CXCR4/CXCL12 axis promotes lymphatic metastasis in tongue squamous cell carcinoma via PI3K/AKT signaling pathway

Abstract

Background

Given that lymphatic metastasis represents a pivotal determinant of poor clinical outcomes in tongue squamous cell carcinoma (TSCC), this study aimed to elucidate the role of the CXCR4/CXCL12 chemokine axis in TSCC lymphatic metastasis and its clinical significance.

Methods

We examined CXCR4 and CXCL12 expression in 87 TSCC specimens by immunohistochemistry and analyzed their correlation with clinicopathological features. TSCC cell lines with stable CXCR4 overexpression or knockdown were established to investigate cellular functions through proliferation, migration, invasion, and apoptosis assays. Mechanistic studies were conducted using pharmacological inhibitors, western blotting, and lymphatic endothelial cell functional assays. An orthotopic TSCC mouse model was developed to validate findings in vivo. RNA sequencing was performed to analyze global transcriptomic changes.

Results

CXCR4 and CXCL12 were significantly upregulated in TSCC tissues compared to adjacent normal tissues, with expression levels correlating with lymph node metastasis and poor survival. CXCR4 overexpression enhanced TSCC cell proliferation, migration, invasion, and epithelial-mesenchymal transition while suppressing apoptosis. Mechanistically, CXCL12 activated the PI3K/AKT pathway in a time- and dose-dependent manner, and pathway inhibition using AMD3100 or LY294002 attenuated pro-metastatic phenotypes. CXCR4/CXCL12 signaling promoted lymphangiogenesis by enhancing lymphatic endothelial cell proliferation, migration, and tube formation. In vivo, CXCR4 overexpression accelerated tumor growth and lymphatic metastasis, while CXCR4 inhibition showed opposite effects. Transcriptomic analysis revealed comprehensive molecular alterations regulated by CXCR4/CXCL12 signaling.

Conclusions

The CXCR4/CXCL12 axis functions as a crucial mediator of TSCC lymphatic metastasis by promoting tumor cell invasiveness and lymphangiogenesis via the PI3K/AKT pathway. CXCR4 and CXCL12 serve as independent prognostic biomarkers for TSCC lymphatic metastasis and represent promising therapeutic targets for this aggressive malignancy.

Graphical Abstract

Supplementary Information

The online version contains supplementary material available at 10.1186/s12967-025-06707-9.

Background

Tongue squamous cell carcinoma (TSCC) represents one of the most prevalent malignancies in the oral cavity, accounting for approximately 25–40% of all oral cancers [1, 2]. Despite advances in multimodal therapeutic strategies, including surgery, radiotherapy, and chemotherapy, the 5-year survival rate for patients with TSCC remains unsatisfactory, largely due to the high incidence of local invasion and regional lymph node metastasis [3, 4]. Lymphatic metastasis has been definitively established as an independent prognostic factor associated with poor clinical outcomes in TSCC patients [5]. Despite its clinical significance, the molecular mechanisms governing lymphatic metastasis in TSCC remain insufficiently characterized, thereby impeding the development of effective targeted therapeutic interventions. Recent research has increasingly focused on the complex molecular networks driving TSCC progression, with particular attention to the role of chemokine axes in mediating lymphatic metastasis [6, 7].

Chemokines and their receptors have emerged as crucial mediators of tumor progression and metastasis across various cancer types [8]. Among these, the CXC chemokine receptor 4 (CXCR4) and its cognate ligand CXC motif chemokine ligand 12 (CXCL12, also known as stromal cell-derived factor-1, SDF-1) have garnered considerable attention due to their involvement in tumor growth, angiogenesis, and metastasis [9, 10]. The CXCL12/CXCR4 axis is known to play a significant role in the malignant development of various tumors, including esophageal squamous cell carcinoma (ESCC), a related head and neck malignancy, by promoting proliferation, invasion, and metastasis [11]. CXCR4 is a seven-transmembrane G protein-coupled receptor that is widely expressed in various tissues and cell types, including lymphocytes, hematopoietic stem cells, and several cancer cells [12]. Upon binding to CXCL12, CXCR4 activates multiple downstream signaling pathways, such as phosphatidylinositol 3-kinase (PI3K)/protein kinase B (AKT), mitogen-activated protein kinase (MAPK), and Janus kinase/signal transducer and activator of transcription (JAK/STAT), thereby influencing cellular proliferation, survival, and migration [13, 14].

Aberrant expression of CXCR4 has been documented in numerous malignancies, including breast, prostate, lung, and colorectal cancers, and is frequently associated with aggressive tumor behavior and poor patient outcomes [15, 16]. In the context of head and neck squamous cell carcinoma (HNSCC), elevated CXCR4 expression has been correlated with advanced tumor stage, cervical lymph node involvement, and distant metastasis [17, 18]. However, the specific role of the CXCR4/CXCL12 axis in TSCC lymphatic metastasis and its underlying molecular mechanisms have not been comprehensively elucidated.

Lymphatic metastasis is a complex, multistep process that encompasses tumor cell invasion, migration, lymphangiogenesis, and colonization of regional lymph nodes [19]. Epithelial-mesenchymal transition (EMT), characterized by the loss of epithelial markers (such as E-cadherin) and the acquisition of mesenchymal properties (including N-cadherin and vimentin), represents a critical early event in this metastatic cascade [20]. Additionally, lymphangiogenesis, the formation of new lymphatic vessels from pre-existing ones, facilitates the dissemination of tumor cells to regional lymph nodes [21]. The vascular endothelial growth factor-C (VEGF-C)/VEGF receptor-3 (VEGFR-3) signaling pathway plays a pivotal role in promoting lymphangiogenesis and lymphatic metastasis [22]. However, whether and how the CXCR4/CXCL12 axis influences EMT and lymphangiogenesis in TSCC remains largely unexplored.

The PI3K/AKT signaling pathway constitutes one of the most frequently dysregulated pathways in human cancers, including TSCC [23]. Activation of this pathway has been implicated in various aspects of tumor progression, such as cell proliferation, survival, metabolism, and metastasis [24]. Recent studies have suggested a potential crosstalk between CXCR4/CXCL12 signaling and the PI3K/AKT pathway in certain cancer types [25, 26]. Nevertheless, the role of PI3K/AKT signaling in mediating CXCR4/CXCL12-induced lymphatic metastasis in TSCC warrants further investigation.

In this study, we aimed to systematically investigate the role of the CXCR4/CXCL12 chemokine axis in tongue squamous cell carcinoma (TSCC) lymphatic metastasis and its clinical significance. Our specific objectives were to elucidate the expression patterns, clinical significance, functional roles, and underlying molecular mechanisms through which the CXCR4/CXCL12 axis orchestrates TSCC lymphatic metastasis, with a particular focus on its regulatory effects on lymphangiogenesis and tumor cell invasiveness.

Methods

Patient samples and tissue specimens

Tumor specimens and adjacent normal tissues were harvested from 87 TSCC patients who underwent surgical resection at the First People's Hospital of Yunnan Province between January 2017 and December 2020. Patients were followed up for 12–60 months, with a median follow-up period of 36 months. None of the patients received preoperative radiotherapy, chemotherapy, or immunotherapy. Clinical information, including age, gender, tumor size, TNM stage, histological grade, and lymph node metastasis status, was obtained from medical records. The study protocol was approved by the Ethics Committee of the First People's Hospital of Yunnan Province (approval number: KHLL2020-KY032), and written informed consent was obtained from all participants. The clinicopathological characteristics of the patients are summarized in Table 1.

Table 1.

Clinicopathological characteristics of TSCC patients and their association with CXCR4 and CXCL12 expression

Characteristic	Total	CXCR4 expression			CXCL12 expression
		Low (n = 43)	High (n = 44)	p-value	Low (n = 44)	High (n = 43)	p-value
Age (years)
< 60	41	22 (53.7%)	19 (46.3%)	0.462	21 (51.2%)	20 (48.8%)	0.763
≥ 60	46	21 (45.7%)	25 (54.3%)		23 (50.0%)	23 (50.0%)
Gender
Male	52	26 (50.0%)	26 (50.0%)	0.894	27 (51.9%)	25 (48.1%)	0.712
Female	35	17 (48.6%)	18 (51.4%)		17 (48.6%)	18 (51.4%)
T stage
T1–T2	51	32 (62.7%)	19 (37.3%)	0.005*	33 (64.7%)	18 (35.3%)	0.002*
T3–T4	36	11 (30.6%)	25 (69.4%)		11 (30.6%)	25 (69.4%)
Lymph node metastasis
No	52	35 (67.3%)	17 (32.7%)	< 0.001*	36 (69.2%)	16 (30.8%)	< 0.001*
Yes	35	8 (22.9%)	27 (77.1%)		8 (22.9%)	27 (77.1%)
TNM stage
I–II	47	31 (66.0%)	16 (34.0%)	0.001*	32 (68.1%)	15 (31.9%)	< 0.001*
III–IV	40	12 (30.0%)	28 (70.0%)		12 (30.0%)	28 (70.0%)
Histological grade
Well/Moderate	63	33 (52.4%)	30 (47.6%)	0.343	34 (54.0%)	29 (46.0%)	0.247
Poor	24	10 (41.7%)	14 (58.3%)		10 (41.7%)	14 (58.3%)

*Statistically significant (p < 0.05)

Immunohistochemistry (IHC)

Formalin-fixed, paraffin-embedded tissue sections (4 μm) were deparaffinized in xylene and rehydrated through graded ethanol. Antigen retrieval was performed using citrate buffer (pH 6.0) in a pressure cooker for 3 min. Endogenous peroxidase activity was quenched with 3% hydrogen peroxide for 10 min. After blocking with 5% normal goat serum (Vector Laboratories, CatS-1000) for 30 min at room temperature, sections were incubated with primary antibodies against CXCR4 (1:100, Abcam, Catab124824), CXCL12 (1:100, Abcam, Catab9797), E-cadherin (1:200, Cell Signaling Technology, Cat3195), N-cadherin (1:200, Cell Signaling Technology, Cat13116), Vimentin (1:200, Cell Signaling Technology, Cat5741), and D2-40 (1:100, Dako, CatM3619) overnight at 4°C. After washing with PBS, sections were incubated with HRP-conjugated secondary antibody (Vector Laboratories, Cat # MP-7401) for 30 min at room temperature. Immunoreactivity was visualized using 3,3′-diaminobenzidine (DAB, Vector Laboratories, Cat SK-4100), and sections were counterstained with hematoxylin. Images were captured using an Olympus BX53 microscope equipped with a DP73 camera (Olympus, Tokyo, Japan).

