LCZ696 improves oxidative stress injury in human podocytes induced by increased glucose levels via Nrf2/HO-1 signaling pathway

Abstract

Background

Uncontrolled diabetes results in diabetic kidney disease (DKD), impacting approximately 40% of individuals with diabetes. Early indicators include podocyte damage and proteinuria, which are influenced by oxidative stress and dysregulation of the Nrf2/HO-1 pathway.

Objective

To examine the potential effect of Sacubitril/valsartan (LCZ696) on the oxidative stress of podocytes induced by hyperglycemia via the signaling pathway.

Methods

Podocytes were categorized into four groups: the first group was exposed to a normal glucose level 5.5 mmol/L, the second group to a high glucose at 40 mmol/L, the third group to a high glucose with LCZ696 at a concentration of 10 µM and the fourth group to a high glucose with Valsartan (VAL) at a concentration of 10 µM. Cell viability was evaluated using the CCK-8 assay. The rate of apoptosis in podocytes was determined through flow cytometry with Annexin V-FITC and PI staining. Oxidative stress parameters were assessed using ROS detection kits. To explore the role of Nrf2 signaling, its expression in podocytes was silenced via siRNA transfection, enabling the evaluation of LCZ696’s effects on oxidative stress and apoptosis in the absence of Nrf2 signaling. The expression levels of HO-1 and Nrf2 were analyzed through Western blotting and real-time polymerase chain reaction (rtPCR).

Results and discussion

The Cell viability study results suggested that a 10 µM concentration of LCZ696 showed better effects. LCZ696 at 10 µM significantly enhanced cell viability and reduced apoptosis in podocytes exposed to high glucose levels. Apoptotic markers showed a notable decrease in the HG + LCZ696 group compared to the HG group, highlighting LCZ696’s superior efficacy over VAL in preventing glucose-induced cell death. The HG group showed significantly higher levels of ROS and MDA compared to the NG group, whereas the SOD levels were considerably lower. ROS levels in the HG + LCZ696 and HG + VAL groups were considerably lower than those in the HG group. Additionally, oxidative stress markers, such as ROS and MDA, were significantly reduced, while SOD levels were notably increased in the LCZ696 and VAL groups compared to the HG group. The relative protein mRNA expression levels of Nrf2 and HO-1 in the HG + LCZ696 group were significantly higher (P < 0.001) compared to the HG group. Compared to the NG group, the relative expression levels of the Nrf2 and HO-1 were lower in the HG group (P < 0.01) and significantly higher in the HG + LCZ696 group than in the NG group (P < 0.05). Moreover, LCZ696 upregulated Nrf2 and HO-1 protein and gene expression levels, mitigating oxidative stress. siRNA-mediated knockdown of Nrf2 further confirmed that LCZ696’s protective effects were Nrf2-dependent, as Nrf2 suppression eliminated LCZ696’s antioxidative and anti-apoptotic benefits, underscoring Nrf2’s role in LCZ696’s mechanism.

Conclusions

LCZ696 can inhibit oxidative stress and improve elevated glucose-induced apoptosis in podocytes via the Nrf2/HO-1 signaling pathway.

Graphical Abstract

Supplementary Information

The online version contains supplementary material available at 10.1186/s40001-025-02883-y.

Introduction

Uncontrolled diabetes can lead to diabetic kidney disease (DKD), a common complication that initially manifests as proteinuria. More than 500 million people globally have diabetes, and approximately 40% of them may develop DKD [1, 2]. As global diabetes rates continue to rise, the prevalence of DKD is also expected to increase. If left unaddressed, DKD can progress to severe kidney failure, often requiring long-term dialysis or a kidney transplant, making it a major contributor to chronic kidney disease and end-stage renal disease [3]. Proteinuria, an early indicator of DKD, results from damage to the kidney's filtration barrier, allowing proteins that should remain in the body to be lost in the urine. The pathological characteristic of early-stage DKD is closely linked to the loss and death of podocytes, which compromises the glomerular filtration barrier and accelerates disease progression [4].

Podocytes are essential components of the glomerular filtration barrier, playing a vital role in blood filtration. Their interlocking foot processes form filtration slits covered by a slit diaphragm, which acts as a selective barrier to prevent protein leakage into the urine. The firm attachment of podocyte foot processes to the basement membrane provides mechanical stability, enabling the barrier to withstand the pressure of blood flow. However, elevated blood glucose levels in diabetes can lead to oxidative stress, disrupted insulin signaling, hemodynamic changes due to hyperfiltration, toxicity from advanced glycation end products (AGE), and chronic inflammation, all of which negatively impact podocyte function [5, 6]. Elevated hyperglycemia levels (HG) cause structural damage (podocyte effacement, death) and functional impairment (decreased nephrin expression, heightened oxidative stress) in podocytes [7, 7]. Although the exact mechanisms underlying DKD are not entirely understood, increasing research suggests that oxidative stress plays a pivotal role in DKD progression and is considered a key factor in its pathogenesis [8].

