Minimal logic gates for probiotic Escherichia coli Nissle 1917 sensing and treatment of dual-bacteria intestinal infection

Haoran Li; Shanshan Zhang; Jinyan Yin; Gege Wang; Qi Wang; Yongzhen Xia; Lixiang Li; Qingsheng Qi; Qian Wang

doi:10.1080/19490976.2025.2530156

. 2025 Jul 6;17(1):2530156. doi: 10.1080/19490976.2025.2530156

Minimal logic gates for probiotic Escherichia coli Nissle 1917 sensing and treatment of dual-bacteria intestinal infection

Haoran Li ^a,^b, Shanshan Zhang ^c,^d, Jinyan Yin ^a, Gege Wang ^a, Qi Wang ^a, Yongzhen Xia ^b, Lixiang Li ^c,^d, Qingsheng Qi ^b,^✉, Qian Wang ^a,^✉

PMCID: PMC12239797 PMID: 40619672

ABSTRACT

Rapid development of synthetic biology has led to engineered probiotics to address the growing concern of infectious diseases and cancer. Dual or multiple bacterial infections are becoming more frequent, but there are few treatment options because complex approaches are needed to address different disease mechanisms. In this study, we designed a minimal logic gate to program E. coli Nissle 1917 to detect and treat the disease caused by Pseudomonas aeruginosa and Yersinia enterocolitica. Two orthogonal gene circuits were verified to detect and kill the two pathogens, respectively. The “AND” gate was designed and engineered to achieve remarkable chemotaxis and killing effects in vitro when both pathogens existed. Then, we demonstrated the preventive and therapeutic effectiveness of the programmed EcN against P. aeruginosa and Y. enterocolitica in a murine model of intestinal infection. The proof-of-concept of our programmed EcN strategy demonstrates an exciting potential method for preventing and treating dual-bacterial infection.

KEYWORDS: Engineered probiotics, logic gate, P. aeruginosa, Y. enterocolitica, directional chemotaxis, dual-bacterial infection

Introduction

Advancements in synthetic biology have enabled the engineering of complex genetic circuits into probiotics to address the growing problem of infectious diseases and cancer.^1,2 Probiotics that confer beneficial physiological or therapeutic benefits,^3,4 such as Escherichia coli Nissle 1917 (EcN), represent the next-generation live biotherapeutics that have undergone genetic modification to target specific diseases. A few studies have exploited engineered probiotics for therapeutic purposes, including the site-specific expression and delivery of biomolecules targeting bacterial and viral infections^5–7 or as adjuvants to pharmacological therapy.⁸ Sagheddu et al. engineered Lactobacillus reuteri to secrete interleukin-10, an anti-inflammatory cytokine, to improve its anti-inflammatory effects.⁹ The probiotic Lactococcus lactis was engineered to detect the Vibrio cholerae-specific CAI-I signaling molecule in the murine intestinal microenvironment by developing a chimeric receptor from the transmembrane ligand-binding domain of V. cholerae sensor kinase CqsS and the signal transduction domain of the response regulator of L. lactis called NisK.¹⁰ In another study, the probiotic EcN was genetically engineered to express the autoinducer molecule CAI-1 from V. cholerae to inhibit the pathogenicity of V. cholerae. In an infant mouse model, feeding the engineered strain significantly increased the resistance of the mice to V. cholerae, reduced the binding of cholera toxin, and decreased the colonization of V. cholerae in the intestines.¹¹ These findings provide strong support for the development of a probiotic-based cholera prevention strategy. Lynch et al. reported the development of the PROT3EcT system, which consists of three modules: a modified bacterial protein secretion system, associated regulatable transcription activators, and secreted therapeutic payloads. This system can direct therapeutic drugs to the disease site and maximize therapeutic efficacy.¹² A genetic circuit containing sialic acid biosensor (pNanA), amplifier, and actuators was created in EcN to restore intestinal bile salt metabolism in response to antibiotic-induced microbiome dysregulation.¹³ The engineered EcN limited the in vitro germination of Clostridium difficile endospores and growth of trophic cells and considerably inhibited infection in a mouse model.¹³

Contact between humans and wildlife, livestock, and pathogens is increasing globally, leading to more frequent simultaneous infections involving more than two pathogens also known as “co-infection,” which require a combination of antibacterial and antiviral drugs. Thus, novel methods for preventing co-infection are urgently needed. To detect dual or multiple pathogen infection, probiotics must be engineered with two or multiple-input signal systems to achieve sophisticated artificial gene regulation programs. Synthetic genetic logic circuits are designed to link various cellular biosensors and genetic actuators and can program probiotics that generate a specified transcriptional output in response to a combination of sensing signals.^14,15 Alec A. K. et al. constructed a serious logic gates circuits consists of NOT/NOR logic based on repressors and applied them to the design of 60 circuits for E. coli. Of these, 45 circuits performed correctly in every output state. The process of integrated circuit design was accelerated by the Electronic Design Automation (EDA) software tools. And the design environment Cello (an abbreviation of Cellular Logic) allowed for the rapid transformation of integrated circuits into DNA sequences for the design of genetic circuits in microbial hosts such as E. coli.^16,17 For example, several genetic logic AND gates have been constructed to link inputs to pathogenicity-related signal-responsive promoters or proteins to achieve highly specific in situ sensing and killing of diseased mammalian cells. Most such genetic logic AND gates employ cascading circuits, the size and complexity of which create design challenges such as varying construction difficulties in different hosts, noise propagation through cascading repressors,¹⁸ and signal crosstalk between genetic elements.^19,20 Triassi et al. developed and designed a “sensor array” with seven inducible systems and seven NOT/NOR gates in EcN SYN8784 to control the expression of therapeutic genes (pheP and stlA), thereby enhancing the activity and manufacturability of EcN for Phenylketonuria (PKU) treatment. This work laid the foundation for the design of genetic circuits that play a role in clinical therapeutic bacterial strains.²¹

Although the “OR” and “AND” logic gates are relatively easy to implement, the design of simpler, more stable, minimalist genetic logic gates with a small DNA footprint potentially has greater value in practical applications. There are still a few reports regarding the minimalist genetic logic gates. Herein, we engineered probiotics with simple, small DNA footprint logic gate behaviors for the detection and treatment of dual-pathogen infections.

Pseudomonas aeruginosa and Yersinia enterocolitica are gram-negative pathogens that commonly cause intestinal diseases. P. aeruginosa infects host tissues^22,23 and causes physiological and functional changes in host immune cells including neutrophils, macrophages, and epithelial cells, triggering inflammation.²⁴ Y. enterocolitica primarily infects infants and young children²⁵ by adhering to and invading various virulence factors that antagonize the host immune response,²⁶ consequently causing acute gastroenteritis, fever, and diarrhea.²⁷ P. aeruginosa and Y. enterocolitica release quorum-sensing (QS) molecules that regulate their physiological behavior and maintain pathogenic function. P. aeruginosa is regulated by the LasR system, which is controlled by N-3-Oxododecanoyl-homoserine lactone²⁸ (3OxoC12-AHL, C₁₂), and Y. enterocolitica is regulated by the YenR QS system, which is controlled by N-Hexanoyl-Homoserine Lactone²⁹ (C6-AHL, C₆). These QS regulatory mechanisms have opposing functions: LasR is an activator and EsaR is a repressor (Figure. S1). Although the QS system protects the dynamic balance and symbiotic cooperation of the gastrointestinal microbiota, changes in host diet, physiology, and immune function disrupt or destroy the inherent harmony of the QS network in the symbiotic microbial community. In response to this disruption, resident pathogenic bacteria or external gastrointestinal pathogens may proliferate uncontrollably, ultimately leading to gastrointestinal or systemic infections.³⁰ The genetically engineered probiotic EcN has been reported to sense and kill P. aeruginosa. By introducing an anti-biofilm enzyme (DspB) and an auxotrophic strategy, the antibacterial capacity and biosafety of this bacterium have been enhanced. In Caenorhabditis elegans and mouse models, this engineered probiotic has demonstrated significant prophylactic and therapeutic effects against P. aeruginosa infection, providing strong evidence for developing novel antibacterial therapies.³¹

Herein, we designed two simplified logic gates in the engineered EcN probiotic targeting and inhibiting the growth of P. aeruginosa and Y. enterocolitica in vitro by simultaneously responding to two signals C₁₂ and C₆. In situ, murine infection model, the engineered EcN autonomously executed diagnostic and therapeutic activities that efficiently reduced a pre-colonized P. aeruginosa and Y. enterocolitica dual infection (Figure. S2). Although this study represents a proof-of-concept demonstration of simplified logic gates to sense and target dual bacterial infection, we believe this synthetic biology-based antibacterial strategy has the potential to become a new therapeutic option for the prevention and treatment of intestinal diseases caused by bacteria.

Results

Engineering of E. coli Nissle 1917 with P. aeruginosa and Y. enterocolitica sensing-killing circuits

The genetic architecture of the P. aeruginosa and Y. enterocolitica sensing and killing systems is shown in Figure 1a, these are two completely separate sets of genetic circuits. A genetic circuit that senses the P. aeruginosa QS molecule C₁₂ and induces downstream BFP expression was established (LasR-BFP, Figure 1a), and another genetic circuit that senses Y. enterocolitica C₆ and induces downstream mCherry expression (EsaR-mCherry, Figure 1a). The effectiveness of the genetic circuits was verified by observing the induction expression of fluorescence protein. The fluorescence intensity of LasR-BFP and EsaR-mCherry was positively correlated with increasing AHL concentration from 0 to 10⁴ nM (Figure 1b). Both the genetic circuits exhibited maximum fluorescence intensity at 5000-nM AHL, the maximum fluorescence intensity of BFP and mCherry was 980 AU and 800 AU. A high concentration of AHL (10⁴ nM) likely caused a growth inhibition and limited a further increase in fluorescence. The dual-circuit engineered EcN emitted only blue fluorescence in response to C₁₂ and red fluorescence in response to C₆; red and blue fluorescence was produced in response to both the molecules. Crosstalk between the two in parallel constructed genetic circuits was investigated by exposure to C₁₂, N-(3-Oxooctanoyl)-L-homoserine lactone, and C₆, to induce the LasR-BFP and EsaR-mCherry genetic circuits (Figure 1c). The results showed that LasR-BFP is highly sensitive to C₁₂ signaling molecules and EsaR-mCherry is highly sensitive to C₆ signaling molecules.