The immunohistochemical staining was evaluated independently by two pathologists who were blinded to the clinical data. The staining intensity was categorized as 0 (negative), 1 (weak), 2 (moderate), or 3 (strong), while the percentage of positive cells was scored as 0 (0%), 1 (1–25%), 2 (26–50%), 3 (51–75%), or 4 (76–100%). The IHC score was calculated by multiplying the intensity score by the percentage score, yielding a final score ranging from 0 to 12. For statistical analysis, patients were stratified into low and high-expression groups based on the median IHC score (score 6), with scores ≤ 6 classified as low expression and scores > 6 classified as high expression.

Cell lines and culture conditions

Human TSCC cell lines CAL-27 and HSC-3 were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA). Normal human oral keratinocytes (HOK) were purchased from ScienCell Research Laboratories (Carlsbad, CA, USA). Human lymphatic endothelial cells (HLECs) were obtained from PromoCell (Heidelberg, Germany). CAL-27 and HSC-3 cells were maintained in DMEM (Gibco, Cat11965-092) containing 10% FBS. HOK cells were cultured in Oral Keratinocyte Medium (ScienCell, Cat2611) according to the manufacturer's instructions. HLECs were grown in Endothelial Cell Growth Medium MV2 (PromoCell, CatC-22022) supplemented with 5% FBS and growth factors. All cells were incubated at 37 °C in a humidified atmosphere with 5% CO2. All cell lines were authenticated by short tandem repeat (STR) profiling and regularly tested for mycoplasma contamination using PCR-based detection methods. Only mycoplasma-negative cells within 10 passages from authentication were used for experiments to ensure data reliability.

Generation of stable cell lines

Lentiviral vectors expressing CXCR4 shRNA (shCXCR4) or non-targeting control shRNA (shControl) were constructed by cloning the target sequences into the pLKO.1 vector (Addgene, Cat10878). The shRNA sequences for CXCR4 were as follows: 5′-GCAGCCTGTACTTGTCCGTCAT-3′ (shCXCR4-1) and 5′-GATGACTTGTCCGTCAGGAAA-3′ (shCXCR4-2). For CXCR4 overexpression, the full-length human CXCR4 cDNA was amplified by PCR and cloned into the pLVX-Puro vector (Clontech, Cat632164). Recombinant lentiviruses were produced by co-transfecting 293 T cells with the lentiviral vectors, psPAX2 (Addgene, Cat12260), and pMD2.G (Addgene, Cat12259) using Lipofectamine 3000 (Invitrogen, CatL3000015). Virus-containing supernatants were collected 48 h after transfection, filtered through a 0.45 μm filter, and used to infect target cells in the presence of 8 μg/ml polybrene (Sigma-Aldrich, CatH9268). Stably transduced cells were selected with 2 μg/ml puromycin (Invitrogen, CatA1113803) for 10 days. The efficiency of CXCR4 knockdown or overexpression was confirmed by quantitative real-time PCR (qRT-PCR) and western blotting.

Cell proliferation assay

Cell proliferation kinetics were quantitatively assessed using the Cell Counting Kit-8 (CCK-8, Dojindo Laboratories, CatCK04) according to the manufacturer's protocol, with minor modifications to optimize sensitivity. Briefly, cells were seeded at a precisely calibrated density of 2 × 10³ cells per well in 96-well plates (n = 6 wells per condition), and absorbance was measured at 450 nm using a microplate spectrophotometer with background subtraction at 630 nm. Cell doubling times were calculated during the exponential growth phase using the formula Td = (t2-t1) × log(2)/log(N2/N1), where N1 and N2 represent the cell numbers at times t1 and t2, respectively.

Briefly, cells were seeded in 96-well plates at a density of 2 × 10³ cells per well and cultured for 24, 48, 72, or 96 h. For CXCL12 stimulation experiments, cells were serum-starved for 12 h and then treated with recombinant human CXCL12 (100 ng/ml, R&D Systems, Cat350-NS) or vehicle control. At each time point, 10 μl of CCK-8 solution was added to each well and incubated for 2 h at 37°C. The absorbance was measured at 450 nm using a microplate reader (BioTek, Winooski, VT, USA). For inhibitor studies, cells were pretreated with AMD3100 (10 μM, Sigma-Aldrich, CatA5602) or LY294002 (20 μM, Selleck Chemicals, CatS1105) for 1 h before CXCL12 stimulation.

Colony formation assay

Cells were seeded in 6-well plates at a density of 500 cells per well and cultured for 14 days. The medium was changed every 3 days. Colonies were fixed with 4% paraformaldehyde for 15 min and stained with 0.1% crystal violet (Sigma-Aldrich, CatC0775) for 20 min. The number of colonies (> 50 cells per colony) was counted under a light microscope.

CXCL12 enzyme-linked immunosorbent assay (ELISA)

The concentration of CXCL12 in cell culture supernatants (serum-free medium as Control and CAL-27 conditioned medium collected after 48 h) was quantified using a human CXCL12 ELISA kit (AiFang Biotechnology, Wuhan, China) according to the manufacturer’s instructions. Absorbance was read wavelength, and CXCL12 concentrations were determined by comparison with a standard curve.

Cell migration and invasion assays

Cell migration and invasion were evaluated using Transwell chambers (8 μm pore size, Corning, Cat3422) without or with Matrigel coating (BD Biosciences, Cat354234), respectively. For the migration assay, 2 × 10⁴ cells in serum-free medium were seeded in the upper chamber, while the lower chamber was filled with medium containing 10% FBS as a chemoattractant. For CXCL12 stimulation, recombinant human CXCL12 (100 ng/ml) was added to the lower chamber. The concentration of 100 ng/ml in this study was chosen based on reports in the literature [27] and our preliminary dose–response experiments demonstrating robust activation of the PI3K/AKT signaling pathway at this concentration. To assess the role of tumor-secreted CXCL12, conditioned medium (CM) was prepared by culturing CAL-27 cells in serum-free DMEM for 48 h; the supernatant was then collected and centrifuged. For these experiments with CAL-27 cells, serum-free medium or CM was added to the lower chamber. Where indicated, CM was pre-incubated with a CXCL12 neutralizing antibody (R&D Systems, Cat# MAB350, 10 µg/ml) or an isotype control IgG antibody (R&D Systems, Cat# MAB002) for 1 h at 37 °C before use. For experiments with the HSC-3 cell line, cells were seeded as above, and the lower chamber contained serum-free medium (Control), medium with recombinant human CXCL12 (100 ng/ml), or medium with CXCL12 (100 ng/ml) plus a 1-h pre-treatment of cells with AMD3100 (10 μM). After 24 h of incubation, non-migrated cells on the upper surface of the membrane were removed with a cotton swab, and migrated cells on the lower surface were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet. For the invasion assay, the upper chambers were precoated with Matrigel (1:8 dilution) before cell seeding, and the incubation time was extended to 48 h. The number of migrated or invaded cells was counted in five random fields under a light microscope (200 × magnification).

Wound healing assay

Cells were seeded in 6-well plates and grown to 90% confluence. A sterile 200 μl pipette tip was used to create a scratch wound. After washing with PBS to remove detached cells, a serum-free medium containing recombinant human CXCL12 (100 ng/ml) or vehicle control was added. Images of the wound area were captured at 0, 6, and 24 h using an inverted microscope (Olympus IX71). The wound closure percentage was calculated using ImageJ software (National Institutes of Health, Bethesda, MD, USA).

Flow cytometry analysis of apoptosis

Apoptosis was assessed using the Annexin V-FITC/PI Apoptosis Detection Kit (BD Biosciences, Cat556547) according to the manufacturer's instructions. Briefly, cells were harvested, washed twice with cold PBS, and resuspended in 1 × binding buffer at a concentration of 1 × 10⁶ cells/ml. Then, 100 μl of the cell suspension was incubated with 5 μl of Annexin V-FITC and 5 μl of propidium iodide (PI) for 15 min at room temperature in the dark. After adding 400 μl of 1 × binding buffer, the samples were analyzed using a BD FACSCalibur flow cytometer (BD Biosciences). The data were analyzed using FlowJo software (TreeStar, Ashland, OR, USA).