“Nrf2” is a crucial regulator involved in various cellular processes [9]. Under physiological conditions, Keap1 binds to Nrf2 in the cytosol, facilitating its degradation by proteasomes. Upon stimulation, Nrf2 detaches from Keap1, translocates to the nucleus, interacts with antioxidant-response elements (AREs), and activates the expression of heme oxygenase-1 (HO-1) [10]. The Nrf2/HO-1 signaling pathway plays a vital role in protecting cells from oxidative stress-induced injury. Previous research has reported that activation of this pathway protects renal function in mice from ischemia‒reperfusion injury [11]. Additionally, another study revealed that excessive ROS generation during cisplatin-induced renal damage was suppressed through this pathway [12].

Previous studies have demonstrated that valsartan (an angiotensin II receptor blocker) reduces podocyte injury in mouse models of DKD [13]. LCZ696, a novel drug classified as an ‘angiotensin receptor-neprilysin inhibitor (ARNI)’, combines a neprilysin inhibitor with an ARB in equal ratios [14]. Clinical studies have shown that treatment with LCZ696 significantly reduces overall mortality and rehospitalization rates for heart failure in hospitalized patients [15]. Recent experimental studies suggested that, compared with valsartan, LCZ696 exhibits superior therapeutic effects in regulating the ‘renin‒angiotensin system’ in spontaneously hypertensive female rats [16]. Additionally, LCZ696 therapy has been shown to delay the progression of DKD in animal models [17]. Mohany et al. reported that LCZ696 alleviates diabetic nephropathy in rats by reducing oxidative stress and NF-κB-mediated inflammation [18]. Therefore, this study evaluates the potential of LCZ696 in mitigating high glucose (HG) induced podocyte damage by establishing an in vitro DKD model with HG stimulation and explores the regulatory role of LCZ696 via the Nrf2/HO-1 pathway.

Materials and methods

Materials

Cell line

Human podocytes were generously provided by the Professor Yifan’s research group at Qilu Medical College, Shandong University.

Main reagents

Fetal bovine serum, trypsin; phosphate-buffered saline (PBS), glucose-free 1640 medium (Yuanpei Co.); LCZ696 reagent (Glpbio, USA); monoclonal antibodies against Nrf2 and HO-1 (Abcam, USA); CCK-8 kit; reactive oxygen species (ROS) fluorescence assay kit; malondialdehyde (MDA) and superoxide dismutase (SOD) colorimetric assay kit (Wuhan Eliate Biological Technology Co., Ltd.).

Methods

Cell culture

Podocytes frozen in liquid nitrogen were thawed and placed in a 5% CO2 incubator at 37 °C. The cells were cultured in normal glucose 1640 medium supplemented with 10% fetal bovine serum. The culture medium was changed every two days. Once the cells reached 80–90% confluency, they were passaged using trypsin digestion.

When podocytes are cultured at 33 °C with IFN-γ in the nutrient media, they remain undifferentiated. Differentiation and maturation begin when the cells are grown at 37 °C in the absence of IFN-γ. In this study, RPMI 1640 medium supplemented with IFN-γ was used for cell growth in an incubator at 33 °C. After fourteen days of induction at 37 °C in the absence of IFN-γ, the cells were differentiated and matured, making them suitable for subsequent experiments.

Cytotoxicity detection of the effects of LCZ696 on podocytes

Healthy podocytes were seeded at a density of 5000 cells per well in 100 µL of medium in ninety-six-well plates, with blank wells containing only medium (no cells). The cells were divided into groups with normal glucose and different concentrations of LCZ696 (10, 20, or 30 μM). LCZ696 was added at the respective concentrations and incubated for 48 h. Subsequently, 10 μL of CCK-8 solution was added to each well and incubated at 37 °C for one hr. Cell viability was assessed based on absorbance measured at 450 nm.

Effects of LCZ696 on podocyte proliferation under high-glucose stimulation

Healthy podocytes were seeded in 100 µL of medium in 96-well plates, with blank wells containing only medium (no cells). The cells were pretreated with high glucose levels (40 mmol/L) for 48 h, followed by stimulation with LCZ696 at three different concentrations (10, 20, or 30 μM) for 24 h. Afterward, CCK-8 solution was added to each well and incubated for one hour. Absorbance was measured at 450 nm and cell viability was calculated based on the recorded absorbance.

