. Christelle M. W. Nadembega: supervision, validation, and visualization. Florencia W. Djigma: supervision, validation, and visualization. Jacques Simpore: validation, supervision, and visualization.
Conflicts of Interest
The authors declare no conflicts of interest.
Transparency Statement
The lead authors, Mousso Savadogo and Lassina Traoré, affirm that this manuscript is an honest, accurate, and transparent account of the study being reported; that no important aspects of the study have been omitted; and that any discrepancies from the study as planned (and, if relevant, registered) have been explained.
Acknowledgments
The author sincerely thanks the other co‐authors for their immense contributions to the success of this study and also the Pietro Annigoni Biomolecular Research Centre (CERBA), 01 BP 364 Ouagadougou 01, Burkina Faso, and the Laboratory of Molecular and Genetic Biology (LABIOGENE), Joseph KI‐ZERBO University, 03 BP 7021 Ouagadougou 03, Burkina Faso, for their remarkable contributions to the success of the study by offering the technical platform for molecular analysis. All authors have read and approved the final version of the manuscript had full access to all of the data in this study and takes complete responsibility for the integrity of the data and the accuracy of the data analysis.
Contributor Information
Mousso Savadogo, Email: moussavado01@gmail.com.
Lassina Traoré, Email: traorelassina27@gmail.com.
Data Availability Statement
The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.
References
- 1. GLOBOCAN , Les Dernières Données Mondiales Sur Le Cancer Montrent Une Incidence Croissante Et De Graves Inégalités, UICC, published 2022, https://www.uicc.org/news/globocan-2022-latest-global-cancer-data-shows-rising-incidence-and-stark-inequities.
- 2. Jemal A., Siegel R., Xu J., and Ward E., “Cancer Statistics, 2010,” CA: A Cancer Journal for Clinicians 60, no. 5 (2010): 277–300, 10.3322/caac.20073. [DOI] [PubMed] [Google Scholar]
- 3. Sung H., Ferlay J., Siegel R. L., et al., “Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries,” CA: A Cancer Journal for Clinicians 71, no. 3 (2021): 209–249, 10.3322/caac.21660. [DOI] [PubMed] [Google Scholar]
- 4. Malinin N. L., Boldin M. P., Kovalenko A. V., and Wallach D., “MAP3K‐Related Kinase Involved in NF‐KB Induction by TNF, CD95 and IL‐1,” Nature 385, no. 6616 (1997): 540–544, 10.1038/385540a0. [DOI] [PubMed] [Google Scholar]
- 5. Chen Y., Lu R., Zheng H., et al., “The NFKB1 Polymorphism (rs4648068) Is Associated With the Cell Proliferation and Motility in Gastric Cancer,” BMC Gastroenterology 15 (2015): 21, 10.1186/s12876-015-0243-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Jiang D. K., Ma X. P., Yu H., et al., “Genetic Variants in Five Novel Loci Including CFB and CD40 Predispose to Chronic Hepatitis B,” Hepatology 62, no. 1 (2015): 118–128, 10.1002/hep.27794. [DOI] [PubMed] [Google Scholar]
- 7. Somé O., Bagué A., Konkobo D., et al., “Breast Cancer in Bobo‐Dioulasso, Burkina Faso: Management Outcomes. Cancer Du Sein À Bobo‐Dioulasso, Burkina Faso: Résultats De La Prise En Charge,” Oncologie 24, no. 2 (2022): 173–184, 10.32604/oncologie.2022.021250. [DOI] [Google Scholar]
- 8. Traoré L., Savadogo M., Zouré A. A., et al., “Carrying SNP rs17506395 (T > G) inTP63gene and CCR5Δ32 Mutation Associated With the Occurrence of Breast Cancer in Burkina Faso,” Open Life Sciences 19, no. 1 (2024): 20220847, 10.1515/biol-2022-0847. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Bambara H. A., Zouré A. A., Sawadogo A. Y., et al., “Breast Cancer: Descriptive Profile of 80 Women Attending Breast Cancer Care in the Department of General and Digestive Surgery of CHU‐YO,” Pan African Medical Journal 28 (2017): 314, 10.11604/pamj.2017.28.314.10203. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Kiendrebeogo I. T., Zoure A. A., Zongo F. I., et al., “Screening of BRCA1 (c.5177_5180delGAAA rs80357867 and c.4986+6T>C rs80358086) and the BRCA2 (c.6445_6446delAT rs80359592) Genes for Breast Cancer Prevention in Burkina Faso,” Ethiopian Journal of Health Sciences 32, no. 4 (2022): 699–708, 10.4314/ejhs.v32i4.5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Zongo N., Ouédraogo S., Bado C., Kaboré A., and Dem A., “Survival of Patients Operated on for Breast Cancer in Ouagadougou/Burkina Faso,” European Journal of Surgical Oncology 48, no. 12 (2022): 2378–2384, 10.1016/j.ejso.2022.07.001. [DOI] [PubMed] [Google Scholar]
- 12. Adico M. D. W., Zouré A. A., Sombié H. K., et al., “Involvement of ERCC1 (rs3212986) and ERCC2 (rs1799793, rs13181) Polymorphisms of DNA Repair Genes in Breast Cancer Occurrence in Burkina Faso,” Molecular Genetics & Genomic Medicine 11, no. 4 (2023): e2134, 10.1002/mgg3.2134. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Dabre S., Zoure A. A., Kiendrébéogo T. I., et al., “Involvement of p.R72P and PIN3 Ins16bp (TP53) Polymorphisms and the I157T (CHEK2) Mutation in Breast Cancer Occurrence in Burkina Faso,” Asian Pacific Journal of Cancer Biology 8, no. 2 (2023): 135–145, 10.31557/apjcb.2023.8.2.135-145. [DOI] [Google Scholar]
- 14. Surakasula A., Nagarjunapu G., and Raghavaiah K., “A Comparative Study of Pre‐ and Post‐Menopausal Breast Cancer: Risk Factors, Presentation, Characteristics and Management,” Journal of Research in Pharmacy Practice 3, no. 1 (2014): 12–18, 10.4103/2279-042X.132704. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Aka E., Horo A., Koffi A., et al., “Expérience Africaine Monocentrique De La Prise En Charge Personnalisée Des Cancers Du Sein À Abidjan: Défis Et Perspectives,” Gynécologie Obstétrique Fertilité & Sénologie. 49, no. 9 (2021): 684–690, 10.1016/j.gofs.2021.03.001. [DOI] [PubMed] [Google Scholar]
- 16. Institut National De La Statistique Et De La Démographie, (INSD) , “Annuaire Statistique 2019,” 2020: 365, www.insd.bf.