Next, we replaced the fluorescence reporter genes in both circuits with the antimicrobial peptide Micromycin S (mcsS) to create killing and lysis systems in EcN (LasR – McsS and EsaR – McsS, Figure 1d). The EcN that killed P. aeruginosa was named EcN-KillP, and the EcN that killed Y. enterocolitica was named EcN-KillY. The production and secretion of McsS mediated killing of P. aeruginosa and Y. enterocolitica upon HSL detection in vitro, as demonstrated by significant growth curve and zone of inhibition analyses (Figure 1e,f, and Figure. S3). Results reveal that the addition of EcN-KillP and EcN-KillY into the culture containing P. aeruginosa or Y. enterocolitica substantially inhibits their growth and decreases their OD₆₀₀ value. Meanwhile, we constructed control groups with the inducible promoters P_las and P_esaR regulating the lysis protein E7 (Figure. S4). Once the E7 protein is activated, the bacterial cells lyse, and their growth rate slows down. When co-cultured with pathogenic bacteria, no significant abnormal changes were observed in the growth of the pathogens. These results demonstrated the successful construction of engineered EcN with sensing and killing circuits that can effectively inhibit the growth of P. aeruginosa or Y. enterocolitica.

After successfully obtaining two independent sensing-killing systems, we integrated the two sets of sensing circuits into the same EcN strain (Figure 1g). When P. aeruginosa was present, the engineered EcN with LasR-BFP genetic circuit could respond to C₁₂ molecules and activated the expression of blue fluorescent protein; when Y. enterocolitica was present, the engineered EcN with the EsaR-mCherry genetic circuit activates the expression of red fluorescent protein in response to the C₆ molecule. And when the two pathogens are present at the same time, both signals are present, the engineered EcN containing dual genetic circuits can respond to both C₁₂ and C₆ signaling molecules and activate the expression of blue and red fluorescent proteins. Fluorescence of EcN carrying LasR-BFP and EsaR-mCherry was observed via microscopy (Figure 1g). The fluorescent protein detection results confirmed that, depending on the detection results of the engineered EcN biosensor, we could select the corresponding killing system to eliminate the pathogen, thereby improving the treatment efficiency.

Design of the minimal and logic gate in EcN for 3OxoC12-AHL and C6-AHL response

The sensing-killing circuits we constructed have achieved consistency between the input and output signals. To generate more specific outputs, especially when different pathogens appear simultaneously, we committed to building a logic AND gate. To avoid the complex challenges posed by engineering cascaded logic circuits, we aimed to construct simplified AND gates with minimal DNA footprint. P_las is a LasR-controlled inducible promoter, while EsaR is a transcriptional repressor protein of P_esaR, and AHL derepresses P_esaR expression (Figure. S5). According to the transcriptional regulation mechanism of LasR and EsaR proteins (Figure. S1), we placed the DNA binding sites of LasR and EsaR proteins in artificial promoters (Figure. S5) in order to activate the downstream transcriptional regulation process only when C₁₂ and C₆ signaling molecules are present at the same time (Figure 2a). Here, C₁₂ induced LasR systems and C₆ induced EsaR systems were utilized as binary inputs for the minimal AND gate construction (Figure 2b). EsaR was introduced into the LasR-BFP circuit and the DNA binding site (DBS) of the EsaR protein was placed between the −35 and −10 regions of the P_las promoter, resulting in the creation of a synthetic promoter P_l&e that drives the expression of the AND gate (LEc-sfGFP). The AND gate only turns on when both the C₁₂ and C₆ signal molecules are present. The absence of any one of the HSL signal inputs [(0,0), (1,0), (0,1)] prevents the green fluorescent output (see the truth table in Figure 2b). Results showed that the fluorescent intensity increased with the addition of increasing concentrations of C₁₂ and C₆ signal molecules (Figure 2c). However, the response fold change of the AND gate is relatively small. Thus, we aimed to further optimize the response range of the AND gate circuit.

Figure 2. — Construction and functional characterization of two-signal factor circuits. (a) The principle of constructing a simple and gate. (b) Design of “AND” logic gate in response to C₁₂ and C₆ molecular inputs and their logical operation tables. (c) Fluorescence characterization of LEc-GFP. (d) Comparison of fluorescence intensity results of “AND” logic gate optimized by different promoters. (e) The “AND” logic gate responds to C₁₂ and C₆ AHLs capability tests. (f) Orthogonal reaction measurement curves of C₁₂ and C₆. (g) Fluorescence observation of “AND” logic gate based on two-signal response in *E. coli* Nissle 1917 bacteria. (h) Fluorescence characterization of “AND” logic gate based on two-pathogenic bacteria’s supernatant response in *E. coli* Nissle 1917 bacteria.

The optimization effort mainly focused on the synthetic promoter P_l&e. When the DBS of EsaR was placed downstream of the −10 region of the promoter (naming LEd-sfGFP circuit), the overall fluorescence intensity expression was not as strong as that of the LEc-sfGFP circuit (Figure 2d, Figure. S6a). Therefore, the focus of optimization is to enhance the transcriptional activity of P_l&e in LEc-GFP. cAMP receptor protein (Crp) is an important global transcription factor in E. coli that exists as a homodimer and binds upstream of the promoter, bending the DNA structure, promoting RNA polymerase recruitment, and accelerating transcription.³² We inserted the Crp DBS upstream of the AND gate P_l&e at positions − 61.5, −72.5, and − 83.5 (LEc-GFP-61.5, LEc-GFP-72.5, and LEc-GFP-83.5, respectively; Figure 2d), distant from the LasR DBS at the − 42 region to prevent steric hindrance. The maximum fluorescence intensity for LEc-GFP-61.5 was 2000 AU at 100 nM C₆ and C₁₂, and no significant increase was observed compared with that of LEc-GFP, although fluorescence intensity was concentration-dependent (Figure. S6b). The dynamic range of LEc-GFP-72.5 was five-fold higher than that of the control group, and the maximum fluorescence intensity was 6000 AU under 100 nM C₆ and C₁₂ (Figure. S6c). LEc-GFP-83.5 demonstrated the optimal effect with a dynamic range 10-fold higher than that of the control group and a maximum fluorescence intensity of ~11000 AU under 100 nM C₆ and C₁₂ (Figure. S6d). The characterization results of LEc-GFP, LEd-GFP, LEc-GFP-61.5, LEc-GFP-72.5, and LEc-GFP-83.5 revealed that placing Crp DBS at a position of P_l&e −83.5 is optimal (Figure 2d), we named this strain EcN-Sense-83.5. Therefore, we successfully constructed an AND logic gate that can respond to dual-signal molecules and function only when both the signal molecules (C₁₂ and C₆) are present.

To exclude the influence of single-signal molecules on genetic circuits, more detailed representations of the logic gates of LEc-GFP-83.5 were shown in Figure 2e,f. The orthogonal dose response curves of dual-signal molecules with LEc-GFP-83.5 were obtained by adding only C₁₂ at concentrations from 0 to 1000 nM and then maintaining the concentration at 1000 nM while adding C₆ at concentrations from 0 to 1000 nM (Figure 2f). Conversely, the orthogonality of dual-signal molecules with LEc-GFP-83.5 was further verified by adding only C₆ at concentrations from 0 to 1000 nM and then maintaining the concentration at 1000 nM while adding C₁₂ at concentrations from 0 to 1000 nM (Figure 2f). The addition of only C₆ or C₁₂ did not activate the AND gate, regardless of their concentration, and the fluorescence intensity was same as the basal output. At a concentration of C₁₂ or C₆ of 1000 nM and when the other AHL was added at increasing concentrations, fluorescence intensity showed a positive linear relationship with the concentration of the second HSL.

To assess the response of the AND gate to the simultaneous addition of C₁₂ and C₆ AHL, we determined its fluorescence intensity following the addition of C₁₂ and C₆ at different concentrations. The results showed that the higher the concentration of C₁₂ and C₆ (within 100 nM), the stronger the fluorescence intensity of the AND gate (Figure 2e and Figure. S7). In addition, compared with the previous logic gate LEc-GFP, the introduction of the Crp DBS significantly promoted the transcriptional activity of the entire logic AND gate without sacrificing the basal leakage. Fluorescence microscopy observation revealed that only when cultured with C₁₂ and C₆ simultaneously, EcN-Sense-83.5 exhibited green fluorescence (Figure 2g), while EcN-Sense-83.5 incubated only with C₁₂ or C₆ did not emit fluorescence. Additionally, fluorescence intensity was produced only when EcN-Sense-83.5 was cocultured with P. aeruginosa and Y. enterocolitica Fig. 2h), demonstrating that EcN-Sense-83.5 was successfully engineered to detect the presence of P. aeruginosa and Y. enterocolitica.

Directed chemotactic motility and killing effect of the engineered EcN toward P. aeruginosa and Y. enterocolitica

To realize the chemotactic motility and killing effect of the engineered EcN on pathogenic bacteria, two modules were separately verified and assembled into the AND gate circuit. The killing module was constructed using P_l&e to control McsS and E7 cleavage protein, respectively, named LEc-Kill-83.5 (Figure 3a). Antimicrobial peptide McsS is a class II microcin produced by the E. coli G3/10 strain that has narrow-spectrum antibacterial activity against Gram-negative bacteria. It is characterized by its small size and does not require further post-translational modifications to be activated.^33–36 McsS has been reported to act against V. cholerae^34,37 and P. aeruginosa.^38,39 To effectively release McsS, we used the E7 lysis protein to lyse the EcN chassis. This protein is very small, comprising only 47 amino acids, and it was incorporated into the gene circuit to create module.⁴⁰ Additionally, the E7 lytic protein is a critical component of the SOS response system in the bacteriocin-producing cells of E. coli, and it exports the bacteriocin into the extracellular space under stressful environmental conditions.⁴¹

Figure 3. — Construction and functional characterization of the kill circuit based on dual signal factors. (a) Design and construction of the killing plasmid. (b) Bacterial growth changes when *P. aeruginosa*, *Y. enterocolitica*, and *EcN-KillD* are co-cultured. (c) Inhibition experiment of *EcN-KillD* plate co-culture with *P. aeruginosa* and *Y. enterocolitica* plates. (d) Design and construction of the chemotactic plasmid. (e) Orientation of LEc-CheZ-83.5 and LEc-motA-83.5 in the concentration gradient of AHL. (f) Orientation of LEc-CheZ-YbaQ-83.5 and LEc-motA-YbaQ-83.5 in the concentration gradient of AHL. (g) Construction of *EcN* with killing and chemotactic functions. (h) Killing characterization of the *EcN-KillD* strain with directional movement in a dual-signaling molecule concentration gradient. Control A: *P. aeruginosa* and *EcN-KillD* co-cultured. Control B: *Y. enterocolitica* and *EcN-KillD* co-culture. 0 h-9 h: *P. aeruginosa*, *Y. enterocolitica*, and *EcN-KillD* co-culture.