Cell grouping

An appropriate drug concentration was selected based on the CCK-8 results. Podocytes in the logarithmic growth phase were randomly allocated into four groups: Group 1 (NG Group): 5.5 mmol/L glucose; Group 2 (HG group): 40 mmol/L glucose; group 3 (HG + LCZ Group) high glucose + 10 μM LCZ696; and group 4 (HG + VAL Group) high glucose + 10 μM VAL. After seeding, the cells were synchronized in serum-free 1640 medium for 24 h. Following synchronization, the NG group was cultured in 1640 medium containing 5.5 mmol/L glucose, while the HG group was maintained in 1640 medium with 40 mmol/L glucose for 48 h. The HG group was exposed to elevated glucose conditions for 24 h, followed by treatment with LCZ696 (10 μM) in the HG + LCZ group and VAL (10 μM) in the HG + VAL group for an additional 24 h. In another in vitro study, five groups were established: Group 1 (NG Group): 5.5 mmol/L glucose; Group 2 (HG group): 40 mmol/L glucose; Group 3 (HG + LCZ Group): high glucose + 10 μM LCZ696; Group 4 (HG + LCZ + siRNA Group): HG + 10 μM LCZ696 + si-Nrf2; and Group 5 (HG + LCZ + NC Group): HG + 10 μM LCZ696 + NC.

Cell apoptosis

Cells were prepared for apoptosis induction following the experimental protocol. They were centrifuged (Thermo Fisher, USA) at 300 g for 5 min, and the supernatant was discarded. The collected cells were washed once with PBS, gently resuspended, and counted. After resuspension at a concentration of 5 × 10⁵ cells, they were centrifuged again at 300 g for 5 min, and the supernatant was discarded. The cells were then washed once more with PBS, centrifuged, and resuspended in 100 μL of diluted 1X Annexin V Binding Buffer. To the cell suspension, 2.5 μL of Annexin V-FITC reagent and 2.5 μL of PI reagent (50 μg/mL) were added. After gentle mixing by vortex, the cells were incubated at room temperature in the dark for 20 min. Finally, 400 μL of diluted 1X Annexin V Binding Buffer was added, the samples were mixed, and immediately analyzed on the flow cytometer.

Determination of ROS

Cells were cultured according to their groupings, and various working solutions were prepared as per the ROS assay kit. Positive control wells (reagent two working solutions) and negative control wells (cells only, no reagent one working solution) were set up. After removing the nutrient media, the cells were washed with serum-free culture media. Then, 1 mL of reagent one working solution was added to fully cover the cells. The cells were incubated for 30 min at 37 °C in the dark. Reagent solution was removed, and the cells were washed with serum-free nutrient media. The cells were then digested with trypsin for 2–3 min, and the digestion was terminated by adding serum-containing culture medium to form a cell suspension. The cells were separated by centrifugation at 1000 × g for 5–10 min. The collected cell pellet was resuspended in serum-free culture medium, and the mean ROS values for each group were measured via flow cytometry.

Colorimetric detection of total SOD and MDA

Sample processing was carried out according to the kit guidelines. Protein levels in each group were determined using an antioxidant kit. The samples were added to a ninety-six-well plate as per the instructions and incubated at 37 °C for twenty minutes. Optical density (OD) was measured at 450 nm using a microplate reader (BioTek, USA), and the SOD activity for each group was calculated accordingly. Similarly, samples were processed as per instructions, and OD values at 532 nm were measured to determine the MDA content for each group.

Western blot analysis of target protein levels

RIPA lysis buffer was used to extract cell proteins from each group, and the BCA method was employed to determine their concentrations. A 10% gel was prepared, and 30 μg of protein was loaded into each well. After electrophoresis, the proteins were transferred to PVDF membranes and blocked with milk at room temperature for 2 h. The membranes were then incubated overnight at 4 °C with primary antibodies: anti-β-actin (1:1000), anti-Nrf2 (1:1000), and anti-HO-1 (1:1000). After incubation, the membranes were washed with TBST three times for 10 min each. Finally, an ECL reagent was added for chemiluminescent detection.

Real-time quantitative PCR detection of Nrf2 and HO-1 mRNA levels in podocytes

Total RNA from each group was extracted via a rapid RNA extraction kit, and the reverse transcription system was prepared on ice. The extracted RNA was reverse transcribed into cDNA, with β-actin serving as the reference gene. The reaction was performed in a 10 μL system; Table 1 presents the primer sequences. The relative quantification of target genes was conducted using the $2^{-\mathrm{\Delta }\mathrm{\Delta }{\text{C}}_{\text{t}}}$ method based on Ct values.

Table 1.

Sequences of the primers

Name	Sequence
Nrf2 forward	ATCCATTCCTGAGTTACAGTGTCTT
Nrf2 reverse	TGTCAGTTTGGCTTCTGGACT
HO-1 forward	TGCTGACCCATGACACCAAG
HO-1 reverse	GGGCAGAATCTTGCACTTTGTT
β-actin forward	CATGTACGTTGCTATCCAGGC
β-actin reverse	CTCCTTAATGTCACGCACGAT

Knockdown of Nrf2 and HO-1 by siRNA

Cell cultures were prepared according to the experimental groups. First, 5.0 μL of siRNA was diluted in 250 μL of Opti-MEM (50 nM for transfection) and mixed gently 3–5 times. Separately, 5.0 μL of Lipofectamine™ 2000 was diluted in 250 μL of Opti-MEM, mixed gently by pipetting, and allowed to sit for 5 min at room temperature. The siRNA and Lipofectamine™ 2000 solutions were then combined, gently mixed 3–5 times, and incubated for 20 min at room temperature to form transfection complexes. The transfection complexes were added at 500 μL per well to a 6-well cell plate, ensuring even distribution by gently shaking the plate. After 6 h of transfection, podocytes were treated with high glucose (HG) and LCZ696. The cell plates were then cultured in a 37 °C incubator with 5% CO₂. Western blot analysis and PCR were subsequently performed to confirm the effectiveness of gene knockdown.