RNA isolation and quantitative real-time PCR

Total RNA was extracted from cells and tissues using TRIzol reagent (Invitrogen, Cat15596026) according to the manufacturer's instructions. RNA quality and quantity were assessed using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific). Complementary DNA (cDNA) was synthesized from 1 μg of total RNA using the PrimeScript RT Reagent Kit (Takara, CatRR037A). qRT-PCR was performed using the SYBR Premix Ex Taq II kit (Takara, CatRR820A) on a LightCycler 480 II Real-Time PCR System (Roche). The PCR conditions were as follows: initial denaturation at 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 30 s. The relative gene expression was calculated using the 2^−ΔΔCt method with GAPDH as an internal control. The primer sequences used in this study are listed in Table 2.

Table 2.

Primer sequences used for qRT-PCR analysis

Gene	Forward primer (5′−3′)	Reverse primer (5′−3′)
CXCR4	ACTACACCGAGGAAATGGGCT	CCCACAATGCCAGTTAAGAAGA
CXCL12	ATTCTCAACACTCCAAACTGTGC	ACTTTAGCTTCGGGTCAATGC
E-cadherin	CGAGAGCTACACGTTCACGG	GGGTGTCGAGGGAAAAATAGG
N-cadherin	TCAGGCGTCTGTAGAGGCTT	ATGCACATCCTTCGATAAGACTG
Vimentin	GACGCCATCAACACCGAGTT	CTTTGTCGTTGGTTAGCTGGT
PI3K3CA	CCACGACCATCATCAGGTGAA	CCTCACGGAGGCATTCTAAAGT
AKT1	AGCGACGTGGCTATTGTGAAG	GCCATCATTCTTGAGGAGGAAGT
PTEN	TGGATTCGACTTAGACTTGACCT	GGTGGGTTATGGTCTTCAAAAGG
VEGF-C	GAGGAGCAGTTACGGTCTGTG	TCCTTTCCTTAGCTGACACTTGT
VEGFR-3	CCCACCCAGCAATGTGAACAG	GGTTGTCATGCACCTGTCATC
Prox1	CAGCCCGAAAAGAACAGAAGT	GGGTCTAGCTCGCACATCTC
GAPDH	GGAGCGAGATCCCTCCAAAAT	GGCTGTTGTCATACTTCTCATGG

Western blot analysis

Cells and tissues were lysed in RIPA buffer (Beyotime, CatP0013B) supplemented with protease and phosphatase inhibitor cocktails (Roche, Cat4693159001 and 4906845001). Nuclear and cytoplasmic fractions were extracted using the Nuclear and Cytoplasmic Protein Extraction Kit (Beyotime, CatP0027) according to the manufacturer's instructions. Protein concentration was determined using the BCA Protein Assay Kit (Thermo Fisher Scientific, Cat23225). Equal amounts of protein (30 μg) were separated by SDS-PAGE and transferred to PVDF membranes (Millipore, CatIPVH00010). After blocking with 5% non-fat milk in TBST for 1 h at room temperature, the membranes were incubated with primary antibodies overnight at 4°C. The following primary antibodies were used: CXCR4 (1:1000, Abcam, Catab124824), CXCL12 (1:1000, Abcam, Catab9797), PI3K (1:1000, Cell Signaling Technology, Cat4249), p-AKT (Ser473) (1:1000, Cell Signaling Technology, Cat4060), AKT (1:1000, Cell Signaling Technology, Cat4691), E-cadherin (1:1000, Cell Signaling Technology, Cat3195), N-cadherin (1:1000, Cell Signaling Technology, Cat13116), Vimentin (1:1000, Cell Signaling Technology, Cat5741), VEGF-C (1:1000, Abcam, Catab9546), VEGFR-3 (1:1000, Abcam, Catab27278), Prox1 (1:1000, Abcam, Catab199359), and β-actin (1:5000, Sigma-Aldrich, CatA5316). For specific experiments with HSC-3 cells, cells were serum-starved overnight, then treated with serum-free medium (Control), recombinant human CXCL12 (100 ng/ml) for 30 min, or CXCL12 (100 ng/ml) following a 1-h pre-treatment with AMD3100 (10 μM) before lysis. After washing with TBST, the membranes were incubated with HRP-conjugated secondary antibodies (1:5000, Cell Signaling Technology, Cat7074 or 7076) for 1 h at room temperature. Protein bands were visualized using the ECL Plus Western Blotting Substrate (Thermo Fisher Scientific, Cat32132) and detected with the ChemiDoc XRS + system (Bio-Rad). Densitometric analysis was performed using ImageJ software.

Immunofluorescence staining

Cells grown on coverslips were fixed with 4% paraformaldehyde for 15 min, permeabilized with 0.1% Triton X-100 for 10 min, and blocked with 5% BSA for 1 h at room temperature. The cells were then incubated with primary antibodies against STAT3 (1:200, Cell Signaling Technology, Cat9139) overnight at 4°C. After washing with PBS, the cells were incubated with Alexa Fluor 594-conjugated secondary antibody (1:500, Invitrogen, CatA-11032) for 1 h at room temperature. Nuclei were counterstained with DAPI (Sigma-Aldrich, CatD9542). Images were captured using a Leica TCS SP8 confocal microscope (Leica Microsystems, Wetzlar, Germany).

Tube formation assay

The tube formation assay was performed using growth factor-reduced Matrigel (BD Biosciences, Cat356231). Briefly, 50 μl of Matrigel was added to each well of a 96-well plate and allowed to polymerize at 37 °C for 30 min. HLECs (2 × 10⁴ cells per well) were seeded onto the Matrigel and cultured in the presence of recombinant human CXCL12 (100 ng/ml) or conditioned medium from TSCC cells. The conditioned medium from TSCC CAL-27 cells was prepared by culturing cells in serum-free DMEM for 48 h, followed by collection and centrifugation to remove cell debris. For experiments involving CAL-27 CM, HLECs were cultured with serum-free medium (Control) or CAL-27 CM; where indicated, CM was pre-incubated with a CXCL12 neutralizing antibody (10 µg/ml) or an isotype control IgG antibody (same concentration) for 1 h at 37 °C before addition to HLECs. For inhibitor studies, HLECs were pretreated with AMD3100 (10 μM) or LY294002 (20 μM) for 1 h before CXCL12 stimulation. After 6 h of incubation, tube formation was observed under a light microscope, and images were captured from five random fields. The total tube length was quantified using ImageJ software.

Co-culture system

A co-culture system was established to investigate the interaction between TSCC cells and HLECs. In brief, TSCC cells were seeded in the upper chamber of a Transwell insert (0.4 μm pore size, Corning, Cat3413), while HLECs were cultured in the lower chamber. After 48 h of co-culture, the medium from the lower chamber (conditioned medium) was collected for subsequent experiments, including migration assays and western blot analysis.

Animal studies

All animal experiments were approved by the Institutional Animal Care and Use Committee of the First People's Hospital of Yunnan Province (approval number: KHLL2020-KY032-A01) and conducted in accordance with institutional guidelines. Six-week-old female BALB/c nude mice (n = 40) were purchased from the Laboratory Animal Center of Kunming Medical University and maintained under specific pathogen-free conditions.

For the orthotopic tongue cancer model, mice were randomly divided into four groups (n = 10 per group): Control, CXCR4-KD, CXCR4-OE, and AMD3100 treatment. CAL-27 cells stably expressing shControl, shCXCR4, or CXCR4-OE (1 × 10⁶ cells in 20 μl PBS) were injected into the lateral border of the tongue. For the AMD3100 treatment group, mice injected with CAL-27-shControl cells received AMD3100 (1.25 mg/kg) intraperitoneally every other day starting from day 7 after tumor cell injection. Tumor growth was monitored weekly, and tumor volume was calculated using the formula: V = (length × width²)/2. Three weeks after cell injection, mice were euthanized, and the primary tumors and cervical lymph nodes were harvested for further analysis.

Histopathological and immunohistochemical analysis of mouse tissues

Primary tumors and cervical lymph nodes were fixed in 4% paraformaldehyde, embedded in paraffin, and sectioned at 4 μm thickness. Hematoxylin and eosin (H&E) staining was performed to assess tumor morphology and lymph node metastasis. Immunohistochemical staining for CXCR4, CXCL12, E-cadherin, N-cadherin, Vimentin, and D2-40 was conducted as described earlier. The Lymphatic vessel density (LVD) was determined using a computer-assisted image analysis system (Image-Pro Plus 6.0, Media Cybernetics) by quantifying D2-40-positive vessels in five non-overlapping high-power fields (200 × magnification, 0.94 mm² per field) selected by systematic random sampling. LVD was expressed as the mean number of lymphatic vessels per mm² tissue area. To minimize observer bias, all quantifications were performed independently by two investigators blinded to the experimental groups, with an inter-observer variability of less than 10%.

RNA sequencing and bioinformatic analysis

Total RNA was extracted from CAL-27-shControl, CAL-27-shCXCR4, and CAL-27-CXCR4-OE cells using the RNeasy Mini Kit (Qiagen, Cat74104) according to the manufacturer's instructions. RNA quality was assessed using an Agilent 2100 Bioanalyzer (Agilent Technologies). Library preparation and RNA sequencing were performed at Novogene Bioinformatics Technology Co., Ltd. (Beijing, China) using the Illumina NovaSeq 6000 platform. Clean reads were mapped to the human reference genome (GRCh38) using HISAT2. Differential gene expression analysis was performed using the DESeq2 R package with the criteria of |log2FoldChange|> 1 and adjusted p < 0.05. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses were conducted using the clusterProfiler R package.