After the killing circuit LEc-Kill-83.5 was transferred into EcN (EcN-KillD), the latter was cocultured with P. aeruginosa, Y. enterocolitica and P. aeruginosa, and Y. enterocolitica separately. P. aeruginosa, Y. enterocolitica and P. aeruginosa, and Y. enterocolitica cultures without EcN-KillD were used as the control (Figure 3b and Figure. S8). The results revealed that the cocultivation of EcN-KillD and P. aeruginosa did not inhibit the growth of P. aeruginosa, similar to Y. enterocolitica. Notably, when EcN-KillD was co-cultivated with P. aeruginosa and Y. enterocolitica, the OD₆₀₀ value did not increase, showing a downward trend in the range of 0.8–0.9. The killing effectiveness of the EcN-KillD was also demonstrated by the bacteriostatic zone on the plate (Figure 3c). EcN-KillD inhibited the growth of mixed cultures of P. aeruginosa and Y. enterocolitica, and the diameter of the bacteriostatic zone reached 2.2 cm. Based on the above experimental results, we successfully engineered a kill circuit in EcN to simultaneously respond to C₁₂ and C₆ signaling molecules generated from mixed cultures of P. aeruginosa and Y. enterocolitica. Thus, EcN-KillD can sense C₁₂ and C₆ to secrete McsS to kill P. aeruginosa and Y. enterocolitica, respectively, and EcN-KillD can be lysed via the lysing protein E7.

Enabling EcN-KillD to swim against the concentration gradient of HSL and localize closer to pathogenic bacteria, we engineered EcN with an HSL-responsive chemotaxis system, which allows the concentration gradient of HSL to control the chemotaxis of EcN. First, cheZ and motA, the important genes that affect EcN motility, were knocked out via homologous recombination (Figure. S9). MotA is a motor protein that promotes the twisting force of the flagella.⁴² CheZ acts as a phosphatase that inhibits the chemical pathway between CheA and motor proteins and terminates the tumbling bias of E. coli.⁴³ The knockout strains were named EcNΔcheZ and EcNΔmotA and they formed compact colonies, whereas wild-type EcN colonies were spread across the entire plate, thereby demonstrating the loss of motility in EcNΔcheZ and EcNΔmotA (Figure. S10).

The chemotaxis systems were constructed by replacing gfp with cheZ and motA genes in LEc-GFP-83.5 (Figure 3d), forming LEc-CheZ-83.5 and LEc-MotA-83.5. YbaQ is a short degron that can be specifically degraded by the ClpXP or ClpAP complex, thereby efficiently degrading the fusion protein.^44,45 The ybaQ sequence was added after cheZ and motA to strictly regulate the chemotaxis system, forming LEc-CheZ-YbaQ-83.5 and LEc-MotA-YbaQ-83.5. After the introduction of LEc-CheZ-83.5 and LEc-MotA-83.5 into EcNΔcheZ and EcNΔmotA, respectively, motility was restored, though it was weaker than that of wild-type EcN. LEc-CheZ-YbaQ-83.5 exhibited stronger mobility than LEc-MotA-83.5. Chemotaxis toward AHLs by LEc-CheZ-83.5 and LEc-CheZ-YbaQ-83.5 was demonstrated in the presence of C₁₂ and C₆ signal molecules; motility of the LEc-CheZ-YbaQ-83.5 strain was stronger (Figure 3e,f). The LEc-MotA-83.5 and LEc-MotA-YbaQ-83.5 strains showed no clear directed chemotaxis. EcN with CheZ-YbaQ showed significantly enhanced, directed chemotaxis up the AHL concentration gradient, demonstrating that CheZ is more suitable than MotA for building directed chemotaxis systems.

The Kill and Motility systems were co-transformed into EcN (named EcN-Motility-Kill, Figure 3g) to construct the dual-circuit EcN-Kill-Motility. EcN-Motility-Kill was inoculated at the center of an agar plate with an HSL concentration gradient and exhibited directed movement within the concentration gradient of C₁₂ and C₆. The strain of EcN-Motility-Kill also inhibited the growth of P. aeruginosa Y. enterocolitica during the process of motility (Figure 3h).

Engineered EcN in a P. aeruginosa and Y. enterocolitica dual-infected murine model

Mice were housed and fed as shown in Figure 4a, infected with P. aeruginosa and Y. enterocolitica via intragastric administration, and monitored daily for changes in body weight (Figure 4b). On day 3 after infection, mouse body weights reached their nadir. The animals were sacrificed and the colonic tissues were dissected and measured (Figure 4c and Figure. S11) and found to be shorter than the controls in all infected groups. Average colon length was shortest in mice infected with both pathogens (the average length 4 cm; p < 0.0001).

Proximal (P) and distal (D) colon tissues were assessed for levels of IL-6 and IL-1β inflammatory factor expression (Figure 4d–g). IL-1β expression was higher in all three infection models versus the controls, and highest in the double infection group (0.0001 < p < 0.0005). Expression was extremely significant in the distal colon of the double infection group (p < 0.0001). We also measured inflammatory expression in each mouse individually to inspect individual differences and obtained similar results (Figure. S12). Colon tissues were stained with hematoxylin-eosin and observed by microscopy (Figure. S13). In all three infected groups, varying degrees of mucosal erosion, crypt dilation, and cellular degeneration were observed compared to the control group. Lymphocyte aggregation and infiltration were observed in the double-infected group. Therefore, we used a “four-point scale” to comprehensively evaluate the mice based on multiple indicators, including body weight, colon length, expression levels of inflammatory factors, and pathological tissue sections (Figure. S14), which indicated that the mouse model of dual bacterial infection was successfully established.

The engineered probiotics EcN-KillP, EcN-KillY, and EcN-KillD strains were applied to animal models infected with single strains of P. aeruginosa and Y. enterocolitica through oral gavage (Figure 5a), in order to evaluate the therapeutic efficacy of the engineered probiotics in situ in animals. We marked the day of gavage with the pathogen as Day 0 and began monitoring changes in the body weight of the mice (Figure 5b,c). On Day 4, the body weight of the mice dropped to its lowest point. Then, we intervened with the successfully constructed engineered probiotics. The results showed that the groups treated with EcN-KillP and EcN-KillY probiotics had a significant increase in body weight, while the group treated with EcN-KillD maintained a low body weight without recovery. The group treated with the wild-type EcN had a body weight that was close to or slightly better than that of the EcN-KillD group, which we speculate is due to the inherent probiotic properties of EcN that allowed for a slow recovery in body weight. By measuring the length of the mice’s colons (Figure 5d), the results corresponded with the body weight findings. This also indirectly proves that although our constructed engineered probiotics cannot restore the body weight of infected mice to the level of the control group in a short period, they can accelerate the probiotic effects and shorten the time for the mice to self-heal.

Figure 5. — Application of engineered probiotics *E. coli* Nissle 1917 in mice infection model. (a) Mice feeding cycle and engineering probiotics *EcN-KillP* and *EcN-KillY* intervention diagram. (b) Changes of body weight in different groups of mice after gavage of *P. aeruginosa* and *EcN-KillP*. (c) Changes of body weight in different groups of mice after gavage of *Y. enterocolitica* and *EcN-KillY*. (d) Colon length of mice after intervention with engineered probiotics. (e) Changes of IL-6 inflammatory factor levels in the colon of different groups of mice after *P. aeruginosa* infection. (f) Changes of IL-1β inflammatory factor levels in the colon of different groups of mice after *P. aeruginosa* infection. (g) Changes of IL-6 inflammatory factor levels in the colon of different groups of mice after *Y. enterocolitica* infection. (h) Changes of IL-1β inflammatory factor levels in the colon of different groups of mice after *Y. enterocolitica* infection.

On the 8th day, after euthanizing the mice, the proximal and distal tissues of the mouse colon were collected to assess the expression levels of inflammatory factors IL-6 and IL-1β following intervention with the engineered probiotics EcN-KillP and EcN-KillY. After infection with P. aeruginosa, the levels of IL-6 and IL-1β inflammatory factors in the proximal and distal tissues of the mouse colon treated with EcN-WT were both increased by four times compared to the blank control group (Figure 5e,f). In the proximal tissues of the colon of mice treated with EcN-KillD, the expression level of IL-6 was increased by 4 times, and the inflammatory level of IL-1β was increased by 4.5 times compared to the blank group. In the distal tissues, both IL-6 and IL-1β inflammatory levels were increased by more than five times, with the expression level of IL-1β even reaching six times. However, in the distal and proximal tissues of the colon of mice intervened with EcN-KillP, the expression level of the inflammatory factor IL-6 was increased by two times compared to the blank control group, while the inflammatory level of IL-1β was only 1.5 times that of the control group. After infection with Y. enterocolitica, the levels of IL-6 and IL-1β inflammatory factors in the proximal and distal tissues of the mouse colon treated with EcN-WT and EcN-KillD were both increased by four times compared to the blank control group (Figure 5g,h), with the inflammatory level of IL-1β in the distal colon tissues even reaching five times. In contrast, in the distal and proximal tissues of the colon of mice intervened with EcN-KillY, the expression levels of the inflammatory factors IL-6 and IL-1β were only increased by two times compared to the blank control group. The results above indicate that the engineered probiotics we constructed have a certain specificity, exerting their therapeutic effects against specific disease conditions. Although EcN-WT has probiotic properties, its probiotic functions are insufficient to improve the health status of diseased mice in a short period.

Next, we evaluated the treatment effect of the strain of EcN-KillD in a P. aeruginosa and Y. enterocolitica dual-infected murine model through conducting intervention experiments, the infected group with PBS gavage was used as negative control and the uninfected group with PBS gavage was used as positive control (Figure 6a). After oral administration of EcN-KillD, mice treated with probiotics showed significant weight recovery compared with positive controls (Figure 6b). The wild-type EcN had a non-significant probiotic effect and thus could not play a therapeutic role (Figure 6b). Also, the average colon length was 3.8 cm in the untreated mice (p < 0.0001) (Figure 6c). With gavage of EcN-WT, the average colon length was approximately 4.5 cm (p < 0.0001). With gavage of EcN-KillD, the average colon length was approximately 5.4 cm (0.0001 < p < 0.0005). This indicated the group of EcN-KillD gavaged exhibited noticeable recovery in colon length compared to dual-infected mice.

After oral administration of pathogens, we collected feces every 2 days to measure IL-6 and IL-1β inflammatory marker expression (Figure 6d,e). The result showed that the 4th day, which is the day of probiotic gavage, acts as a turning point. In the first 4 days, the levels of inflammatory factors increased, then decreased from day 4 to day 8.

Finally, we conducted a statistical analysis of the richness, species composition, and interspecies relationships of the mouse gut microbiota (Figure 6f). We analyzed the proportion of gut microbiota in the feces of mice at the genus level (Figure. S15). From the results, we found that after gavage with pathogenic bacteria, the proportion of P. aeruginosa in the mouse gut increased from 2%–4% to 17%–25% (Figure 6g), and the proportion of Y. enterocolitica increased from 2%–7% to 19%–22% (Figure 6h). After intervention with the engineered probiotics we constructed, the proportion of P. aeruginosa decreased from 22% to 12% (Figure 6g), and the proportion of Y. enterocolitica decreased from 21% to 10% (Figure 6h). In contrast, in the group intervened with wild-type EcN after infection, the proportion of P. aeruginosa changed from 25% to 17% (Figure 6g), with minimal changes in the microbial community ratios. The proportion of Y. enterocolitica remained at 22% (Figure 6h), with no changes in the microbial community ratios. This set of data indirectly reflects that the engineered probiotics we constructed can exert corresponding therapeutic effects on the basis of their inherent probiotic functions. Subsequently, we also detected the abundance of the entire microbial community in the gut of mice from all groups (Figure 6i). There were no significant differences in the total number of bacterial communities between the infected and treated groups and the blank group before and after the administration of the pathogenic bacteria, as well as before and after the intervention with engineered probiotics. Additionally, the proportion of unique bacterial communities in the treated group increased from 9% before probiotic intervention to 38%. We believe this is because the engineered probiotics we constructed not only eliminated the pathogenic bacteria but also functioned as probiotics, stabilizing the gut microbiota and restoring its abundance, whereas the presence of pathogenic bacteria would disrupt the homeostasis of the gut microbiota. Moreover, the released McsS had no significant impact on other unrelated bacterial communities.