Statistical analysis

GraphPad Prism 9.3 software was employed for graphing, and I ImageJ software was employed for image analysis. Statistical significance was tested via SPSS 26 software. For normally distributed data, the results are represented as the Mean ± SD (x̄ ± s). One-way analysis of variance (ANOVA) was employed for multiple group comparisons, pair-wise t comparisons were performed using the LSD-t test. A P value of less than 0.05 was considered statistically significant.

Results

LCZ696 improved HG-cultured podocyte viability via reducing apoptosis-related events

As depicted in Fig. 1A, the cell viability levels in the NG group, NG + 10 μM LCZ696 group, NG + 20 μM LCZ696 group, and NG + 30 μM LCZ696 group were 1, 1.03 ± 0.18, 0.96 ± 0.06, and 0.81 ± 0.01, respectively, with statistically significant differences (F = 37.292, P < 0.001). As the concentration of LCZ696 increased, the survival rate of human podocytes gradually decreased. Cell viability was significantly reduced when the LCZ696 concentration reached 30 μmol/L (P < 0.001) compared to the NG group. The cells were precultured in high-glucose medium for 48 h, followed by stimulation with different concentrations of LCZ696 for 24 h. The viability of the cells in each group was then measured, as shown in Fig. 1B. The cell viability levels in the HG, HG + LCZ696 10 μM, HG + LCZ696 20 μM, and HG + LCZ696 30 μM groups were 1, 1.06 ± 0.03, 1.03 ± 0.04, and 0.93 ± 0.03, respectively, with significant differences (F = 15.930, P < 0.001). The HG + LCZ69610 μM group exhibited increased activity (P = 0.012) compared to the high-glucose group. In conclusion, 10 μM was selected as the LCZ696 dose for further stimulation.

Fig. 1.

Effects of the drug concentration of LCZ696 on podocyte activity under normal or high-glucose conditions A Effects of varied concentrations of LCZ696 on the survival of podocytes. B Effects of various drug concentrations on podocytes under high-glucose conditions. (ns P > 0.05, * P < 0.05, ** P < 0.01 **** P < 0.0001)

The flow cytometry analysis revealed a notable increase in the rate of apoptosis under high glucose (HG) conditions when compared to both normal (NG) and treated environments. As illustrated in Fig. 2, the incidence of apoptosis was markedly elevated in the HG group, reaching 65.07%, in stark contrast to the NG group, which exhibited a rate of only 30.01% (P < 0.05). Furthermore, the administration of LCZ696 resulted in a significant reduction in apoptosis among podocytes, yielding a rate of 49.01% that was statistically significant compared to the HG group (P < 0.01). Treatment with VAL also contributed to a decrease in apoptotic rates, demonstrating a protective effect, albeit less pronounced than that of LCZ696, with results of 51.14% (P < 0.05). This suggests a potential for therapeutic intervention in mitigating the detrimental effects of hyperglycemia on podocyte survival. These findings indicate that LCZ696 provides more robust protection in high-glucose conditions, likely by inhibiting apoptosis-related signaling pathways [19].

Fig. 2.

Depicts the rate of Apoptosis A in normal conditions, B under high glucose conditions, C after treatment with LCZ696, and D after treatment with VAL. E Representing the effects of the LCZ696 (10 µM) and VAL (10 µM) on podocyte apoptosis as compared to high-glucose and normal conditions. (^*P < 0.05,^*** P < 0.001,^**** P < 0.0001)

Effects of LCZ696 on ROS levels in podocytes under high-glucose stimulation

As shown in Fig. 3G, the relative levels of ROS in the NG, HG, HG + LCZ696, and HG + VAL groups were 1, 1.32 ± 0.07, 1.01 ± 0.02, and 1.01 ± 0.03, respectively, with significant differences (F = 13.058, P = 0.002). The ROS levels were notably higher in the HG group compared to the NG group (P = 0.005). However, the differences between the HG + LCZ696 group and the NG group (P = 0.240), as well as between the HG + VAL group and the NG group, were not statistically significant. Notably, the ROS content in cells treated with LCZ696 and VAL for 24 h was significantly lower than in the HG group (P = 0.001). However, the FACS images also suggested that the level of ROS had substantially increased during exposure to high glucose levels (Fig. 3D) and significantly decreased after treatment with LCZ696 and VAL, respectively (Fig. 3E and F).

Fig. 3.