- 17. Hartl D. L. and Clark A. G., “Principles of Population Genetics.” 4th ed. (2007).
- 18. Tiofack A. T. Z., Simo G., Ofon E., et al., “The TP63 Gene Polymorphism rs17506395 Is Associated With Early Breast Cancer in Cameroon,” Asian Pacific Journal of Cancer Prevention 21, no. 8 (2020): 2199–2208, 10.31557/APJCP.2020.21.8.2199. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Huang Q., Liu Y., Qiu M., et al., “Potentially Functional Variants of MAP3K14 in the NF‐κB Signaling Pathway Genes Predict Survival of HBV‐Related Hepatocellular Carcinoma Patients,” Frontiers in Oncology 12 (2022), 10.3389/fonc.2022.990160. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Traore L., Nignan N., Kiemde S., et al., “Involvement of CD40 (rs1883832) and MAP3K14 (rs2074292) Genes Polymorphisms in Hepatitis B Virus Infection in Burkina Faso, West Africa,” Journal of Biosciences and Medicine 11, no. 12 (2023): 343–361, 10.4236/jbm.2023.1112026. [DOI] [Google Scholar]
- 21. Chen J., Chen H., Mai H., et al., “A Functional Variant of CD40 Modulates Clearance of Hepatitis B Virus in Hepatocytes via Regulation of the ANXA2/CD40/BST2 Axis,” Human Molecular Genetics 32, no. 8 (2022): 1334–1347, 10.1093/hmg/ddac284. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Hamta A. and Safaei P. G., “Relationship Between Polymorphisms in the CD40 Gene With the Prevalence of Breast Cancer: A Case‐Control Study,” Medical Journal of Tabriz University of Medical Sciences 45, no. 4 (2023): 305–314, 10.34172/mj.2023.34. [DOI] [Google Scholar]
- 23. Dimitrakopoulos F. I. D., Antonacopoulou A. G., Kottorou A. E., et al., “Genetic Variations of CD40 and LTβR Genes Are Associated With Increased Susceptibility and Clinical Outcome of Non‐Small‐Cell Carcinoma Patients,” Frontiers in Oncology 11 (2021): 721577, 10.3389/fonc.2021.721577. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Deng Z. H., Sun M. H., Li Y. S., et al., “Single Nucleotide Polymorphisms in the CD40 Gene Associate With the Disease Susceptibility and Severity in Knee Osteoarthritis in the Chinese Han Population: A Case‐Control Study,” BMC Musculoskeletal Disorders 18, no. 1 (2017): 115, 10.1186/s12891-017-1466-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Zhou G., Wang Y., Fang Z., et al., “CD40‐1C>T Polymorphism and the Risk of Lung Cancer in a Chinese Population,” International Journal of Clinical and Experimental Pathology 8, no. 11 (2015): 15163–15169, https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4713647/. [PMC free article] [PubMed] [Google Scholar]
- 26. Tian T., Huang P., Wu J., et al., “CD40 Polymorphisms Were Associated With HCV Infection Susceptibility Among Chinese Population,” BMC Infectious Diseases 19, no. 1 (2019): 840, 10.1186/s12879-019-4482-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Jiang H., Yuan F. F., Wang H. N., et al., “Compelling Evidence Linking CD40 Gene With Graves' Disease in the Chinese Han Population,” Frontiers in Endocrinology 12 (2021): 759597, 10.3389/fendo.2021.759597. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Krishnappa P., Kong H. M., Mohamad I. B., Voon K., and Somanath S. D., “CD40 Polymorphism in Cervical Carcinoma in a Subset of Malaysian Population,” Journal of Obstetrics and Gynaecology Research 43, no. 5 (2017): 923–928, 10.1111/jog.13277. [DOI] [PubMed] [Google Scholar]
- 29. Zhu M., Li X., Feng Y., et al., “Impact of CD40 Gene Polymorphisms on the Risk of Cervical Squamous Cell Carcinoma: A Case‐Control Study,” BMC Cancer 23, no. 1 (2023): 845, 10.1186/s12885-023-11367-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.