The three constructed probiotic strains with bactericidal properties can exert their unique therapeutic and probiotic effects against specific disease conditions, and they only become active upon being triggered by specific virulence factors, this significantly reduces the stress response of foreign substances on the body. While treating bacterial diseases, they protect the health and stability of the body to a greater extent, providing a foundation for future research on the use of engineered probiotics to prevent and treat dual bacterial infections.

Discussion

Currently, limited treatment options are available for infection caused by two or more bacteria together. Only some synthetic antibiotics and sulfonamide drugs are available for treatment. However, there is an urgent need for a new and effective treatment strategy to address this issue because of the increasing antibiotic resistance and emergence of superbugs. As an important candidate for probiotic therapy, EcN has always been at the forefront of research in probiotic genetic engineering owing to its clear research background and well-understood biological properties.⁴⁶ the The applications of synthetic bacterial therapy based on quorum-sensing (QS) circuits for the treatment of intestinal diseases emphasize the potential of QS circuits in dynamically regulating bacterial behavior and achieving the integration of disease diagnosis and treatment. By designing and applying QS genetic circuits, precise diagnosis and personalized treatment of intestinal diseases can be realized, providing a new direction for next-generation personalized medicine.⁴⁷ EcN competes with pathogenic bacteria in the intestines and protects the host from invasive infections.⁴⁸ Clinical attempts have already been made to use EcN for engineering therapeutic bacteria to address various intestinal diseases, including metabolic disorders such as hyperammonemia, as well as extraintestinal diseases such as tumor detection and treatment.⁴⁹ In previous studies, the engineered EcN that produces salicylic acid and immunotherapeutic molecules has been successfully used for the detection and treatment of colorectal cancer.⁵⁰ Redenti et al. used engineered probiotic EcN as a carrier to deliver tumor neoantigens, effectively controlling tumor growth and prolonging survival.⁵¹

Based on synthetic biology, the emergence of genetically engineered probiotic therapy using genetic circuits provides unlimited possibilities for the clinical treatment of complex and severe infectious diseases and cancer. Taketani et al. designed a set of genome-integrated NOT/NOR gates based on single guide RNA (CRISPR-dCas9) in Bacteroides thetaiotaomicron and constructed genetic circuits that respond to bile acids and dehydrotetracyclines. This genetic system plays an important role in the in vitro human gut model system and in bacteria associated with the primary colonic epithelial monolayer.⁵² Here, we incorporated the concept of “logic gates” into the engineered probiotic EcN. Our work research indicates that the strategy of integrating dual or multiple logic input signals in genetic circuits to generate cellular responses can serve as a mechanism for the development of therapeutic drugs. In this design, the complexity of the cascade circuit is excluded, minimal-sized genetic logic gates are simple circuits with a small DNA footprint. First, we constructed two independent gene circuits that sense C₁₂ and C₆ signal molecules, respectively, in EcN, which is used for monitoring the existence of either of the pathogens through two different fluorescent proteins expression. Then the corresponding killing systems were arranged to eliminate the pathogens. The advantage of the sensing system is it can detect multiple signals with multiple outputs at the same time. To simplify the outputs when encountering dual pathogen infection, we designed an AND logic gate by employing the LasR-inducible promoter P_las with a downstream EsaR roadblock to construct an engineered probiotics EcN that could simultaneously respond to C₁₂ and C₆ molecules and finally kill P. aeruginosa and Y. enterocolitica. The two-signal input AND gate showed a threefold greater response when it was first built. To enlarge the dynamic range of the AND gate, enhancing the strength of the promoter simply by changing the −35 and −10 regions of P_l&e promoter is not a good choice because the −35 region overlaps with the DBS of LasR, which may greatly affect the ability of LasR to activate the promoter. Therefore, we redesigned P_l&e by placing the CRP-binding site upstream. The CRP-binding site is an important transcriptional regulation sequence (consensus sequence: AAATGTGATCTAGATCACATTT) widely distributed in many bacteria.^53,54 CRP is a cyclic AMP activated allosteric protein. This CRP-cAMP complex can bind to a recognition site in the target core promoters to assist RNA polymerase binding to the promoter. Ge et al. have demonstrated that integration of more CRP-binding sites in the luxR-luxI intergenic sequence strongly activated the P_luxR transcription.⁵⁵ Herein, we hypothesized that P_las is also a CRP-dependent promoter, and the increased numbers of CRP-binding sites could recruit more CRP-cAMP complexes, enhancing transcription from P_las, especially the AND gate promoter P_l&e by strengthening interactions with RNAP. The resulting LEc-GFP-83.5 system showed a 10-fold greater dynamic range than the control. This result demonstrated the effectiveness of CRP-binding site integration and the constructed AND gate possess both high dynamic ranges and low leakiness.

Based on the AND gate gene circuit, the chemotaxis and killing genetic circuits were constructed to respond to dual-signal molecules and were combined to achieve antibacterial effects during directed movement, effectively inhibiting the growth of P. aeruginosa or Y. enterocolitica pathogens. Engineered probiotics with CheZ-YbaQ showed a significant directed chemotaxis ability toward the AHL concentration gradient, indicating CheZ is more suitable than MotA for building directed chemotaxis systems. The motion of the cell toward the attractant is achieved by increasing run length and decreasing tumbling frequency.⁵⁶ CheZ, as a phosphatase, accelerates hydrolysis and removes the phosphate group from CheY-P, inhibiting the chemotaxis pathway between CheA and the flagellar motor. This terminates the biased tumbling and enables bacteria to perform directed chemotaxis along the concentration gradient of signal molecules.⁴² The microcin S was selected to inhibit the growth of P. aeruginosa and Y. enterocolitica. By inducing lysis of the engineered probiotics, large quantities of microcin S can be rapidly released to suppress pathogen proliferation. This study did not opt for the direct secretion method of microcin S, as direct secretion is more suitable for chronic diseases requiring long-term microbial modulation or mucosal barrier repair, such as Crohn’s disease or ulcerative colitis.⁵⁷

In our mouse model, dual infection of P. aeruginosa and Y. enterocolitica caused the most severe damage, as observed by indicators including body weight, colon length, and inflammatory marker expression (IL-6 and IL-1β). However, after intervention with the engineered probiotics, we observed significant improvement in all indicators on the 4th day. Although mice have some healing ability and their body weight would recover over time, the probiotic intervention significantly shortened the healing time and improved the animals’ health status (Figure 5). The engineered probiotics were able to sense the pathogen and accelerate bacterial clearance from in vitro and in situ. Then the engineered probiotics can promote their own clearance after executing their programmed functionalities. The in vitro and in situ efficacy of the engineered probiotics suggests the potential utility of this therapeutic regimen. More research data also indicate that engineered bacterial strains are more effective at preventing infections than combating pre-established infections, and the duration of protection provided by engineered probiotics will depend on the ability of the cells to remain in the gut as well as many other factors.³¹ Therefore, we believe that a single dose of engineered probiotics can protect for several weeks against infections by P. aeruginosa and Y. enterocolitica.

The introduction of logic gates into probiotic therapy provides ideas for directly and effectively addressing diseases caused by various pathological mechanisms. Our work emphasizes the potential of rational creation of minimal “AND” gate circuits using an inducible promoter with a roadblock model. By integrating gene circuits that sense two or multiple input signals with the logic of an “AND” gate, our platform establishes a modular framework capable of processing distinct infection types and triggering tailored therapeutic responses through performance-optimized genetic programs. Our work lays a preliminary foundation for designing multi-sensing circuits and logic gates in the chassis of the engine to explore the diagnosis and treatment of pathogen infections.

Materials and methods

Strains culture and plasmids construction

All E. coli strains were maintained in Luria Bertani (LB) medium at 37°C with appropriate antibiotics and/or supplements unless stated otherwise (final concentrations: 100 μg/L ampicillin, 25 μg/L kanamycin, and 17 μg/L chloramphenicol). Cloning was performed with E. coli DH5α and functional identification was performed with a modified EcN strain. The recombinant plasmids cloned in E. coli DH5α were electroporated and transformed into EcN. The electroporation procedure was performed using 2500 V, 25μF, and 200 Ω, with an electrotransformation constant of approximately 5.0. After electroporation, cells were incubated in 1 mL LB medium at 37°C for 1 h, then spread on LB agar containing 100 μg/mL ampicillin and vancomycin. Single colonies were verified by sequencing. P. aeruginosa and Y. enterocolitica were cultivated in LB medium at 37°C.

Plasmids and strains are listed in Table S1. Primers are listed in Table S2. Gene IDs are listed in Table S3.

Fluorescence assay

The colonies were cultured overnight at 37°C in LB medium containing ampicillin and chloramphenicol (2% inoculum size) and transferred to 48-well plates. Once the samples reached an OD₆₀₀ of 0.5–0.8, different concentrations of 3OxoC12-AHL and C6-AHL were added at 2% each (0, 0.1, 1, 10, 100, 1000, 5000, and 10,000 nM). After 24 h, the OD₆₀₀, BFP (excitation at 402 nm and emission at 457 nm), mCherry (excitation at 583 nm and emission at 645 nm), and GFP (excitation at 485 nm and emission at 528 nm) were measured using a BioTek Synergy plate reader. Fluorescent protein expression in EcN was also observed via inverted fluorescence microscopy (Nikon).

Orthogonal analysis of 3OxoC12-AHL and C6-AHL

EcN harboring the LEc-GFP-83.5 circuit was cultured overnight at 37°C in LB medium containing ampicillin. Then, EcN was reinoculated at a 2% inoculum size into a 48-well plate containing LB medium with ampicillin. At OD₆₀₀ 0.6−0.8, C₁₂ (C₆) was added and incubated for 12 h (0, 0.1, 1, 10, 100, and 1000 nM). Then, based on the 1000 nM concentration of C₁₂ (C₆), 0, 0.1, 1, 10, 100, and 1000 nM C₆ (C₁₂) were added, culturing was continued for another 12 h, and fluorescence intensity was measured.