Statistical analysis

Statistical analyses were performed using SPSS 23.0 (IBM, Armonk, NY, USA) and GraphPad Prism 8.0 (GraphPad Software, San Diego, CA, USA). Continuous variables are presented as mean ± standard deviation (SD). Differences between two groups were analyzed using Student's t-test, while comparisons among multiple groups were performed using one-way analysis of variance (ANOVA) followed by Tukey's post hoc test. The chi-square test or Fisher's exact test was used to evaluate the association between CXCR4/CXCL12 expression and clinicopathological parameters. Survival curves were plotted using the Kaplan–Meier method and compared with the log-rank test. Univariate and multivariate Cox regression analyses were employed to identify independent prognostic factors. Receiver operating characteristic (ROC) curve analysis was conducted to assess the predictive value of CXCR4 and CXCL12 for lymph node metastasis. All statistical tests were two-sided, and p < 0.05 was considered statistically significant.

Results

CXCR4 and CXCL12 are upregulated in TSCC tissues and correlate with lymphatic metastasis and poor prognosis

To elucidate the potential contribution of the CXCR4/CXCL12 axis to TSCC progression, we initially examined the expression profiles of CXCR4 and CXCL12 in TSCC tissues (n = 87), matched lymphoid tissues, and adjacent normal tissues by IHC. As demonstrated in Fig. 1a and b, both CXCR4 and CXCL12 exhibited significantly elevated expression in TSCC tissues compared to normal tissues (p < 0.001), with lymphoid tissues demonstrating intermediate expression levels. Quantification of IHC scores further confirmed the progressive increase in CXCR4 and CXCL12 expression from normal tissues to lymphoid tissues to TSCC samples (Fig. 1a, b, right panels).

Fig. 1.

CXCR4 and CXCL12 expression in TSCC tissues and their association with patient survival. a Representative immunohistochemical staining of CXCR4 in normal tongue epithelium, lymphoid tissue, and TSCC tissue (left panels) and quantification of IHC scores (right panel). Scale bars, 100 μm. b Representative immunohistochemical staining of CXCL12 in normal tongue epithelium, lymphoid tissue, and TSCC tissue (left panels) and quantification of IHC scores (right panel). Scale bars, 100 μm. c Kaplan–Meier survival analysis of TSCC patients stratified by CXCR4 expression. d Kaplan–Meier survival analysis of TSCC patients stratified by CXCL12 expression. Data are presented as mean ± SD.****p < 0.0001(compared to Control)

We next analyzed the correlation between CXCR4/CXCL12 expression and clinicopathological features in TSCC patients. As summarized in Table 1, high expression of both CXCR4 and CXCL12 was significantly associated with advanced T stage, lymph node metastasis, and higher TNM stage (all p < 0.05). To further assess the prognostic significance of CXCR4 and CXCL12 expression, we performed a Kaplan–Meier survival analysis. Patients with high CXCR4 expression exhibited significantly poorer overall survival compared to those with low CXCR4 expression (Fig. 1c, p < 0.01). Similarly, high CXCL12 expression was also associated with reduced overall survival (Fig. 1d, p < 0.01).

Furthermore, univariate and multivariate Cox regression analyses were conducted to identify independent prognostic factors for TSCC patients. As shown in Fig. 8a, both CXCR4 expression (HR = 2.85, 95% CI 1.58–5.12, p < 0.001) and CXCL12 expression (HR = 2.36, 95% CI 1.27–4.38, p = 0.007), along with lymph node metastasis (HR = 3.76, 95% CI 2.04–6.93, p < 0.001), were independent predictors of overall survival in TSCC patients. Collectively, these results indicate that CXCR4 and CXCL12 are upregulated in TSCC tissues and serve as potential prognostic biomarkers for TSCC patients.

Fig. 8.

CXCR4 and CXCL12 serve as predictive biomarkers for lymphatic metastasis in TSCC patients. a Forest plot showing the results of multivariate Cox regression analysis for overall survival in TSCC patients. b Receiver operating characteristic (ROC) curve analysis of CXCR4 expression for predicting lymph node metastasis in TSCC patients. c ROC curve analysis of CXCL12 expression for predicting lymph node metastasis in TSCC patients. d Nomogram for predicting the probability of lymph node metastasis in TSCC patients incorporating CXCR4 expression, CXCL12 expression, tumor size, tumor depth, differentiation, and age. e Calibration curve of the nomogram for predicting lymph node metastasis in TSCC patients. f Kaplan–Meier survival analysis of TSCC patients stratified by risk score based on the nomogram

CXCR4 regulates TSCC cell proliferation, migration, invasion, and apoptosis

To investigate the functional roles of CXCR4 in TSCC progression, we established stable CXCR4-knockdown (CXCR4-KD) and CXCR4-overexpressing (CXCR4-OE) TSCC cell lines using lentiviral vectors. We first examined the effect of CXCR4 on TSCC cell proliferation using the CCK-8 assay. As shown in Fig. 2a, CXCR4 knockdown significantly suppressed the proliferation of TSCC cells compared to the control group, whereas CXCR4 overexpression markedly enhanced cell proliferation. Consistent with these findings, colony formation assays revealed that CXCR4-KD cells formed fewer and smaller colonies, while CXCR4-OE cells formed more and larger colonies compared to control cells (Fig. 2b).

Fig. 2.

CXCR4 regulates TSCC cell proliferation, migration, invasion, and EMT. a Cell proliferation assessed by CCK-8 assay in CAL-27 cells with different CXCR4 expression levels (Control, shControl, shRNA-CXCR4-KD, and shRNA-CXCR4-OE). b Colony formation assay of CAL-27 cells with different CXCR4 expression levels. Representative images (left) and quantification (right). c Transwell migration assay of CAL-27 cells with different CXCR4 expression levels. Representative images (left) and quantification (right). Scale bars, 100 μm. d Transwell invasion assay of CAL-27 cells with different CXCR4 expression levels. Representative images (left) and quantification (right). Scale bars, 100 μm. e Quantification of apoptotic cells measured by flow cytometry. f Representative flow cytometry plots showing apoptosis in CAL-27 cells with different CXCR4 expression levels. g Western blot analysis of EMT markers (E-cadherin, N-cadherin, and Vimentin) in CAL-27 cells with different CXCR4 expression levels. h qRT-PCR analysis of EMT markers in CAL-27 cells with different CXCR4 expression levels. i Wound healing assay showing the effect of CXCL12 on CAL-27 cell migration. Representative images (left) and quantification (right). Scale bars, 100 μm. j Real-time cell analysis (RTCA) showing the effect of CXCL12 on CAL-27 cell migration. Data are presented as mean ± SD from three independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001(compared to Control or Serum-Free); ^#p < 0.05, ^##p < 0.01, ^####p < 0.0001(compared to shControl or Blank-Serum); ^&&p < 0.01, ^&&&&p < 0.0001(compared to shControl- CXCR4-KD)

We next assessed the impact of CXCR4 on TSCC cell migration and invasion using Transwell assays. CXCR4 knockdown significantly reduced the migratory and invasive capabilities of TSCC cells, whereas CXCR4 overexpression had the opposite effect (Fig. 2c, d). Furthermore, flow cytometric analysis demonstrated that CXCR4 knockdown increased the apoptotic rate of TSCC cells, while CXCR4 overexpression decreased apoptosis (Fig. 2e, f).

Epithelial-mesenchymal transition (EMT) plays a crucial role in tumor metastasis by enhancing cancer cell motility and invasiveness. We therefore investigated whether CXCR4 modulates EMT in TSCC cells. Western blot analysis demonstrated that CXCR4 knockdown significantly upregulated the expression of the epithelial marker E-cadherin (2.6-fold increase, p < 0.01) and concurrently downregulated the expression of the mesenchymal markers N-cadherin and Vimentin (68% and 73% reduction, respectively; p < 0.001) (Fig. 2g). Conversely, CXCR4 overexpression markedly suppressed E-cadherin expression (71% reduction, p < 0.01) while enhancing N-cadherin and Vimentin expression (3.2-fold and 2.8-fold increase, respectively; p < 0.001). Consistent patterns were observed at the mRNA level, as validated by qRT-PCR (Fig. 2h), confirming the regulatory effect of CXCR4 on EMT in TSCC cells.

In parallel, we examined the effects of CXCL12 stimulation on TSCC cell migration. Wound healing assays showed that CXCL12 treatment significantly enhanced the migratory ability of TSCC cells compared to serum-free controls (Fig. 2i). Real-time cell analysis (RTCA) further confirmed the pro-migratory effect of CXCL12 on TSCC cells (Fig. 2j). Together, these results demonstrate that CXCR4/CXCL12 signaling promotes TSCC cell proliferation, migration, invasion, and EMT while inhibiting apoptosis.

The PI3K/AKT pathway mediates CXCR4/CXCL12-induced TSCC progression

To decipher the precise molecular mechanisms underlying CXCR4/CXCL12-mediated TSCC progression, we systematically investigated potential downstream signaling cascades. Since the PI3K/AKT pathway represents one of the most frequently dysregulated signaling networks in TSCC and has been implicated in cancer metastasis, we specifically examined its involvement in CXCR4/CXCL12 signaling in TSCC cells.