Depicts the levels of ROS in different states A Level of ROS in normal conditions, B Level of ROS in negative control, C Low ROS level in positive control, D High ROS level under High glucose (HG) exposure, E reduced level of ROS after treatment with LCZ696, F reduced level of ROS after treatment with VAL, and G comparative effects of LCZ696 on ROS levels in podocytes upon high-glucose stimulation as compared to the HG group (ns P > 0.05, **** P < 0.0001)

Determination of oxidative stress levels

The results of the MDA assay revealed that the MDA levels in the NG, HG, HG + LCZ696, and HG + VAl groups were 0.34 ± 0.13, 0.60 ± 0.14, 0.45 ± 0.08, and 0.42 ± 0.20, respectively, with significant differences (F = 8.156, P < 0.05). The MDA level in the HG group was significantly higher than that in the NG group (P = 0.012). However, no significant difference in the MDA levels between the HG + LCZ696 and HG + VAL groups compared to the NG group (P = 0.887). Notably, the MDA level in the HG + LCZ696 and HG + VAL treated groups was significantly lower than that in the HG group (P = 0.014).

The results of the SOD assay revealed that the SOD levels in the NG, HG, and HG + LCZ696 groups were 53.52 ± 3.39, 32.87 ± 2.35, 57.43 ± 1.73, and 49.72 ± 2.21respectively, with statistically significant differences (F = 7.849, P = 0.011). The SOD activity level in the HG group was significantly lower compared to the NG group (P = 0.015). However, there was no significant difference in SOD levels between the HG + LCZ696 and HG + VAL groups compared to the NG group (P = 0.477). Notably, the SOD level in the HG + LCZ696 and HG + VAL treated group was significantly higher (P = 0.005) in comparison with HG group (Fig. 4).

Fig. 4.

MDA (A) and SOD (B) were employed to determine the expression of oxidative stress products in each group (ns P > 0.05,* P < 0.05, **P < 0.01,***P < 0.001)

Effects of LCZ696 on the relative expression levels of Nrf2 and HO-1 proteins in podocytes under high-glucose stimulation

The Western blot results (Fig. 5) indicate that relative protein expression levels of Nrf2 and HO-1 are significantly lower in the HG group than in the NG group (P < 0.05), suggesting that high glucose conditions may suppress the expression of Nrf2 and HO-1 in podocytes.

Fig. 5.

Effect of LCZ696 on the protein expression levels of Nrf2 (A, B) and HO-1 (A, C) in podocytes under high-glucose stimulation (ns P > 0.05,* P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001)

In the HG + LCZ696 group, Nrf2 and HO-1 levels were significantly higher compared to the NG group (P < 0.01), indicating that LCZ696 treatment not only restored but also boosted the expression of these proteins beyond normal glucose levels. In contrast, there was no significant difference between the HG + VAL and NG groups. These findings suggest that LCZ696 may reduce oxidative stress and cell damage in podocytes by regulating the Nrf2/HO-1 pathway, playing a key role in antioxidant defense and cellular protection. Compared to the HG group, both treatments significantly increased Nrf2 and HO-1 expression (P < 0.001), demonstrating that LCZ696 and VAL can effectively counteract the harmful effects of high glucose on antioxidant protein levels. However, LCZ696 caused a more notable increase in protein expression than VAL, with a statistically significant difference (P < 0.01). This suggests that both interventions activate the Nrf2/HO-1 pathway, helping to reduce oxidative stress and cellular damage in podocytes under high-glucose conditions, with LCZ696 providing superior protection.

Effects of LCZ696 on the gene expression levels of Nrf2 and HO-1 in podocytes under high-glucose stimulation

The relative gene expression levels of Nrf2 and HO-1 are significantly lower in the HG group compared to the NG group (P < 0.01). This indicates that high-glucose conditions downregulate the transcription of Nrf2 and HO-1 genes. Nrf2 is a master regulator of antioxidant defense, and HO-1 is a protective enzyme regulated by Nrf2 [20]. Reduced expression of these genes suggests that high glucose compromises the antioxidant response, potentially making podocytes more vulnerable to oxidative stress and damage. In the HG + LCZ696 and HG + VAL groups, the gene expression levels of Nrf2 andHO-1 are significantly higher than in the NG group (P < 0.05). These results suggest that LCZ696 and VAL treatments upregulate Nrf2 and HO-1 gene expression beyond normal glucose levels, indicating that these drugs can boost the antioxidant defense system. Both LCZ696 and VAL treatments significantly increase the gene expression levels of Nrf2 and HO-1 compared to the HG group (P < 0.01). This indicates that these treatments counteract the downregulation of Nrf2 and HO-1 caused by high glucose exposure, restoring antioxidant gene expression. The results suggest that LCZ696 may promote the transcription of Nrf2 and HO-1 genes in podocytes exposed to high glucose. Since the Nrf2/HO-1 pathway is crucial for antioxidative defense, the enhanced expression of these genes likely regulates oxidative stress and protects podocytes from injury [21]. These findings align with the hypothesis that LCZ696 and VAL may mitigate high glucose-induced oxidative stress by enhancing the transcriptional activity of key antioxidant genes, such as Nrf2 and HO-1. Notably, the HG + LCZ group shows a more pronounced increase in Nrf2 and HO-1 expression compared to the HG + VAL group (P < 0.01), suggesting that LCZ696 may have a superior capacity to activate the antioxidant response pathway in podocytes under high glucose conditions. This distinction implies that LCZ696 could offer enhanced protection against oxidative damage by more effectively upregulating antioxidant defenses than VAL (Fig. 6).