In vitro bacteriostatic assay of engineered probiotic EcN

P. aeruginosa and Y. enterocolitica were inoculated in LB liquid medium at 2% inoculum size and cultured overnight at 37°C. The overnight culture was inoculated into LB medium at 2% inoculum size, following which 1.5 ml of culture was transferred to a 24-well cell culture plate. The pathogenic bacteria were incubated at 37°C with agitation to OD₆₀₀ ~0.9, cocultured with EcN harboring LEc-Kill-83.5 for 24 h, and then bacterial growth was measured.

A 2% inoculum of EcN was added to LB liquid medium and incubated for 2 h. Then, P. aeruginosa and Y. enterocolitica (2%) were added to induce the expression of McsS in EcN. At OD₆₀₀ ~1.5, a 200-μl aliquot of the induced bacterial suspension was collected. A mixture of P. aeruginosa and Y. enterocolitica was spread on antibiotic-free LB solid medium and precultured at 37°C for 1 h. Then, an Oxford cup was placed in the center of the plate and the 200 μl aliquot of induced bacterial liquid was added. The control group was treated with PBS and bacterial growth was measured.

Knockout of cheZ and motA

The EcN cheZ and motA genes were knocked out via parental hybridization.⁵⁸ To construct the ΔcheZ mutant or ΔmotA mutant, plasmids EcNΔcheZ and EcNΔmotA were constructed. The left and right homologous fragments for deleting cheZ or motA were amplified from the genomic DNA of EcN by PCR. Deletion of cheZ or motA was achieved by two rounds of homologous recombination as described previously. The principle and detailed procedures are described in Supplementary Figure S9.

Chemotactic and killing assay by P. aeruginosa and Y. enterocolitica induction

Parafilm (pretreated overnight with UV) was placed 1 cm from the edge of the LB semisolid medium. A mixed induction solution of 100 nM 3OxoC12-AHL and C6-AHL was added dropwise on the membrane and incubated at 37°C for 6 h. After culturing the EcN harboring LEc-CheZ-83.5 and LEc-CheZ-YbaQ-83.5 to OD₆₀₀ 0.6–0.8, 10 μl of the bacterial suspension was placed on the opposite side of the LB semisolid medium 1 cm from the edge. The plate was incubated at 37°C for 24 h and bacterial motility was observed.

The mixed culture of P. aeruginosa and Y. enterocolitica (10 μl) was inoculated 1 cm from the edge of the LB semisolid medium and incubated for 3 h at 37°C. Then, EcN containing LEc-CheZ-YbaQ-83.5 and LEc-Kill-83.5 dual plasmids was inoculated in the center of the plate (20 μl). The plate was incubated at 37°C and photographs were taken every 3 h. The inhibitory effect of the engineered probiotics on the chemotaxis of P. aeruginosa and Y. enterocolitica was observed.

Animal model

All procedures were conducted under Institutional Animal Care and Use Committee (IACUC) guidelines and in conformity with protocols approved by the NUS IACUC (R18–0329) and all relevant ethical regulations were approved by the Animal Ethics Committee of Shandong University. Female C57BL/6 mice (6–8 weeks old, purchased from Jiangsu Huachuang sino Pharma Tech Co.Ltd.) were provided with an antibiotic cocktail in water (0.4 mg/mL ampicillin) for a week following acclimatization (−1 day). The mice were maintained on a complex carbohydrate-free diet and infected with P. aeruginosa (2 × 10⁹ CFU) and Y. enterocolitica (2 × 10⁹ CFU) on day 0 through oral gavage, and weighed daily. Probiotics (1 × 10¹¹ CFU) were administered via oral gavage on the fourth day. The animals were monitored up to 8 days post-infection. Animal experiments were conducted in standardized housing and under standard housing conditions (12 light/12 dark cycle, 22°C–24°C with humidity set at 40%–50%) at the National Glycoengineering Research Center of Shandong University.

Extraction of RNA from mouse feces

On day 0, day 2, day 4, day 6, and day 8, collect 3–5 fecal pellets from the mice and place them into 1.5-ml EP tubes. Add 1 ml of Trizol solution and then perform low-temperature oscillation grinding. After grinding, centrifuge the grinding solution at 12,000 rpm for 2 min. Take 800 µl of the supernatant from the grinding solution and add 1/5 volume of chloroform solution. Mix thoroughly and then place on ice for 15 min. Centrifuge at 12,000 rpm for 15 min. Pipette 350 µl of the upper clear liquid, add an equal volume of isopropanol solution, mix thoroughly, and then place on ice for 10 min. Centrifuge at 10,000 rpm for 10 min. Discard all the supernatant, add 700 µl of 70% ethanol solution, and centrifuge at 7,500 rpm for 5 min. Discard all the supernatant again and add 30 µl of DNase/RNase-free water. The fecal RNA extraction is now complete. (All samples were quickly frozen with liquid nitrogen before grinding and stored at −80℃. All centrifugation operations should be performed at 4℃.)

Reverse transcription and quantitative PCR

The reverse transcription kit HiScript II Q RT SuperMix for qPCR (Catalog No.: R223) and the qPCR kit Taq Pro Universal SYBR qPCR Master Mix (Catalog No.: 712–02) were both purchased from Nanjing Vazyme Biotech Co., Ltd. The operating procedures were carried out according to the instructions provided with the kits. The primer sequences used for qPCR were all downloaded from PrimerBank (https://pga.mgh.harvard.edu/primerbank/index.html) and shown in Table S5.

Detection of bacterial colonies in the intestinal tract

On day 0 (before gavage with pathogenic bacteria), day 4 (before probiotic intervention), and day 8 (before sacrifice), fecal pellets (3–5) from all mice were collected, placed into clean sterile 1.5 ml EP tubes, rapidly frozen in liquid nitrogen, and then stored at −80℃ for analysis of gut microbiota richness in mice. The extraction of nucleic acids from mouse feces, PCR amplification, and construction of sequencing libraries for the determination of gut microbiota richness and transcriptome were commissioned to Shanghai Majorbio Bio-pharm Technology Co., Ltd.

Statistics

In statistics, error bars indicate standard deviations from three parallel experiments. The statistical analyses were performed using Prism 9.0.0 software (GraphPad, La Jolla CA) (http://www.graphpad.com). The significant difference between different groups was analyzed using independent one-way analysis of variance (ANOVA, nonparametric or mixed) and two-way ANOVA to calculate the adjusted p-values, the p-value <0.0005 (*) indicated statistical significance, and p-value <0.0001 (****) was considered extremely significant.

All data related to the gut microbiota were processed on the Majorbio Cloud Platform (https://cloud.majorbio.com).

Supplementary Material

Surrporting information.docx

KGMI_A_2530156_SM7014.docx^{(6.7MB, docx)}

Acknowledgments

The authors would like to thank Sen Wang, Xiaomin Zhao, and Yuyu Guo from the State Key Laboratory of Microbial Technology of Shandong University for their help and guidance in fluorescence microscopy.

We thank the ACS authoring services team for editing the language of the draft of this manuscript.

Funding Statement

This work was supported by the National Key R&D Program of China [2024YFA0917100], and the National Natural Science Foundation of China [32270089].

Disclosure statement

No potential conflict of interest was reported by the author(s).

Author contributions

H.L. performed all the experiments and data analysis. S.Z., G.W., and J.Y. participated in the gavage experiment in mice. Qi W. participated in the logic gate design work. L.L. participated in the design of dual-infected murine model. Q.Q. and Q.W. supervised the whole work and wrote the manuscript with comments from all authors.

Data availability statement

All data are available in manuscript and supplementary file.

Supplementary material

Supplemental data for this article can be accessed online at https://doi.org/10.1080/19490976.2025.2530156.