Western blot analysis revealed that CXCL12 stimulation robustly activated the PI3K/AKT pathway in a time-dependent manner, as evidenced by significantly increased phosphorylation of AKT at Ser473 (p-AKT) without altering total AKT expression (Fig. 3a). Densitometric analysis indicated a 5.7-fold increase in p-AKT/AKT ratio at 60 min post-stimulation compared to baseline (p < 0.001, n = 3 independent experiments). The activation of PI3K/AKT signaling was observed as early as 5 min after CXCL12 treatment and reached a maximum of 60 min. Similarly, CXCL12 activated the PI3K/AKT pathway in a dose-dependent manner, with the most robust activation observed at a concentration of 200 ng/ml (Fig. 3b).

Fig. 3.

The PI3K/AKT pathway mediates CXCR4/CXCL12-induced TSCC progression. a Western blot analysis of PI3K, p-AKT, and AKT in CAL-27 cells treated with CXCL12 (100 ng/ml) for the indicated times (0, 5, 15, 30, and 60 min). Representative blots (left) and quantification (right). b Western blot analysis of PI3K, p-AKT, and AKT in CAL-27 cells treated with different concentrations of CXCL12 (0, 10, 50, 100, and 200 ng/ml) for 30 min. Representative blots (left) and quantification (right). c Western blot analysis of PI3K, p-AKT, and AKT in CAL-27 cells treated with CXCL12 (100 ng/ml), AMD3100 (10 μM), or CXCL12 + AMD3100. Representative blots (left) and quantification (right). d Immunofluorescence staining of STAT3 in CAL-27 cells treated with CXCL12 (100 ng/ml) or vehicle control. Scale bars, 20 μm. e Western blot analysis of p-AKT and AKT in CAL-27 cells treated with CXCL12 (100 ng/ml), LY294002 (20 μM), or CXCL12 + LY294002. Representative blots (left) and quantification (right). f Transwell migration assay of CAL-27 cells treated with CXCL12 (100 ng/ml), AMD3100 (10 μM), or CXCL12 + AMD3100. Representative images (left) and quantification (right). Scale bars, 100 μm. g Transwell invasion assay of CAL-27 cells treated with CXCL12 (100 ng/ml), LY294002 (20 μM), or CXCL12 + LY294002. Representative images (left) and quantification (right). Scale bars, 100 μm. h Western blot analysis of EMT markers (E-cadherin, N-cadherin, and Vimentin) in CAL-27 cells treated with CXCL12 (100 ng/ml), AMD3100 (10 μM), LY294002 (20 μM), or combinations. Representative blots (left) and quantification (right). Data are presented as mean ± SD from three independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001(compared to 0 or Control); ^#p < 0.05, ^###p < 0.001, ^####p < 0.0001(compared to AMD3100 or CXCL12); ^&&p < 0.01, ^&&&p < 0.001, ^&&&&p < 0.0001(compared to CXCL12 or CXCL12 + AMD3100)

To verify the specificity of CXCL12-induced PI3K/AKT activation, we employed AMD3100, a highly selective CXCR4 antagonist. Pretreatment with AMD3100 (10 μM) for 1 h significantly attenuated CXCL12-induced phosphorylation of AKT by 78% (p < 0.001), definitively establishing that CXCL12 activates the PI3K/AKT pathway specifically through CXCR4 receptor engagement (Fig. 3c). This demonstrates that blocking CXCR4 activity inhibits the downstream PI3K/AKT signaling induced by CXCL12. Moreover, immunofluorescence staining showed that CXCL12 stimulation promoted the nuclear translocation of STAT3, a known downstream effector of PI3K/AKT signaling (Fig. 3d).

We next investigated whether the PI3K/AKT pathway is essential for CXCR4/CXCL12-mediated TSCC progression. Treatment with the PI3K inhibitor LY294002 significantly suppressed CXCL12-induced AKT phosphorylation (Fig. 3e). Furthermore, both AMD3100 and LY294002 blocked CXCL12-enhanced migration and invasion of TSCC cells (Fig. 3f-g). Similarly, these inhibitors reversed CXCL12-induced changes in EMT markers, restoring E-cadherin expression and reducing N-cadherin and Vimentin expression (Fig. 3h).

Additionally, we examined the effects of CXCR4 modulation on PI3K/AKT signaling in TSCC cells. CXCR4 overexpression increased PI3K expression and AKT phosphorylation, while CXCR4 knockdown had the opposite effect (Fig. S2). Collectively, these findings demonstrate that the PI3K/AKT pathway plays a crucial role in mediating CXCR4/CXCL12-induced TSCC progression.

CXCR4/CXCL12 signaling promotes lymphangiogenesis in TSCC

Lymphangiogenesis plays a pivotal role in facilitating lymphatic metastasis in cancer. To elucidate whether and how CXCR4/CXCL12 signaling modulates lymphangiogenesis in TSCC, we established an in vitro lymphangiogenesis model and systematically examined the effects of CXCL12 on HLECs'biological behaviors using multiple complementary approaches. CCK-8 assay showed that CXCL12 treatment significantly enhanced HLEC proliferation compared to the control group (Fig. 4a). Similarly, wound healing assays revealed that CXCL12 remarkably increased the migratory ability of HLECs (Fig. 4b). Furthermore, tube formation assays demonstrated that CXCL12 stimulation promoted HLEC tube formation, as evidenced by increased tube length (Fig. 4c).

Fig. 4.

CXCR4/CXCL12 signaling promotes lymphangiogenesis in TSCC. a Cell proliferation of human lymphatic endothelial cells (HLECs) treated with CXCL12 (100 ng/ml) or vehicle control, assessed by CCK-8 assay. b Wound healing assay showing the effect of CXCL12 on HLEC migration. Representative images (left) and quantification (right). Scale bars, 100 μm. c Tube formation assay of HLECs treated with CXCL12 (100 ng/ml) or vehicle control. Representative images (left) and quantification (right). Scale bars, 100 μm. d Western blot analysis of lymphangiogenic factors (VEGF-C, VEGFR-3, and Prox1) in HLECs treated with CXCL12 (100 ng/ml) or vehicle control. Representative blots (left) and quantification (right). e Western blot analysis of PI3K, p-AKT, and AKT in HLECs treated with CXCL12 (100 ng/ml) or vehicle control. Representative blots (left) and quantification (right). f Tube formation assay of HLECs treated with CXCL12 (100 ng/ml), LY294002 (20 μM), or CXCL12 + LY294002. Representative images (left) and quantification (right). Scale bars, 100 μm. g Schematic representation of the co-culture system used to investigate the interaction between TSCC cells and HLECs. h Transwell migration assay of HLECs co-cultured with CAL-27 cells with different CXCR4 expression levels. Representative images (left) and quantification (right). Scale bars, 100 μm. Data are presented as mean ± SD from three independent experiments. ***p < 0.001, ****p < 0.0001(compared to Control); ^####p < 0.0001(compared to CXCL12)

We next explored the molecular mechanisms underlying CXCL12-induced lymphangiogenesis. Western blot analysis demonstrated that CXCL12 treatment (100 ng/ml for 24 h) significantly upregulated the expression of critical lymphangiogenic factors, including VEGF-C (2.8-fold, p < 0.01), VEGFR-3 (3.2-fold, p < 0.001), and Prox1 (2.4-fold, p < 0.01), in HLECs (Fig. 4d). Importantly, CXCL12 also activated the PI3K/AKT pathway in HLECs, as indicated by increased levels of phosphorylated AKT (Fig. 4e). Moreover, inhibition of the PI3K/AKT pathway with LY294002 attenuated CXCL12-induced tube formation in HLECs (Fig. 4f), suggesting that PI3K/AKT signaling is involved in CXCL12-mediated lymphangiogenesis.

To comprehensively characterize the bidirectional communication between TSCC cells and HLECs within the tumor microenvironment, we established a Transwell co-culture system that enables paracrine interactions while preventing direct cell–cell contact (Fig. 4g). This model allows for the systematic assessment of TSCC cell-derived secretory factors on lymphatic endothelial cell functions. Interestingly, HLECs co-cultured with CXCR4-overexpressing TSCC cells exhibited enhanced migratory capacity compared to those co-cultured with control cells, whereas HLECs co-cultured with CXCR4-knockdown TSCC cells showed reduced migration (Fig. 4h). These findings indicate that CXCR4/CXCL12 signaling promotes lymphangiogenesis by enhancing HLEC proliferation, migration, and tube formation through the activation of the PI3K/AKT pathway and upregulation of lymphangiogenic factors. Our results also indicate that soluble factors secreted by TSCC cells, potentially including CXCL12, are capable of promoting HLEC migration and tube formation, suggesting the possibility of tumor cells influencing lymphangiogenesis through paracrine mechanisms.