Fig. 6.

Effects of LCZ696 on the expression levels of the Nrf 2 (A) and HO-1 (B) genes in podocytes under high-glucose stimulation (*P < 0.05, **P < 0.01, ****P < 0.0001)

Modulation of Nrf2 expression by LCZ696 in high glucose conditions from siRNA knockdown

Figure 7A illustrates the modulation of Nrf2 expression under high-glucose conditions, both with and without the treatment of LCZ696. The baseline condition represents Nrf2 expression levels in cells exposed to high glucose alone, a state known to induce oxidative stress and potentially alter the expression of antioxidant defense pathways. In contrast, the treatment condition demonstrates the effect of LCZ696, a compound with potential therapeutic implications in oxidative stress-related diseases. The inclusion of siRNA-mediated knockdown of Nrf2 provides a targeted approach to understand whether the observed effects of LCZ696 are dependent on the presence of Nrf2. The Fig likely reveals that under high-glucose stress, Nrf2 expression may be upregulated as part of the cell’s natural antioxidant response. However, the treatment with LCZ696 appears to modulate this response further, potentially amplifying or stabilizing Nrf2 expression. The siRNA knockdown condition likely shows a marked decrease in Nrf2 levels, indicating effective gene silencing, and offers a control to assess LCZ696's efficacy independently of Nrf2. The expression of HO-1 (heme oxygenase-1), a downstream target of Nrf2 and a critical component of the cellular antioxidant defense system, is also examined under high-glucose conditions with LCZ696 treatment. HO-1 is typically upregulated in response to oxidative stress, functioning to reduce oxidative damage by degrading heme into biliverdin, carbon monoxide, and free iron, all of which contribute to cytoprotection. Under baseline conditions with high glucose, HO-1 expression may be elevated as part of the oxidative stress response triggered by hyperglycemia. This aligns with its role in combating the harmful effects of reactive oxygen species (ROS). Treatment with LCZ696 appears to modulate HO-1 expression, potentially enhancing its levels through Nrf2 activation, thereby suggesting an indirect mechanism of stress mitigation. The inclusion of siRNA-mediated Nrf2 knockdown provides further clarity; if HO-1 levels significantly decrease after Nrf2 silencing, it underscores the dependence of HO-1 induction on the Nrf2 pathway. This would imply that LCZ696’s effects on HO-1 are mediated through its ability to regulate Nrf2 activity. β-actin serves as a loading control in the Western blot analysis. β-actin is a housekeeping protein consistently expressed in most cell types and remains unaffected by experimental treatments, such as high-glucose conditions or LCZ696 treatment. (B) The high glucose (HG) group shows significantly reduced Nrf2 protein expression compared to the normal glucose (NG) group (P < 0.01). This indicates that high glucose conditions downregulate Nrf2 protein, which may contribute to cellular stress or impaired defense mechanisms in such conditions. Treatment with LCZ696 under high glucose conditions (HG + LCZ696) showed significant increase in Nrf2 protein expression compared to both HG (P < 0.0001) and NG (P < 0.05), showing that LCZ696 restores and enhances Nrf2 protein levels under high glucose conditions. Nrf2 protein expression is significantly suppressed (P < 0.0001) compared to HG + LCZ696, validating the siRNA's knockdown effect on Nrf2, with expression similar to the HG + LCZ696 group, confirming the effect of LCZ696 treatment is specific and not disrupted by non-targeted siRNA controls. Both Nrf2 mRNA and protein levels decrease in HG conditions compared to normal glucose (NG), showing that high glucose negatively regulates Nrf2 at both transcriptional and translational levels. LCZ696 significantly upregulates Nrf2 protein expression, similar to its effect on mRNA levels. This suggests a protective mechanism of LCZ696 under high glucose conditions, potentially through Nrf2 activation. The siRNA effectively reduces Nrf2 protein expression, confirming the key role of Nrf2 in the observed protective effects of LCZ696. As with mRNA expression, the NC group shows expression comparable to HG + LCZ696, confirming that the observed knockdown effect in the siRNA group is specific.

Fig. 7.