References

1.Braff D, Shis D, Collins JJ.. Synthetic biology platform technologies for antimicrobial applications. Adv Drug Delivery Rev. 2016;105(Pt A):35–19. doi: 10.1016/j.addr.2016.04.006. [DOI] [PubMed] [Google Scholar]
2.Ruder WC, Lu T, Collins JJ. Synthetic biology moving into the clinic. Science. 2011;333(6047):1248–1252. doi: 10.1126/science.1206843. [DOI] [PubMed] [Google Scholar]
3.Suez J, Zmora N, Segal E, Elinav E. The pros, cons, and many unknowns of probiotics. Nat Med. 2019;25(5):716–729. doi: 10.1038/s41591-019-0439-x. [DOI] [PubMed] [Google Scholar]
4.Hwang IY, Chang MW. Engineering commensal bacteria to rewire host-microbiome interactions. Curr Opin In Biotechnol. 2020;62:116–122. doi: 10.1016/j.copbio.2019.09.007. [DOI] [PubMed] [Google Scholar]
5.Goh YL, He H, March JC. Engineering commensal bacteria for prophylaxis against infection. Curr Opin In Biotechnol. 2012;23(6):924–930. doi: 10.1016/j.copbio.2012.03.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Duval M, Lewis CJ, Nomellini JF, Horwitz MS, Smit J, Cavacini LA. Enhanced neutralization of HIV by antibodies displayed on the S-layer of caulobacter crescentus. Antimicrob Agents Chemother. 2011;55(12):5547–5552. doi: 10.1128/AAC.00509-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Gupta S, Bram EE, Weiss R. Genetically programmable pathogen sense and destroy. ACS Synth Biol. 2013;2(12):715–723. doi: 10.1021/sb4000417. [DOI] [PubMed] [Google Scholar]
8.Lu TK, Collins JJ. Engineered bacteriophage targeting gene networks as adjuvants for antibiotic therapy. Proc Natl Acad Sci USA. 2009;106(12):4629–4634. doi: 10.1073/pnas.0800442106. [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Sagheddu V, Uggeri F, Belogi L, Remollino L, Brun P, Bernabe G, Moretti G, Porzionato A, Morelli L, Castagliuolo I, et al. The biotherapeutic potential of lactobacillus reuteri characterized using a target-specific selection process. Front Microbiol. 2020;11:532. doi: 10.3389/fmicb.2020.00532. [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Mao N, Cubillos-Ruiz A, Cameron DE, Collins JJ. Probiotic strains detect and suppress cholera in mice. Sci Transl Med. 2018;10(445). doi: 10.1126/scitranslmed.aao2586. [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Duan F, March JC. Engineered bacterial communication prevents vibrio cholerae virulence in an infant mouse model. Proc Natl Acad Sci USA. 2010;107(25):11260–11264. doi: 10.1073/pnas.1001294107. [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Lynch JP, González-Prieto C, Reeves AZ, Bae S, Powale U, Godbole NP, Tremblay JM, Schmidt FI, Ploegh HL, Kansra V, et al. Engineered escherichia coli for the in situ secretion of therapeutic nanobodies in the gut. Cell Host & Microbe. 2023;31(4):634–649.e8. doi: 10.1016/j.chom.2023.03.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Koh E, Hwang IY, Lee HL, De Sotto R, Lee JWJ, Lee YS, March JC, Chang MW. Engineering probiotics to inhibit clostridioides difficile infection by dynamic regulation of intestinal metabolism. Nat Commun. 2022;13(1):3834. doi: 10.1038/s41467-022-31334-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Kobayashi H, Kaern M, Araki M, Chung K, Gardner TS, Cantor CR, Collins JJ. Programmable cells: interfacing natural and engineered gene networks. Proc Natl Acad Sci USA. 2004;101(22):8414–8419. doi: 10.1073/pnas.0402940101. [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Khalil AS, Collins JJ. Synthetic biology: applications come of age. Nat Rev Genet. 2010;11(5):367–379. doi: 10.1038/nrg2775. [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Nielsen AAK, Der BS, Shin J, Vaidyanathan P, Paralanov V, Strychalski EA, Ross D, Densmore D, Voigt CA. Genetic circuit design automation. Science. 2016;352(6281). doi: 10.1126/science.aac7341. [DOI] [PubMed] [Google Scholar]
17.Jones TS, Oliveira SMD, Myers CJ, Voigt CA, Densmore D. Genetic circuit design automation with cello 2.0. Nat Protoc. 2022;17(4):1097–1113. doi: 10.1038/s41596-021-00675-2. [DOI] [PubMed] [Google Scholar]
18.Hooshangi S, Thiberge S, Weiss R. Ultrasensitivity and noise propagation in a synthetic transcriptional cascade. Proc Natl Acad Sci USA. 2005;102(10):3581–3586. doi: 10.1073/pnas.0408507102. [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Moon TS, Lou C, Tamsir A, Stanton BC, Voigt CA. Genetic programs constructed from layered logic gates in single cells. Nature. 2012;491(7423):249–253. doi: 10.1038/nature11516. [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Stanton BC, Nielsen AA, Tamsir A, Clancy K, Peterson T, Voigt CA. Genomic mining of prokaryotic repressors for orthogonal logic gates. Nat Chem Biol. 2014;10(2):99–105. doi: 10.1038/nchembio.1411. [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Triassi AJ, Fields BD, Monahan CE, Means JM, Park Y, Doosthosseini H, Padmakumar JP, Isabella VM, Voigt CA. Redesign of an escherichia coli Nissle treatment for phenylketonuria using insulated genomic landing pads and genetic circuits to reduce burden. Cell Syst. 2023;14(6):512–524.e12. doi: 10.1016/j.cels.2023.05.004. [DOI] [PubMed] [Google Scholar]
22.Strateva T, Yordanov D. Pseudomonas aeruginosa - a phenomenon of bacterial resistance. J Med Microbiol. 2009;58(9):1133–1148. doi: 10.1099/jmm.0.009142-0. [DOI] [PubMed] [Google Scholar]
23.Otto M. Physical stress and bacterial colonization. FEMS Microbiol Rev. 2014;38(6):1250–1270. doi: 10.1111/1574-6976.12088. [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Holm A, Vikstrom E. Quorum sensing communication between bacteria and human cells: signals, targets, and functions. Front Plant Sci. 2014;5:309. doi: 10.3389/fpls.2014.00309. [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Niehues J, McElroy C, Croon A, Pietschmann J, Frettloh M, Schroper F. Bacterial lighthouses-real-time detection of Yersinia enterocolitica by quorum sensing. Biosens (Basel). 2021;11(12):517. doi: 10.3390/bios11120517. [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Mazzette R, Fois F, Consolati SG, Salza S, Tedde T, Soro P, Collu C, Ladu D, Virgilio S, Piras F. Detection of pathogenic yersinia enterocolitica in slaughtered Pigs by cultural methods and real-time polymerase chain reaction. Italian J Food Saf. 2015;4(2):4579. doi: 10.4081/ijfs.2015.4579. [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Bottone EJ. Yersinia enterocolitica: revisitation of an enduring human pathogen. Clin Microbiol Newsl. 2015;37(1):1–8. doi: 10.1016/j.clinmicnews.2014.12.003. [DOI] [Google Scholar]
28.Jack AA, Khan S, Powell LC, Pritchard MF, Beck K, Sadh H, Sutton L, Cavaliere A, Florance H, Rye PD, et al. Alginate oligosaccharide-induced modification of the lasI-lasR and rhlI-rhlR quorum-sensing systems in pseudomonas aeruginosa. Antimicrob Agents Ch. 2018;62(5). doi: 10.1128/aac.02318-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Ng Y-K, Grasso M, Wright V, Garcia V, Williams P, Atkinson S. The quorum sensing system of Yersinia enterocolitica 8081 regulates swimming motility, host cell attachment, and virulence plasmid maintenance. Genes. 2018;9(6):307. doi: 10.3390/genes9060307. [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Su Y, Ding T. Targeting microbial quorum sensing: the next frontier to hinder bacterial driven gastrointestinal infections. Gut Microbes. 2023;15(2):2252780. doi: 10.1080/19490976.2023.2252780. [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Hwang IY, Koh E, Wong A, March JC, Bentley WE, Lee YS, Chang MW. Engineered probiotic escherichia coli can eliminate and prevent pseudomonas aeruginosa gut infection in animal models. Nat Commun. 2017;8(1). doi: 10.1038/ncomms15028. [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Geng H, Jiang R. cAMP receptor protein (CRP)-mediated resistance/tolerance in bacteria: mechanism and utilization in biotechnology. Appl Microbiol Biotechnol. 2015;99(11):4533–4543. doi: 10.1007/s00253-015-6587-0. [DOI] [PubMed] [Google Scholar]
33.Zschuttig A, Zimmermann K, Blom J, Goesmann A, Pohlmann C, Gunzer F, Bereswill S. Identification and characterization of microcin S, a new antibacterial peptide produced by probiotic escherichia coli G3/10. PLoS One. 2012;7(3):e33351. doi: 10.1371/journal.pone.0033351. [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Kim S-Y, Randall JR, Gu R, Nguyen QD, Davies BW. Antibacterial action, proteolytic immunity, and in vivo activity of a vibrio cholerae microcin. Cell Host & Microbe. 2024;32(11):1959–1971.e6. doi: 10.1016/j.chom.2024.08.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Zhang G, Lin M, Qin M, Xie Q, Liang M, Jiang J, Dai H, Xu S, Feng S, Liao M. Establishing heterologous production of Microcins J25 and Y in bacillus subtilis. J Agric Food Chem. 2023;71(14):5600–5613. doi: 10.1021/acs.jafc.3c00675. [DOI] [PubMed] [Google Scholar]
36.Telhig S, Pham NP, Ben Said L, Rebuffat S, Ouellette M, Zirah S, Fliss I. Exploring the genetic basis of natural resistance to microcins. Microbiol Genomics. 2024;10(2). doi: 10.1099/mgen.0.001156. [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Peng W, Orth K. A small microcin plays a big role in V. cholerae interbacterial competition. Cell Host & Microbe. 2024;32(11):1880–1881. doi: 10.1016/j.chom.2024.10.011. [DOI] [PubMed] [Google Scholar]
38.Hwang IY, Tan MH, Koh E, Ho CL, Poh CL, Chang MW. Reprogramming microbes to Be pathogen-seeking killers. ACS Synth Biol. 2013;3(4):228–237. doi: 10.1021/sb400077j. [DOI] [PubMed] [Google Scholar]
39.Duquesne S, Destoumieux-Garzon D, Peduzzi J, Rebuffat S. Microcins, gene-encoded antibacterial peptides from enterobacteria. Nat Prod Rep. 2007;24(4):708–734. doi: 10.1039/b516237h. [DOI] [PubMed] [Google Scholar]
40.Saeidi N, Wong CK, Lo TM, Nguyen HX, Ling H, Leong SSJ, Poh CL, Chang MW. Engineering microbes to sense and eradicate pseudomonas aeruginosa, a human pathogen. Mol Syst Biol. 2011;7(1):521. doi: 10.1038/msb.2011.55. [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Chak KF, Kuo WS, Lu FM, James R. Cloning and characterization of the ColE7 plasmid. J Gen Microbiol. 1991;137(1):91–100. doi: 10.1099/00221287-137-1-91. [DOI] [PubMed] [Google Scholar]
42.Karmakar R. State of the art of bacterial chemotaxis. J Basic Microb. 2021;61(5):366–379. doi: 10.1002/jobm.202000661. [DOI] [PubMed] [Google Scholar]
43.Blat Y, Eisenbach M. Mutants with defective phosphatase activity show no phosphorylation-dependent oligomerization of CheZ. The phosphatase of bacterial chemotaxis. J Biol Chem. 1996;271(2):1232–1236. doi: 10.1074/jbc.271.2.1232. [DOI] [PubMed] [Google Scholar]
44.Shin J, Noireaux V. Study of messenger RNA inactivation and protein degradation in an escherichia coli cell-free expression system. J Biol Eng. 2010;4(1):1–9. doi: 10.1186/1754-1611-4-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Flynn JM, Neher SB, Kim YI, Sauer RT, Baker TA. Proteomic discovery of cellular substrates of the ClpXP protease reveals five classes of ClpX-recognition signals. Mol Cell. 2003;11(3):671–683. doi: 10.1016/s1097-2765(03)00060-1. [DOI] [PubMed] [Google Scholar]
46.Ou B, Yang Y, Tham WL, Chen L, Guo J, Zhu G. Genetic engineering of probiotic escherichia coli nissle 1917 for clinical application. Appl Microbiol Biotechnol. 2016;100(20):8693–8699. doi: 10.1007/s00253-016-7829-5. [DOI] [PubMed] [Google Scholar]
47.Dang Z, Gao M, Wang L, Wu J, Guo Y, Zhu Z, Huang H, Kang G. Synthetic bacterial therapies for intestinal diseases based on quorum-sensing circuits. Biotechnol Adv. 2023;65:65. doi: 10.1016/j.biotechadv.2023.108142. [DOI] [PubMed] [Google Scholar]
48.Altenhoefer A, Oswald S, Sonnenborn U, Enders C, Schulze J, Hacker J, Oelschlaeger TA. The probiotic Escherichia coli strain Nissle 1917 interferes with invasion of human intestinal epithelial cells by different enteroinvasive bacterial pathogens. FEMS Immunol and Med Microbiol. 2004;40(3):223–229. doi: 10.1016/S0928-8244(03)00368-7. [DOI] [PubMed] [Google Scholar]
49.Kurtz CB, Millet YA, Puurunen MK, Perreault M, Charbonneau MR, Isabella VM, Kotula JW, Antipov E, Dagon Y, Denney WS, et al. An engineered E. coli Nissle improves hyperammonemia and survival in mice and shows dose-dependent exposure in healthy humans. Sci Transl Med. 2019;11(475). doi: 10.1126/scitranslmed.aau7975. [DOI] [PubMed] [Google Scholar]
50.Gurbatri CR, Radford GA, Vrbanac L, Im J, Thomas EM, Coker C, Taylor SR, Jang Y, Sivan A, Rhee K, et al. Engineering tumor-colonizing E. coli Nissle 1917 for detection and treatment of colorectal neoplasia. Nat Commun. 2024;15(1). doi: 10.1038/s41467-024-44776-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
51.Redenti A, Im J, Redenti B, Li F, Rouanne M, Sheng Z, Sun W, Gurbatri CR, Huang S, Komaranchath M, et al. Probiotic neoantigen delivery vectors for precision cancer immunotherapy. Nature. 2024;635(8038):453–461. doi: 10.1038/s41586-024-08033-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
52.Taketani M, Zhang J, Zhang S, Triassi AJ, Huang Y-J, Griffith LG, Voigt CA. Genetic circuit design automation for the gut resident species bacteroides thetaiotaomicron. Nat Biotechnol. 2020;38(8):962–969. doi: 10.1038/s41587-020-0468-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
53.de Crombrugghe B, Busby S, Buc H. Cyclic AMP receptor protein: role in transcription activation. Science. 1984;224(4651):831–838. doi: 10.1126/science.6372090. [DOI] [PubMed] [Google Scholar]
54.Berg OG, von Hippel PH. Selection of DNA binding sites by regulatory proteins. II. The binding specificity of cyclic AMP receptor protein to recognition sites. J Mol Biol. 1988;200(4):709–723. doi: 10.1016/0022-2836(88)90482-2. [DOI] [PubMed] [Google Scholar]
55.Ge C, Yu Z, Sheng H, Shen X, Sun X, Zhang Y, Yan Y, Wang J, Yuan Q. Redesigning regulatory components of quorum-sensing system for diverse metabolic control. Nat Commun. 2022;13(1):2182. doi: 10.1038/s41467-022-29933-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
56.Marx RB, M A. Quantification of chemotaxis to naphthalene by Pseudomonas putida G7. Appl Environ Microbiol. 1999;65(7):2847–2852. doi: 10.1128/AEM.65.7.2847-2852.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
57.Zou Z-P, Zhang X-P, Zhang Q, Yin B-C, Zhou Y, Ye B-C. Genetically engineered bacteria as inflammatory bowel disease therapeutics. Eng Microbiol. 2024;4(4):100167. doi: 10.1016/j.engmic.2024.100167. [DOI] [PMC free article] [PubMed] [Google Scholar]
58.Ferrières L, Hémery GL, Nham T, Guérout A-M, Mazel D, Beloin C, Ghigo J-M. Silent mischief: bacteriophage mu insertions contaminate products of escherichia coli random mutagenesis performed using suicidal transposon delivery plasmids mobilized by broad-host-range RP4 conjugative machinery. J Bacteriol. 2010;192(24):6418–6427. doi: 10.1128/jb.00621-10. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Surrporting information.docx