CXCR4/CXCL12 axis promotes TSCC growth and lymphatic metastasis in vivo

To validate the role of the CXCR4/CXCL12 axis in TSCC progression and lymphatic metastasis in vivo, we established a clinically relevant orthotopic TSCC mouse model by precisely injecting CAL-27 cells (Control, CXCR4-KD, or CXCR4-OE) into the lateral border of the tongue of BALB/c nude mice (n = 10 per group). The sample size was determined based on power analysis with 80% power to detect a 50% difference in metastasis rate at a significance level of 0.05. Additionally, a group of mice injected with control cells received AMD3100 treatment (Fig. 5a). Tumor growth was monitored for three weeks. As shown in Fig. 5b, CXCR4 overexpression significantly accelerated tumor growth, while CXCR4 knockdown or AMD3100 treatment markedly suppressed tumor growth compared to the control group. Consistent with these findings, the final tumor weight at the endpoint was highest in the CXCR4-OE group and lowest in the CXCR4-KD and AMD3100 groups (Fig. 5c).

Fig. 5 .

CXCR4/CXCL12 axis promotes TSCC growth and lymphatic metastasis in vivo. a Schematic representation of the orthotopic TSCC mouse model. b Tumor growth curves of CAL-27 cells with different CXCR4 expression levels (Control, CXCR4-KD, CXCR4-OE) or treated with AMD3100. c Tumor weight at the endpoint. d Lymph node metastasis rates in different groups. e Representative images of H&E staining of cervical lymph nodes at low magnification (100 ×). Scale bars, 200 μm. f Representative images of H&E staining of cervical lymph nodes at high magnification (400 ×). Scale bars, 50 μm. g Immunohistochemical staining of CXCR4 and CXCL12 in primary tumors from different groups. Scale bars, 100 μm. h Immunohistochemical staining of EMT markers (E-cadherin, N-cadherin, and Vimentin) in primary tumors from different groups. Scale bars, 100 μm. i Quantification of lymphatic vessel density (LVD) in primary tumors from different groups. Data are presented as mean ± SD. ****p < 0.0001(compared to Control); ^###p < 0.001, ^####p < 0.0001(compared to CXCR4-KD); ^&&&&p < 0.0001 (compared to CXCR4-OE)

We next examined the effect of CXCR4/CXCL12 signaling on lymphatic metastasis. Comprehensive histopathological analysis of cervical lymph nodes, performed by two independent pathologists blinded to the experimental groups, revealed that the incidence of lymph node metastasis was significantly higher in the CXCR4-OE group (7/10, 70%) compared to the control group (4/10, 40%; p < 0.05), while it was markedly reduced in both the CXCR4-KD (2/10, 20%; p < 0.01 vs. control) and AMD3100-treated (3/10, 30%; p < 0.05 vs. control) groups (Fig. 5d–f). Moreover, the metastatic tumor burden, as measured by the ratio of metastatic to total lymph node area, was 3.2-fold higher in the CXCR4-OE group compared to controls (p < 0.001). Immunohistochemical staining of the primary tumors confirmed that CXCR4 and CXCL12 expression was highest in the CXCR4-OE group and lowest in the CXCR4-KD and AMD3100 groups (Fig. 5g). Moreover, CXCR4 overexpression was associated with decreased E-cadherin and increased N-cadherin and Vimentin expression, indicating enhanced EMT (Fig. 5h). In contrast, CXCR4 knockdown or AMD3100 treatment exhibited the opposite effects.

Furthermore, immunohistochemical staining for D2-40, a specific marker for lymphatic endothelial cells, revealed that the lymphatic vessel density (LVD) was significantly higher in the CXCR4-OE group and lower in the CXCR4-KD and AMD3100 groups compared to the control group (Fig. 5i, j). These in vivo findings corroborate our in vitro results and demonstrate that the CXCR4/CXCL12 axis promotes TSCC growth, EMT, lymphangiogenesis, and lymphatic metastasis.

Transcriptomic analysis reveals the molecular landscape regulated by XCR4/CXCL12 signaling in TSCC

To gain comprehensive insights into the global molecular landscape regulated by CXCR4/CXCL12 signaling in TSCC, we performed high-throughput RNA sequencing (RNA-seq) to systematically profile the transcriptome of CAL-27 cells with differential CXCR4 expression levels (Control, CXCR4-KD, and CXCR4-OE). Three biological replicates were sequenced for each condition, generating approximately 60 million paired-end reads per sample with > 90% mapping rate to the human reference genome (GRCh38). Principal component analysis (PCA) showed a clear separation of the three groups, indicating distinct gene expression patterns (Fig. 6a). Volcano plots revealed numerous differentially expressed genes (DEGs) between Control vs. CXCR4-KD (Fig. 6b) and Control vs. CXCR4-OE (Fig. 6c) comparisons.

Fig. 6.

Transcriptomic analysis of CXCR4/CXCL12-regulated gene expression in TSCC. a Principal component analysis (PCA) of RNA-seq data from CAL-27 cells with different CXCR4 expression levels (Control, CXCR4-KD, and CXCR4-OE). b Volcano plot showing differentially expressed genes (DEGs) between Control and CXCR4-KD CAL-27 cells. c Volcano plot showing DEGs between Control and CXCR4-OE CAL-27 cells. d Heatmap of DEGs between Control and CXCR4-KD CAL-27 cells. e Heatmap of DEGs between Control and CXCR4-OE CAL-27 cells. f qRT-PCR validation of selected DEGs (PI3K3CA, AKT1, PTEN, CXCL12, and CXCR4) in CAL-27 cells with different CXCR4 expression levels. g Western blot validation of selected DEGs in CAL-27 cells with different CXCR4 expression levels. Representative blots (left) and quantification (right). h Proposed mechanistic model illustrating how the CXCR4/CXCL12 axis promotes TSCC lymphatic metastasis through the PI3K/AKT pathway. Data are presented as mean ± SD from three independent experiments. ^*p < 0.05, ^**p < 0.01, ***p < 0.001, ****p < 0.0001 (compared to Control); ^##p < 0.01, ^###p < 0.001, ^####p < 0.0001(compared to CXCR4-OE)

Hierarchical clustering of the DEGs demonstrated that CXCR4 knockdown and overexpression resulted in distinct gene expression profiles compared to the control group (Fig. 6d, e). To validate the RNA-seq findings, we selected several key genes for qRT-PCR and western blot analyses. The expression patterns of key genes, including PI3K3CA, AKT1, PTEN, CXCL12, and CXCR4, were consistent with the RNA-seq results, as validated by qRT-PCR and Western blot analyses (Fig. 6f, g). CXCR4 overexpression led to increased expression of PI3K3CA and AKT1 and decreased expression of PTEN, while CXCR4 knockdown had the opposite effects. These findings further support the involvement of the PI3K/AKT pathway in CXCR4/CXCL12 signaling.

To identify the biological processes and pathways affected by CXCR4/CXCL12 signaling, we performed Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses. Gene Ontology (GO) enrichment analysis revealed that differentially expressed genes (DEGs) in the Control vs. CXCR4-KD comparison were significantly enriched in biological processes related to extracellular matrix organization (GO:0030198, fold enrichment = 3.8, FDR = 0.0002), cell adhesion (GO:0007155, fold enrichment = 2.9, FDR = 0.0008), epithelial cell differentiation (GO:0030855, fold enrichment = 2.6, FDR = 0.0015), and regulation of cell migration (GO:0030334, fold enrichment = 2.4, FDR = 0.0024) (Fig. S1a). These functional categories are integrally associated with tumor invasion and metastatic processes, further supporting the central role of CXCR4 in regulating TSCC progression. In contrast, DEGs in the Control vs. CXCR4-OE comparison were enriched in processes associated with keratinization, skin development, epidermis development, and lymphocyte differentiation (Fig. S1b).

KEGG pathway analysis showed that DEGs in the Control vs. CXCR4-KD comparison were enriched in pathways related to the cytoskeleton in muscle cells, cardiomyopathy, and various neurodegenerative diseases (Fig. S1c). In contrast, DEGs in the Control vs. CXCR4-OE comparison were enriched in cancer-related pathways, cytokine-cytokine receptor interaction, T cell-related pathways, and cell adhesion molecules (Fig. S1d). These findings highlight the diverse molecular processes regulated by CXCR4/CXCL12 signaling in TSCC and provide a valuable resource for further investigation.

TSCC-secreted CXCL12 promotes autocrine migration and invasion and paracrine lymphangiogenesis

To investigate the role of tumor cell-derived CXCL12, we first confirmed that CAL-27 TSCC cells secrete CXCL12 into their culture medium; ELISA revealed a significant concentration of CXCL12 in CAL-27 conditioned medium (CM) compared to control medium (Fig. 7g). We then assessed the impact of this autocrine CXCL12. CAL-27 CM significantly enhanced the migratory (Fig. 7a) and invasive (Fig. 7b) capacities of CAL-27 cells themselves compared to control medium. Importantly, these pro-migratory and pro-invasive effects of CM were substantially attenuated by the addition of a CXCL12 neutralizing antibody, but not by an isotype control IgG, indicating that CXCL12 secreted by TSCC cells plays a key role in promoting their own motility and invasiveness.

Fig. 7.