A Western blot analysis of Nrf2 and HO-1 expression in response to LCZ and siRNA., B Nrf2 expression by LCZ696 in high glucose conditions from siRNA Knockdown in WB and C Nrf2 expression by LCZ696 in high glucose conditions from siRNA knockdown in PCR (*P < 0.05, **P < 0.01,***P < 0.001,****P < 0.0001)

Figure 7C represents HG has slightly lower Nrf2 expression than NG (P < 0.05), suggesting that high glucose may suppress Nrf2 expression. HG + LCZ696 has a significant increase in Nrf2 expression compared to HG (P < 0.0001), indicating that LCZ696 upregulates Nrf2 under high glucose conditions. In HG + LCZ696 + siRNA, Nrf2 expression drops drastically, confirming successful knockdown by siRNA. This expression is statistically lower than all other groups (P < 0.0001), except HG alone, showing the importance of Nrf2 for LCZ696 effect. HG + LCZ696 + NC shows levels similar to HG + LCZ696, confirming that the siRNA effect is specific and not due to nonspecific factors. LCZ696 treatment significantly boosts Nrf2 expression under high glucose conditions. siRNA-mediated knockdown confirms that Nrf2 plays a key role in LCZ696 effect. The comparison also highlights that Nrf2 expression is sensitive to high glucose, showing decreased levels without LCZ696.

Discussion

DKD is a serious complication arising from microvascular damage associated with diabetes. It is characterized by the presence of proteinuria, which indicates that the kidneys are not filtering properly and allowing proteins that should remain in the bloodstream to be excreted in the urine. Additionally, patients with DKD often experience elevated creatinine levels, a waste product that accumulates when kidney function declines, reflecting impaired kidney performance [22, 23]. Deterioration of the glomerular filtration barrier and podocyte injury lead to proteinuria in DKD patients [24]. Moreover, the programmed cell death is subject to modulation by anaerobic metabolism, especially in hypoxic environments. In conditions of oxygen deprivation, cells transition to anaerobic glycolysis, resulting in ATP depletion and the accumulation of lactate [25]. The metabolic shift may induce apoptosis through mitochondrial dysfunction, leading to the release of cytochrome C and the activation of caspases [26]. Reactive oxygen species (ROS) produced in hypoxic conditions may additionally enhance apoptotic pathways [27]. Furthermore, hypoxia-inducible factor-1α (HIF-1α) is stabilized in low oxygen conditions, influencing the expression of genes related to apoptosis. The disruption of cellular energy balance and redox equilibrium caused by anaerobic metabolism exacerbates apoptotic signals.

Various factors in the diabetic environment can damage podocytes, leading to a reduction in podocyte density and even podocyte detachment [28, 29]. Podocyte dysfunction is a contributing factor in the pathogenesis and progression of DKD [30]. Therefore, inhibiting podocyte injury is an effective strategy to delay the progression of DKD.

Nrf2 is a member of the transcription factor superfamily and features a basic leucine zipper (bZIP) structure. It comprises seven highly conserved domains known as NRF2-ECH (epichlorohydrin, Neh) homologous domains, referred to as Neh1 through Neh7. These domains play a crucial role in Nrf2's function as a regulator of antioxidant response and cellular defense mechanisms [31, 32]. The Neh1 domain mediates the binding of Nrf2 to the ARE. The N-terminal Neh2 domain binds to Keap1 which contains a high-affinity binding site (ETGE region) and a low-affinity binding site (DLG region), forming the structural basis for regulating Nrf2 activity. Under physiological conditions, Nrf2 exists in an inactive state in the cytoplasm and is coupled with Keap1. Keap1 contains a binding site for the ubiquitin ligase Cullin3, which mediates the ubiquitination and degradation of Nrf2. As the body is exposed to oxidative stress factors or electrophilic substances, Nrf2 dissociates from Keap1 and translocates to the nucleus. This protein forms a heterodimer with nuclear Maf proteins, recognizes and binds to AREs in the promoter regions of target genes, and activates the expression of downstream antioxidant genes, such as HO-1 and GPX4, leading to the upregulation of antioxidant and cytoprotective gene expression [33].

Nrf2 signaling pathway activation can reduce ROS production and plays a critical role in sustaining cellular redox homeostasis [34]. Research has shown that knocking out Nrf2 augments oxidative stress and kidney injury in STZ-induced diabetic mice [35], whereas activation of the Nrf2 signalling pathway can improve the development of diabetic nephropathy induced by STZ in rats [36], suggesting that the Nrf2 pathway has a renal-protective effect in diabetic nephropathy. In the present study, it was revealed that the Nrf2/HO-1 antioxidant pathway was significantly inhibited in podocytes treated with HG, leading to reduced expression of the Nrf2 and HO-1 proteins and genes. Under high-glucose conditions, the imbalance caused by increased ROS production and insufficient endogenous Nrf2/HO-1 antioxidant activity leads to intracellular oxidative stress, resulting in podocyte injury and death. Therefore, activating the Nrf2/HO-1 signaling pathway could be a promising therapeutic strategy to prevent high glucose-induced podocyte injury [37]. This finding is consistent with previous research, which suggests that the interaction of TNF-α with cell membrane molecules, particularly those of the TNF-α receptor superfamily, including CD30, indicates the presence of a complex and dynamic process [38].