KGMI_A_2530156_SM7014.docx^{(6.7MB, docx)}

Data Availability Statement

All data are available in manuscript and supplementary file.

[cit0001] 1.Braff D, Shis D, Collins JJ.. Synthetic biology platform technologies for antimicrobial applications. Adv Drug Delivery Rev. 2016;105(Pt A):35–19. doi: 10.1016/j.addr.2016.04.006. [DOI] [PubMed] [Google Scholar]

[cit0002] 2.Ruder WC, Lu T, Collins JJ. Synthetic biology moving into the clinic. Science. 2011;333(6047):1248–1252. doi: 10.1126/science.1206843. [DOI] [PubMed] [Google Scholar]

[cit0003] 3.Suez J, Zmora N, Segal E, Elinav E. The pros, cons, and many unknowns of probiotics. Nat Med. 2019;25(5):716–729. doi: 10.1038/s41591-019-0439-x. [DOI] [PubMed] [Google Scholar]

[cit0004] 4.Hwang IY, Chang MW. Engineering commensal bacteria to rewire host-microbiome interactions. Curr Opin In Biotechnol. 2020;62:116–122. doi: 10.1016/j.copbio.2019.09.007. [DOI] [PubMed] [Google Scholar]

[cit0005] 5.Goh YL, He H, March JC. Engineering commensal bacteria for prophylaxis against infection. Curr Opin In Biotechnol. 2012;23(6):924–930. doi: 10.1016/j.copbio.2012.03.004. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0006] 6.Duval M, Lewis CJ, Nomellini JF, Horwitz MS, Smit J, Cavacini LA. Enhanced neutralization of HIV by antibodies displayed on the S-layer of caulobacter crescentus. Antimicrob Agents Chemother. 2011;55(12):5547–5552. doi: 10.1128/AAC.00509-11. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0007] 7.Gupta S, Bram EE, Weiss R. Genetically programmable pathogen sense and destroy. ACS Synth Biol. 2013;2(12):715–723. doi: 10.1021/sb4000417. [DOI] [PubMed] [Google Scholar]

[cit0008] 8.Lu TK, Collins JJ. Engineered bacteriophage targeting gene networks as adjuvants for antibiotic therapy. Proc Natl Acad Sci USA. 2009;106(12):4629–4634. doi: 10.1073/pnas.0800442106. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0009] 9.Sagheddu V, Uggeri F, Belogi L, Remollino L, Brun P, Bernabe G, Moretti G, Porzionato A, Morelli L, Castagliuolo I, et al. The biotherapeutic potential of lactobacillus reuteri characterized using a target-specific selection process. Front Microbiol. 2020;11:532. doi: 10.3389/fmicb.2020.00532. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0010] 10.Mao N, Cubillos-Ruiz A, Cameron DE, Collins JJ. Probiotic strains detect and suppress cholera in mice. Sci Transl Med. 2018;10(445). doi: 10.1126/scitranslmed.aao2586. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0011] 11.Duan F, March JC. Engineered bacterial communication prevents vibrio cholerae virulence in an infant mouse model. Proc Natl Acad Sci USA. 2010;107(25):11260–11264. doi: 10.1073/pnas.1001294107. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0012] 12.Lynch JP, González-Prieto C, Reeves AZ, Bae S, Powale U, Godbole NP, Tremblay JM, Schmidt FI, Ploegh HL, Kansra V, et al. Engineered escherichia coli for the in situ secretion of therapeutic nanobodies in the gut. Cell Host & Microbe. 2023;31(4):634–649.e8. doi: 10.1016/j.chom.2023.03.007. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0013] 13.Koh E, Hwang IY, Lee HL, De Sotto R, Lee JWJ, Lee YS, March JC, Chang MW. Engineering probiotics to inhibit clostridioides difficile infection by dynamic regulation of intestinal metabolism. Nat Commun. 2022;13(1):3834. doi: 10.1038/s41467-022-31334-z. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0014] 14.Kobayashi H, Kaern M, Araki M, Chung K, Gardner TS, Cantor CR, Collins JJ. Programmable cells: interfacing natural and engineered gene networks. Proc Natl Acad Sci USA. 2004;101(22):8414–8419. doi: 10.1073/pnas.0402940101. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0015] 15.Khalil AS, Collins JJ. Synthetic biology: applications come of age. Nat Rev Genet. 2010;11(5):367–379. doi: 10.1038/nrg2775. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0016] 16.Nielsen AAK, Der BS, Shin J, Vaidyanathan P, Paralanov V, Strychalski EA, Ross D, Densmore D, Voigt CA. Genetic circuit design automation. Science. 2016;352(6281). doi: 10.1126/science.aac7341. [DOI] [PubMed] [Google Scholar]

[cit0017] 17.Jones TS, Oliveira SMD, Myers CJ, Voigt CA, Densmore D. Genetic circuit design automation with cello 2.0. Nat Protoc. 2022;17(4):1097–1113. doi: 10.1038/s41596-021-00675-2. [DOI] [PubMed] [Google Scholar]

[cit0018] 18.Hooshangi S, Thiberge S, Weiss R. Ultrasensitivity and noise propagation in a synthetic transcriptional cascade. Proc Natl Acad Sci USA. 2005;102(10):3581–3586. doi: 10.1073/pnas.0408507102. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0019] 19.Moon TS, Lou C, Tamsir A, Stanton BC, Voigt CA. Genetic programs constructed from layered logic gates in single cells. Nature. 2012;491(7423):249–253. doi: 10.1038/nature11516. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0020] 20.Stanton BC, Nielsen AA, Tamsir A, Clancy K, Peterson T, Voigt CA. Genomic mining of prokaryotic repressors for orthogonal logic gates. Nat Chem Biol. 2014;10(2):99–105. doi: 10.1038/nchembio.1411. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0021] 21.Triassi AJ, Fields BD, Monahan CE, Means JM, Park Y, Doosthosseini H, Padmakumar JP, Isabella VM, Voigt CA. Redesign of an escherichia coli Nissle treatment for phenylketonuria using insulated genomic landing pads and genetic circuits to reduce burden. Cell Syst. 2023;14(6):512–524.e12. doi: 10.1016/j.cels.2023.05.004. [DOI] [PubMed] [Google Scholar]

[cit0022] 22.Strateva T, Yordanov D. Pseudomonas aeruginosa - a phenomenon of bacterial resistance. J Med Microbiol. 2009;58(9):1133–1148. doi: 10.1099/jmm.0.009142-0. [DOI] [PubMed] [Google Scholar]

[cit0023] 23.Otto M. Physical stress and bacterial colonization. FEMS Microbiol Rev. 2014;38(6):1250–1270. doi: 10.1111/1574-6976.12088. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0024] 24.Holm A, Vikstrom E. Quorum sensing communication between bacteria and human cells: signals, targets, and functions. Front Plant Sci. 2014;5:309. doi: 10.3389/fpls.2014.00309. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0025] 25.Niehues J, McElroy C, Croon A, Pietschmann J, Frettloh M, Schroper F. Bacterial lighthouses-real-time detection of Yersinia enterocolitica by quorum sensing. Biosens (Basel). 2021;11(12):517. doi: 10.3390/bios11120517. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0026] 26.Mazzette R, Fois F, Consolati SG, Salza S, Tedde T, Soro P, Collu C, Ladu D, Virgilio S, Piras F. Detection of pathogenic yersinia enterocolitica in slaughtered Pigs by cultural methods and real-time polymerase chain reaction. Italian J Food Saf. 2015;4(2):4579. doi: 10.4081/ijfs.2015.4579. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0027] 27.Bottone EJ. Yersinia enterocolitica: revisitation of an enduring human pathogen. Clin Microbiol Newsl. 2015;37(1):1–8. doi: 10.1016/j.clinmicnews.2014.12.003. [DOI] [Google Scholar]