Autocrine and Paracrine Effects of TSCC-Derived CXCL12 and Generalizability of CXCR4/CXCL12 Signaling. a Transwell migration assay of CAL-27 cells stimulated with their own conditioned medium (CM). b Transwell invasion assay of CAL-27 cells under the same conditions as (a). c Tube formation assay of Human Lymphatic Endothelial Cells (HLECs) stimulated with CAL-27 conditioned medium. d Transwell migration assay of HSC-3 TSCC cells. e Transwell invasion assay of HSC-3 cells under the same conditions as (d). f Western blot analysis of phosphorylated AKT (P-AKT) and total AKT in HSC-3 cells. g ELISA quantification of CXCL12 levels in serum-free medium (Control) and CAL-27 conditioned medium (CAL-27 CM) after 48 h of culture. Representative images are shown for A-E. Bar graphs represent quantification of migrated/invaded cells or relative length of tubes, presented as mean ± SD from three independent experiments. ***p < 0.001, ****p < 0.0001 (compared to control); ^###p < 0.001, ^####p < 0.0001 (compared to CM or CXCL12 group); ^&&&p < 0.001, ^&&&&p < 0.0001 (compared to CM + IgG group); ns = not significant

Furthermore, to explore the paracrine effects of TSCC-secreted CXCL12 on lymphangiogenesis, we found that CAL-27 CM significantly promoted tube formation by HLECs (Fig. 7c). This pro-lymphangiogenic effect was also significantly inhibited by the CXCL12 neutralizing antibody, suggesting that CXCL12 from TSCC cells is a critical factor in stimulating lymphatic endothelial cell functions.

Generalizability of CXCR4/CXCL12 signaling in the HSC-3 TSCC cell line

To determine if our findings were applicable to other TSCC cell lines, we examined the effects of CXCL12 on HSC-3 cells. Exogenous recombinant CXCL12 significantly enhanced the migration (Fig. 7d) and invasion (Fig. 7e) of HSC-3 cells. These effects were markedly inhibited by the CXCR4-specific antagonist AMD3100, confirming the involvement of CXCR4. Moreover, CXCL12 stimulation led to a significant increase in AKT phosphorylation (p-AKT) in HSC-3 cells, indicative of PI3K/AKT pathway activation, and this activation was also effectively blocked by AMD3100 (Fig. 7f). These data demonstrate that the CXCL12/CXCR4 axis promotes migration, invasion, and PI3K/AKT signaling in another TSCC cell line, supporting the broader relevance of this pathway.

Based on our experimental findings and transcriptomic analysis, we proposed a mechanistic model illustrating how the CXCR4/CXCL12 axis promotes TSCC lymphatic metastasis (Fig. 6h). In this model, CXCL12 binding to CXCR4 activates the PI3K/AKT signaling pathway, which subsequently induces EMT, enhances tumor cell survival, migration, and invasion, and promotes lymphangiogenesis, ultimately leading to lymphatic metastasis.

CXCR4 and CXCL12 serve as predictive biomarkers for lymphatic metastasis in TSCC patients

Given the crucial role of the CXCR4/CXCL12 axis in TSCC lymphatic metastasis, we sought to evaluate the potential of CXCR4 and CXCL12 as predictive biomarkers for lymph node metastasis in TSCC patients. Receiver operating characteristic (ROC) curve analysis was performed to assess the predictive value of CXCR4 and CXCL12 expression for lymph node metastasis. As shown in Fig. 8b, CXCR4 expression exhibited good discriminatory power with an area under the curve (AUC) of 0.799 (95% CI 0.672–0.951, p = 0.0029). Similarly, CXCL12 expression demonstrated excellent predictive performance with an AUC of 0.861 (95% CI 0.737–0.986, p = 0.0003) (Fig. 8c).

To further improve the predictive accuracy, we combined CXCR4 and CXCL12 expression with traditional clinicopathological parameters to develop a nomogram for predicting the probability of lymph node metastasis in TSCC patients (Fig. 8d). The nomogram incorporated CXCR4 expression, CXCL12 expression, tumor size, tumor depth, differentiation, and age, with each factor assigned a corresponding point score. The total points were then used to estimate the probability of lymph node metastasis. The calibration curve showed good agreement between the predicted and actual probabilities of lymph node metastasis (Fig. 8e).

Finally, we stratified TSCC patients into high-risk and low-risk groups based on the nomogram scores. Kaplan–Meier survival analysis revealed that patients in the high-risk group had significantly worse overall survival compared to those in the low-risk group (Fig. 8f, p < 0.001). These findings suggest that CXCR4 and CXCL12 expression, in combination with clinicopathological parameters, can serve as valuable predictive biomarkers for lymphatic metastasis and prognostic indicators for TSCC patients.

Discussion

Lymphatic metastasis represents a pivotal determinant of poor prognosis in patients with TSCC, with approximately 40% of patients developing regional lymph node involvement at diagnosis. Despite its clinical significance, the molecular mechanisms orchestrating this process remain incompletely elucidated, hampering the development of targeted interventions [28, 29]. In this comprehensive study, we demonstrate that the CXCR4/CXCL12 chemokine axis plays a crucial role in promoting TSCC lymphatic metastasis through multiple mechanisms, including enhanced tumor cell migration and invasion, epithelial-mesenchymal transition (EMT), and lymphangiogenesis, predominantly via the PI3K/AKT signaling pathway. Furthermore, we establish CXCR4 and CXCL12 as promising predictive biomarkers for lymph node metastasis and prognostic indicators for TSCC patients.

Our initial findings revealed significant upregulation of both CXCR4 and CXCL12 in TSCC tissues compared to adjacent normal tissues, with their expression levels positively correlating with advanced T stage, lymph node metastasis, and poor survival outcomes. These observations align with previous reports in other cancer types, including breast [18], colorectal [30], and pancreatic cancers [31], where elevated CXCR4 expression has been associated with aggressive clinicopathological features and adverse prognosis. In the context of head and neck cancers, Andreas et al. [32, 33]. Recently demonstrated that increased CXCR4 expression correlates with lymph node metastasis in oral squamous cell carcinoma (OSCC), while Tohru et al. [34] reported that high CXCL12 levels predict poor survival in nasopharyngeal carcinoma. A recent study specifically investigating OSCC also found significant associations between the expression of CXCL12, CXCR4, PI3K, and AKT proteins and lymph node metastasis, suggesting their potential cooperation [7]. Our study extends these findings specifically to TSCC and establishes both CXCR4 and CXCL12 as independent prognostic factors, highlighting their potential clinical utility.

Functionally, we demonstrated that CXCR4 overexpression enhances TSCC cell proliferation, migration, and invasion while inhibiting apoptosis, whereas CXCR4 knockdown produces opposite effects. Our findings further show that TSCC cells (CAL-27) secrete CXCL12, which then acts in an autocrine manner to significantly enhance their own migration and invasion, effects that were abrogated by a CXCL12 neutralizing antibody. These observations suggest that CXCR4 functions as an oncogenic driver in TSCC, consistent with its role in other malignancies [11, 35]. Notably, we found that CXCR4 modulation significantly influences EMT, a critical process in cancer metastasis characterized by the loss of epithelial markers and acquisition of mesenchymal features [36]. CXCR4 overexpression reduced E-cadherin expression while increasing N-cadherin and Vimentin levels, suggesting enhanced EMT [37]. Conversely, CXCR4 knockdown reversed these changes, indicating EMT suppression. Zhao et al. recently reported that CXCR4 promotes EMT in intrahepatic cholangiocarcinoma through the Wnt/β-catenin pathway [38], while Lin et al. [39] demonstrated that CXCR4 induces EMT in human papillary thyroid carcinoma via the NF-kB pathway. Our findings identify PI3K/AKT as the predominant pathway mediating CXCR4-induced EMT in TSCC, highlighting potential tissue-specific differences in downstream signaling mechanisms.

Mechanistically, we demonstrated that CXCL12 activates the PI3K/AKT pathway in TSCC cells in both time- and dose-dependent manners. This activation was effectively blocked by AMD3100, a specific CXCR4 antagonist, confirming the specificity of CXCL12-CXCR4 interaction in triggering PI3K/AKT signaling. The PI3K/AKT pathway represents one of the most frequently dysregulated pathways in human cancers, including TSCC [40, 41], and its activation has been implicated in various aspects of tumor progression, including cell proliferation, survival, and metastasis [42]. We further validated this mechanism in another TSCC cell line, HSC-3, where exogenous CXCL12 promoted migration and invasion and activated the PI3K/AKT pathway via CXCR4, underscoring the generalizability of these findings. Zhang et al. [43] recently reported that CXCR4/CXCL12-mediated PI3K/AKT activation promotes gastric cancer progression, while Yin et al. [26] demonstrated a similar mechanism in Adamantinomatous craniopharyngiomas. Our study establishes the critical role of this signaling axis in TSCC and further shows that inhibition of either CXCR4 (using AMD3100) or PI3K (using LY294002) effectively attenuates CXCL12-induced pro-metastatic phenotypes, suggesting potential therapeutic strategies. These in vitro experimental results strongly suggest that CXCL12 promotes TSCC progression by activating the CXCR4/PI3K/AKT signaling pathway.

A particularly novel aspect of our study is the demonstration that CXCR4/CXCL12 signaling promotes lymphangiogenesis, a critical process facilitating lymphatic metastasis [44]. We found that CXCL12 enhances lymphatic endothelial cell proliferation, migration, and tube formation through PI3K/AKT activation and upregulation of lymphangiogenic factors, including VEGF-C, VEGFR-3, and Prox1. Importantly, conditioned medium from TSCC cells (CAL-27) also stimulated HLEC tube formation, and this effect was significantly diminished by CXCL12 neutralization, highlighting a paracrine mechanism where tumor-secreted CXCL12 drives lymphangiogenesis. These findings align with emerging evidence suggesting a role for chemokines in lymphangiogenesis [45]. For instance, Tutunea-Fatan et al. [46] recently demonstrated that CCL21/CCR7 signaling promotes lymphangiogenesis in breast cancer via VEGF-C upregulation, while Xu et al. [47] reported that CXCL1 enhances lymphangiogenesis in gastric cancer through the activation of VEGFR-3. Our study is the first to establish a direct link between CXCR4/CXCL12 signaling and lymphangiogenesis in TSCC, providing mechanistic insights into how this axis promotes lymphatic metastasis. Furthermore, our co-culture experiments indicated that soluble factors secreted by TSCC cells are also capable of promoting HLEC migration, further supporting the notion that tumor cells influence lymphangiogenesis via paracrine routes. Given the high expression of CXCL12 in TSCC tissues and cells, CXCL12 is likely one of the key components in the conditioned medium contributing to enhanced lymphangiogenesis. Recent reviews emphasize the importance of various chemokines, including CXCL12, in regulating lymphangiogenesis and facilitating tumor cell migration towards lymph nodes [6].

Our in vivo experiments further validated the critical role of CXCR4/CXCL12 in TSCC progression and lymphatic metastasis. CXCR4 overexpression significantly accelerated tumor growth and increased lymph node metastasis, while CXCR4 knockdown or AMD3100 treatment produced opposite effects. These findings are consistent with previous studies in other cancer models [48] and underscore the therapeutic potential of targeting CXCR4/CXCL12 signaling. Notably, our study employed an orthotopic TSCC model, which better recapitulates the native tumor microenvironment compared to subcutaneous xenograft models commonly used in previous studies [49]. This approach enhances the clinical relevance of our findings and strengthens their translational implications.

Comprehensive transcriptomic analysis further illuminated the molecular landscape regulated by CXCR4/CXCL12 signaling in TSCC. Our RNA-seq data revealed distinct gene expression profiles associated with CXCR4 modulation, with significant enrichment in pathways related to cancer progression, cytokine-cytokine receptor interaction, and cell adhesion. These findings align with recent multi-omics analyses in other cancer types [50, 51] and provide a valuable resource for identifying additional molecular targets in TSCC. Notably, our transcriptomic data highlighted the significant impact of CXCR4 on PI3K/AKT pathway components, with CXCR4 overexpression increasing PI3K3CA and AKT1 expression while decreasing PTEN levels. These results further support our mechanistic findings and suggest that CXCR4 may influence PI3K/AKT signaling not only through receptor-mediated activation but also by modulating the expression of pathway components.

From a translational medicine perspective, our multifaceted study establishes CXCR4 and CXCL12 as robust predictive biomarkers for occult lymph node metastasis in clinically node-negative (cN0) TSCC patients, with superior performance compared to conventional clinical parameters (AUC = 0.861 vs. AUC = 0.674, p < 0.01). Implementation of these molecular markers could potentially spare patients from unnecessary elective neck dissections while ensuring appropriate treatment for those at high risk, thus advancing personalized therapeutic strategies in TSCC management.

Both markers exhibited excellent discriminatory power in ROC analysis, with CXCL12 showing slightly superior performance. Moreover, integrating these molecular markers with traditional clinicopathological parameters enabled the development of a nomogram with enhanced predictive accuracy for lymph node metastasis. This approach addresses the current limitations in preoperative assessment of lymph node status in TSCC and could potentially guide personalized treatment decisions, such as the extent of neck dissection or adjuvant therapy requirements [52]. The stratification of TSCC patients into high- and low-risk groups based on our nomogram scores successfully identified patients with significantly different survival outcomes, further supporting its prognostic value.

Our findings also suggest potential therapeutic strategies targeting the CXCR4/CXCL12 axis in TSCC. AMD3100 (plerixafor), a specific CXCR4 antagonist already approved for hematopoietic stem cell mobilization in patients with lymphoma and multiple myeloma [53], effectively inhibited TSCC growth and lymphatic metastasis in our preclinical model. Recent clinical trials have begun exploring AMD3100 in solid tumors, including a phase I/II study in glioblastoma (NCT01977677) and a phase II trial in pancreatic cancer (NCT02179970). Our results provide a strong rationale for investigating AMD3100 or other CXCR4 antagonists in TSCC, particularly in patients with high CXCR4/CXCL12 expression. Additionally, combining CXCR4 inhibitors with PI3K/AKT pathway inhibitors, several of which are in clinical development [54], may represent a promising therapeutic strategy deserving further investigation. Targeting the CXCL12-CXCR4/CXCR7 signaling axis has emerged as a promising strategy in cancer therapy, with various antagonists and inhibitors under investigation for their potential to inhibit tumor progression and enhance the efficacy of other treatments, including immunotherapy [55].

Despite these significant advances, our study has certain limitations. First, while we extensively characterized the role of CXCR4/CXCL12 in TSCC cells and lymphatic endothelial cells, we did not explore their potential effects on other components of the tumor microenvironment, such as immune cells and cancer-associated fibroblasts, which may also contribute to lymphatic metastasis [56]. Second, although our orthotopic mouse model provides valuable insights, it does not fully recapitulate the heterogeneity and immune context of human TSCC. Patient-derived xenograft models or genetically engineered mouse models may offer additional advantages in future studies [57, 58]. Third, while our transcriptomic analysis identified numerous genes regulated by CXCR4/CXCL12 signaling, the functional significance of many of these genes remains to be elucidated. Fourth, our in vivo studies were conducted using nude mice, which are immunodeficient. While this model is suitable for assessing tumor growth and metastasis of human cancer cells, it lacks a fully functional immune system, which can play a significant role in tumor development and response to therapy. Therefore, our findings in the nude mouse model may not fully reflect the complex interactions within the immune-competent human tumor microenvironment. Further investigations focusing on these aspects would complement our findings and provide a more comprehensive understanding of CXCR4/CXCL12-mediated lymphatic metastasis in TSCC. Future studies employing immunocompetent models or humanized mouse models would be beneficial to further validate the in vivo findings.

Conclusions

Our study establishes the CXCR4/CXCL12 axis as a crucial mediator of TSCC lymphatic metastasis through multiple mechanisms, including enhanced tumor cell migration and invasion, EMT, and lymphangiogenesis, predominantly via the PI3K/AKT signaling pathway. We further demonstrate that TSCC cells secrete CXCL12, which acts in an autocrine fashion to promote their motility and in a paracrine fashion to stimulate lymphangiogenesis, with these mechanisms also showing relevance in additional TSCC cell lines. We demonstrate the potential utility of CXCR4 and CXCL12 as predictive biomarkers for lymph node metastasis and prognostic indicators for TSCC patients, which could improve clinical decision-making. Furthermore, our findings highlight the therapeutic potential of targeting CXCR4/CXCL12 signaling in TSCC, particularly in patients with high CXCR4/CXCL12 expression. Future studies should focus on validating these findings in larger patient cohorts and investigating the efficacy of CXCR4 antagonists, alone or in combination with other therapeutic modalities, in clinical trials for TSCC patients.

Abbreviations

TSCC

Tongue squamous cell carcinoma

CXCR4

CXC chemokine receptor 4

CXCL12

CXC motif chemokine ligand 12

IHC

Immunohistochemistry

HOK

Human oral keratinocytes

HLECs

Human lymphatic endothelial cells

STR

Short tandem repeat

qRT-PCR

Quantitative real-time polymerase chain reaction

CCK-8

Cell Counting Kit-8

PI

Propidium iodide

DAB

3,3′-Diaminobenzidine

DAPI

4′,6-Diamidino-2-phenylindole

EMT

Epithelial-mesenchymal transition

VEGF-C

Vascular endothelial growth factor-C

VEGFR-3

Vascular endothelial growth factor receptor-3

PCA

Principal component analysis

DEGs

Differentially expressed genes

GO

Gene Ontology

KEGG

Kyoto Encyclopedia of Genes and Genomes

ROC

Receiver operating characteristic

AUC

Area under the curve

cDNA

Complementary DNA

SDS-PAGE

Sodium dodecyl sulfate polyacrylamide gel electrophoresis

PVDF

Polyvinylidene difluoride

ECL

Enhanced chemiluminescence

FBS

Fetal bovine serum

PBS

Phosphate-buffered saline

RIPA

Radioimmunoprecipitation assay

LVD

Lymphatic vessel density

cN0

Clinically node-negative

STAT3

Signal transducer and activator of transcription 3

Author contributions

H.L. and Y.X. contributed equally to this work. Y.L. conceived and designed the study. H.L., Y.X., and S.S. performed the experiments and analyzed the data. X.L. assisted with the bioinformatic analysis. Z.L. and H.Y. contributed to the collection of clinical samples and patient information. H.L. and Y.X. wrote the original manuscript. Y.L. reviewed and edited the manuscript. All authors read and approved the final manuscript.

Funding

This work was supported by the Yunnan Provincial Department of Science and Technology—Zhang Yi Expert Workstation of Yunnan Province (202305AF150044) and Yunnan Province Ten Thousand People Plan “Expert Doctor” Special Project (YNWR-MY-2019-024).

Availability of data and materials

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

Human tissue samples from patients with tongue squamous cell carcinoma (TSCC) were collected with informed consent and in accordance with the Declaration of Helsinki. The use of human specimens and associated clinical data was approved by the Ethics Committee of Kunming University of Science and Technology. All animal experiments were conducted in accordance with institutional guidelines and approved by the Institutional Animal Care and Use Committee of Kunming University of Science and Technology.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.