LCZ696 is an angiotensin II (Ang II) type 1 receptor-neprilysin inhibitor. Earlier research reported that LCZ696 could upregulate the expression of Nrf2 and HO-1 [39] Nrf2 is a master regulator of cellular antioxidant defense, primarily through its role in upregulating the expression of various antioxidative and cytoprotective genes, including HO-1 [40]. Under oxidative stress conditions, Nrf2 activation leads to a coordinated increase in antioxidant response elements, which decreases cellular reactive oxygen species (ROS) levels and helps prevent oxidative damage [41]. In this study, LCZ696 was shown to induce Nrf2 activation in both a dose-dependent and time-dependent manner. Furthermore, when Nrf2 was inhibited or disrupted, the protective effects of LCZ696 under high glucose conditions were diminished, underscoring the pivotal role of Nrf2 activation in mediating antioxidative and anti-apoptotic responses.

In DKD, the antioxidant defense system is significantly compromised due to increased oxidative stress. Nrf2, as a master regulator of antioxidant responses, activates several downstream antioxidant proteins, including HO-1, which play essential roles in mitigating oxidative damage and reducing apoptosis. In this study, LCZ696 demonstrated its protective effects under high glucose conditions by upregulating Nrf2, which in turn enhanced HO-1 expression. This pathway highlights the importance of both Nrf2 activation and its downstream targets in protecting against DN-related oxidative stress and cellular injury. Activation of the Nrf2 signaling pathway enhances HO-1 expression. Upon activation, Nrf2 translocate from the cytoplasm to the nucleus, where it binds to antioxidant response elements (ARE) to promote the transcription and activation of HO-1. In the present investigation, we also observed that LCZ696 increased the expression of Nrf2 and HO-1 in the Nrf2 signaling pathway in podocytes induced by HG.

Furthermore, the activation of the Nrf2 signaling pathway by LCZ696 significantly reduced ROS production in vitro. The findings from both the mRNA and protein expression analyses highlight the critical role of Nrf2 in mitigating high glucose-induced cellular stress. High glucose conditions were associated with a significant reduction in Nrf2 expression at both the transcriptional and translational levels, indicating the detrimental impact of hyperglycaemia on the Nrf2 pathway. Treatment with LCZ696 not only restored but significantly enhanced NRF2 expression, suggesting its potential as a protective agent against oxidative stress under hyperglycemic conditions. The knockdown of Nrf2 using siRNA confirmed that the beneficial effects of LCZ696 were mediated through the activation of Nrf2, as silencing this gene abolished the increase in Nrf2 expression. The negative control further validated the specificity of the siRNA effect. Together, these results demonstrate that LCZ696 exerts a protective effect by upregulating Nrf2, making it a promising therapeutic strategy for combating high glucose-induced cellular damage. Therefore, LCZ696 may protect human renal podocytes from high glucose-induced damage by activating the Nrf2 signaling pathway. This activation enhances HO-1 expression, leading to decreased ROS production and, consequently, reduced podocyte injury.

Conclusion

In summary, this study provides compelling evidence that high-glucose stimulation leads to an increase in reactive oxygen species (ROS) production in human podocytes while simultaneously inhibiting the Nrf2/HO-1 antioxidant pathway. The findings suggest that elevated glucose levels can induce oxidative stress, contributing to podocyte damage and dysfunction, which are critical factors in the progression of diabetic nephropathy. Our results indicate that LCZ696 has the potential to activate the Nrf2/HO-1 signaling pathway, effectively reducing ROS production and alleviating podocyte injury caused by high glucose exposure. By enhancing the activity of this antioxidant pathway, LCZ696 may counteract the detrimental effects of oxidative stress, offering protective benefits for podocytes. These molecular insights shed light on the Reno protective effects of LCZ696 in the context of DKD. The study suggests that the protective actions of LCZ696 are intricately linked to the modulation of the Nrf2/HO-1 antioxidant pathway, highlighting its significance in combating oxidative stress in diabetic conditions. Given the rising prevalence of DKD among diabetic patients, LCZ696 presents a promising new therapeutic strategy. By targeting the underlying mechanisms of oxidative stress and inflammation in renal cells, LCZ696 could offer a novel approach for the management of diabetic nephropathy, potentially improving patient outcomes and quality of life. This research opens up new avenues for further investigation into the clinical applications of LCZ696, with the hope of establishing it as a cornerstone in the treatment of DKD.

Authors contributions

HZ: conceiving and designing the work, collecting data, analyzing and interpreting the data, writing the manuscript. MY: collecting data, analyzing and interpreting the data, writing the manuscript. YZ: collecting data, analyzing and interpreting the data, writing the manuscript. DL: collecting data, analyzing and interpreting the data, writing the manuscript. GL: analyzing and interpreting the data, writing the manuscript, revising the manuscript.

Funding

The National Natural Science Foundation of China (82370720).

Data availability

Data for this study is available from the corresponding author upon reasonable request. No datasets were generated or analysed during the current study.

Declarations

Ethics approval and Consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that there is no conflict of interest regarding the publication of this paper.