[cit0028] 28.Jack AA, Khan S, Powell LC, Pritchard MF, Beck K, Sadh H, Sutton L, Cavaliere A, Florance H, Rye PD, et al. Alginate oligosaccharide-induced modification of the lasI-lasR and rhlI-rhlR quorum-sensing systems in pseudomonas aeruginosa. Antimicrob Agents Ch. 2018;62(5). doi: 10.1128/aac.02318-17. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0029] 29.Ng Y-K, Grasso M, Wright V, Garcia V, Williams P, Atkinson S. The quorum sensing system of Yersinia enterocolitica 8081 regulates swimming motility, host cell attachment, and virulence plasmid maintenance. Genes. 2018;9(6):307. doi: 10.3390/genes9060307. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0030] 30.Su Y, Ding T. Targeting microbial quorum sensing: the next frontier to hinder bacterial driven gastrointestinal infections. Gut Microbes. 2023;15(2):2252780. doi: 10.1080/19490976.2023.2252780. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0031] 31.Hwang IY, Koh E, Wong A, March JC, Bentley WE, Lee YS, Chang MW. Engineered probiotic escherichia coli can eliminate and prevent pseudomonas aeruginosa gut infection in animal models. Nat Commun. 2017;8(1). doi: 10.1038/ncomms15028. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0032] 32.Geng H, Jiang R. cAMP receptor protein (CRP)-mediated resistance/tolerance in bacteria: mechanism and utilization in biotechnology. Appl Microbiol Biotechnol. 2015;99(11):4533–4543. doi: 10.1007/s00253-015-6587-0. [DOI] [PubMed] [Google Scholar]

[cit0033] 33.Zschuttig A, Zimmermann K, Blom J, Goesmann A, Pohlmann C, Gunzer F, Bereswill S. Identification and characterization of microcin S, a new antibacterial peptide produced by probiotic escherichia coli G3/10. PLoS One. 2012;7(3):e33351. doi: 10.1371/journal.pone.0033351. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0034] 34.Kim S-Y, Randall JR, Gu R, Nguyen QD, Davies BW. Antibacterial action, proteolytic immunity, and in vivo activity of a vibrio cholerae microcin. Cell Host & Microbe. 2024;32(11):1959–1971.e6. doi: 10.1016/j.chom.2024.08.012. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0035] 35.Zhang G, Lin M, Qin M, Xie Q, Liang M, Jiang J, Dai H, Xu S, Feng S, Liao M. Establishing heterologous production of Microcins J25 and Y in bacillus subtilis. J Agric Food Chem. 2023;71(14):5600–5613. doi: 10.1021/acs.jafc.3c00675. [DOI] [PubMed] [Google Scholar]

[cit0036] 36.Telhig S, Pham NP, Ben Said L, Rebuffat S, Ouellette M, Zirah S, Fliss I. Exploring the genetic basis of natural resistance to microcins. Microbiol Genomics. 2024;10(2). doi: 10.1099/mgen.0.001156. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0037] 37.Peng W, Orth K. A small microcin plays a big role in V. cholerae interbacterial competition. Cell Host & Microbe. 2024;32(11):1880–1881. doi: 10.1016/j.chom.2024.10.011. [DOI] [PubMed] [Google Scholar]

[cit0038] 38.Hwang IY, Tan MH, Koh E, Ho CL, Poh CL, Chang MW. Reprogramming microbes to Be pathogen-seeking killers. ACS Synth Biol. 2013;3(4):228–237. doi: 10.1021/sb400077j. [DOI] [PubMed] [Google Scholar]

[cit0039] 39.Duquesne S, Destoumieux-Garzon D, Peduzzi J, Rebuffat S. Microcins, gene-encoded antibacterial peptides from enterobacteria. Nat Prod Rep. 2007;24(4):708–734. doi: 10.1039/b516237h. [DOI] [PubMed] [Google Scholar]

[cit0040] 40.Saeidi N, Wong CK, Lo TM, Nguyen HX, Ling H, Leong SSJ, Poh CL, Chang MW. Engineering microbes to sense and eradicate pseudomonas aeruginosa, a human pathogen. Mol Syst Biol. 2011;7(1):521. doi: 10.1038/msb.2011.55. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0041] 41.Chak KF, Kuo WS, Lu FM, James R. Cloning and characterization of the ColE7 plasmid. J Gen Microbiol. 1991;137(1):91–100. doi: 10.1099/00221287-137-1-91. [DOI] [PubMed] [Google Scholar]

[cit0042] 42.Karmakar R. State of the art of bacterial chemotaxis. J Basic Microb. 2021;61(5):366–379. doi: 10.1002/jobm.202000661. [DOI] [PubMed] [Google Scholar]

[cit0043] 43.Blat Y, Eisenbach M. Mutants with defective phosphatase activity show no phosphorylation-dependent oligomerization of CheZ. The phosphatase of bacterial chemotaxis. J Biol Chem. 1996;271(2):1232–1236. doi: 10.1074/jbc.271.2.1232. [DOI] [PubMed] [Google Scholar]

[cit0044] 44.Shin J, Noireaux V. Study of messenger RNA inactivation and protein degradation in an escherichia coli cell-free expression system. J Biol Eng. 2010;4(1):1–9. doi: 10.1186/1754-1611-4-9. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0045] 45.Flynn JM, Neher SB, Kim YI, Sauer RT, Baker TA. Proteomic discovery of cellular substrates of the ClpXP protease reveals five classes of ClpX-recognition signals. Mol Cell. 2003;11(3):671–683. doi: 10.1016/s1097-2765(03)00060-1. [DOI] [PubMed] [Google Scholar]

[cit0046] 46.Ou B, Yang Y, Tham WL, Chen L, Guo J, Zhu G. Genetic engineering of probiotic escherichia coli nissle 1917 for clinical application. Appl Microbiol Biotechnol. 2016;100(20):8693–8699. doi: 10.1007/s00253-016-7829-5. [DOI] [PubMed] [Google Scholar]

[cit0047] 47.Dang Z, Gao M, Wang L, Wu J, Guo Y, Zhu Z, Huang H, Kang G. Synthetic bacterial therapies for intestinal diseases based on quorum-sensing circuits. Biotechnol Adv. 2023;65:65. doi: 10.1016/j.biotechadv.2023.108142. [DOI] [PubMed] [Google Scholar]

[cit0048] 48.Altenhoefer A, Oswald S, Sonnenborn U, Enders C, Schulze J, Hacker J, Oelschlaeger TA. The probiotic Escherichia coli strain Nissle 1917 interferes with invasion of human intestinal epithelial cells by different enteroinvasive bacterial pathogens. FEMS Immunol and Med Microbiol. 2004;40(3):223–229. doi: 10.1016/S0928-8244(03)00368-7. [DOI] [PubMed] [Google Scholar]

[cit0049] 49.Kurtz CB, Millet YA, Puurunen MK, Perreault M, Charbonneau MR, Isabella VM, Kotula JW, Antipov E, Dagon Y, Denney WS, et al. An engineered E. coli Nissle improves hyperammonemia and survival in mice and shows dose-dependent exposure in healthy humans. Sci Transl Med. 2019;11(475). doi: 10.1126/scitranslmed.aau7975. [DOI] [PubMed] [Google Scholar]

[cit0050] 50.Gurbatri CR, Radford GA, Vrbanac L, Im J, Thomas EM, Coker C, Taylor SR, Jang Y, Sivan A, Rhee K, et al. Engineering tumor-colonizing E. coli Nissle 1917 for detection and treatment of colorectal neoplasia. Nat Commun. 2024;15(1). doi: 10.1038/s41467-024-44776-4. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0051] 51.Redenti A, Im J, Redenti B, Li F, Rouanne M, Sheng Z, Sun W, Gurbatri CR, Huang S, Komaranchath M, et al. Probiotic neoantigen delivery vectors for precision cancer immunotherapy. Nature. 2024;635(8038):453–461. doi: 10.1038/s41586-024-08033-4. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0052] 52.Taketani M, Zhang J, Zhang S, Triassi AJ, Huang Y-J, Griffith LG, Voigt CA. Genetic circuit design automation for the gut resident species bacteroides thetaiotaomicron. Nat Biotechnol. 2020;38(8):962–969. doi: 10.1038/s41587-020-0468-5. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0053] 53.de Crombrugghe B, Busby S, Buc H. Cyclic AMP receptor protein: role in transcription activation. Science. 1984;224(4651):831–838. doi: 10.1126/science.6372090. [DOI] [PubMed] [Google Scholar]

[cit0054] 54.Berg OG, von Hippel PH. Selection of DNA binding sites by regulatory proteins. II. The binding specificity of cyclic AMP receptor protein to recognition sites. J Mol Biol. 1988;200(4):709–723. doi: 10.1016/0022-2836(88)90482-2. [DOI] [PubMed] [Google Scholar]

[cit0055] 55.Ge C, Yu Z, Sheng H, Shen X, Sun X, Zhang Y, Yan Y, Wang J, Yuan Q. Redesigning regulatory components of quorum-sensing system for diverse metabolic control. Nat Commun. 2022;13(1):2182. doi: 10.1038/s41467-022-29933-x. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0056] 56.Marx RB, M A. Quantification of chemotaxis to naphthalene by Pseudomonas putida G7. Appl Environ Microbiol. 1999;65(7):2847–2852. doi: 10.1128/AEM.65.7.2847-2852.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0057] 57.Zou Z-P, Zhang X-P, Zhang Q, Yin B-C, Zhou Y, Ye B-C. Genetically engineered bacteria as inflammatory bowel disease therapeutics. Eng Microbiol. 2024;4(4):100167. doi: 10.1016/j.engmic.2024.100167. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cit0058] 58.Ferrières L, Hémery GL, Nham T, Guérout A-M, Mazel D, Beloin C, Ghigo J-M. Silent mischief: bacteriophage mu insertions contaminate products of escherichia coli random mutagenesis performed using suicidal transposon delivery plasmids mobilized by broad-host-range RP4 conjugative machinery. J Bacteriol. 2010;192(24):6418–6427. doi: 10.1128/jb.00621-10. [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Minimal logic gates for probiotic Escherichia coli Nissle 1917 sensing and treatment of dual-bacteria intestinal infection

Haoran Li

Shanshan Zhang

Jinyan Yin

Gege Wang

Qi Wang

Yongzhen Xia

Lixiang Li

Qingsheng Qi

Qian Wang

ABSTRACT

Introduction

Results

Engineering of E. coli Nissle 1917 with P. aeruginosa and Y. enterocolitica sensing-killing circuits

Figure 1.

Design of the minimal and logic gate in EcN for 3OxoC12-AHL and C6-AHL response

Figure 2.

Directed chemotactic motility and killing effect of the engineered EcN toward P. aeruginosa and Y. enterocolitica

Figure 3.

Engineered EcN in a P. aeruginosa and Y. enterocolitica dual-infected murine model

Figure 4.

Figure 5.

Figure 6.

Discussion

Materials and methods

Strains culture and plasmids construction

Fluorescence assay

Orthogonal analysis of 3OxoC12-AHL and C6-AHL

In vitro bacteriostatic assay of engineered probiotic EcN

Knockout of cheZ and motA

Chemotactic and killing assay by P. aeruginosa and Y. enterocolitica induction

Animal model

Extraction of RNA from mouse feces

Reverse transcription and quantitative PCR

Detection of bacterial colonies in the intestinal tract

Statistics

Supplementary Material

Acknowledgments

Funding Statement

Disclosure statement

Author contributions

Data availability statement

Supplementary material

References

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases