RAD51 modulates in nasopharyngeal carcinoma cells by regulating Caspase-8-mediated pyroptosis

Abstract

Objective

Radiotherapy is a first-line treatment for nasopharyngeal carcinoma (NPC), but resistance to radiation remains a major clinical challenge. This study aimed to investigate the role of RAD51, a key homologous recombination repair protein, in radiotherapy resistance of NPC and to elucidate its underlying molecular mechanisms.

Methods

RAD51 expression levels were examined in tumor and adjacent normal tissues from 20 NPC patients and in the radioresistant NPC cell line CNE2. Functional assays were conducted using recombinant RAD51 protein, the RAD51 inhibitor B02, and the Caspase-8 inhibitor Z-IETD-FMK. Changes in cell viability, lactate dehydrogenase (LDH) release, and expression of pyroptosis-related proteins were analyzed to assess the effects of RAD51 modulation.

Results

RAD51 expression was significantly elevated in NPC tumor tissues and CNE2 cells compared to normal controls (P < 0.05). Recombinant RAD51 protein enhanced CNE2 cell viability and inhibited Caspase-8-mediated pyroptosis pathways (P < 0.05). Inhibition of RAD51 by B02 reduced its expression and cell viability (P < 0.05), while the addition of Z-IETD-FMK further suppressed pyroptosis and promoted survival in RAD51-overexpressing cells (P < 0.05).

Conclusion

This study is the first to demonstrate that RAD51 promotes radiotherapy resistance in NPC cells by suppressing Caspase-8-dependent pyroptosis. These findings suggest that targeting RAD51 may represent a novel strategy to overcome radioresistance and improve therapeutic outcomes in NPC.

Supplementary Information

The online version contains supplementary material available at 10.1007/s12672-025-03100-2.

Introduction

Nasopharyngeal carcinoma (NPC) is a malignant tumor originating from the nasopharyngeal epithelium, with high incidence in Southeast Asia, particularly in southern China [1–3]. Radiotherapy is the first-line treatment strategy for NPC, as it can effectively target and kill tumor cells by damaging their DNA, preventing them from dividing and proliferating [4, 5]. Despite its effectiveness, resistance to radiotherapy remains a significant challenge in NPC treatment, leading to tumor recurrence and metastasis [6], which ultimately contribute to poor prognosis [7]. Several mechanisms have been implicated in radiotherapy resistance, including enhanced DNA repair, evasion of apoptosis, activation of autophagy, and modulation of tumor microenvironment, all of which allow tumor cells to survive genotoxic stress [8–10]. These issues highlight the need for further investigation into the mechanisms of radiotherapy resistance, which could help improve therapeutic efficacy and extend patient survival.

The RAD51 gene, located on human chromosome 15, encodes a protein involved in homologous recombination repair, a critical process for repairing DNA double-strand breaks [11]. Upon DNA damage, RAD51 binds to single-stranded DNA and forms nucleoprotein filaments that facilitate homology searching and DNA strand exchange, thereby promoting DNA repair and restoring the integrity of the DNA double helix [12]. RAD51 plays an essential role in maintaining genome stability and cell survival, and its overexpression has been observed in various cancers, including pancreatic cancer, breast cancer, non-small cell lung cancer, and esophageal cancer, where it contributes to resistance to radiotherapy and chemotherapy [13–16]. Elevated levels of RAD51 are often associated with poor prognosis and shortened survival in cancer patients. In some cancers, high levels of RAD51 enhance DNA repair processes, thus improving the ability of tumor cells to resist DNA-damaging treatments such as radiotherapy [17, 18]. However, its specific role in NPC, particularly in modulating radioresistance, remains unclear.

Recent studies have begun to suggest a potential link between RAD51 and radiotherapy resistance in NPC [19], yet the downstream mechanisms remain largely unknown. In particular, the interaction between RAD51 and regulated forms of cell death—such as pyroptosis—has not been well explored in this context.

Therefore, we hypothesize that RAD51 promotes radioresistance in NPC cells by inhibiting Caspase-8-mediated pyroptosis. This study aimed to investigate the impact of RAD51 on cell viability and pyroptosis in NPC cells and assess its potential as a therapeutic target for overcoming radiotherapy resistance.

Materials and methods

Clinical tissue sample collection

The clinical component of this study involved an observational, tissue-based comparison of RAD51 expression between nasopharyngeal carcinoma (NPC) tumors and adjacent normal tissues. A total of 20 patients with histologically confirmed NPC were enrolled at The First Affiliated Hospital of Jinan University between February 2024 and June 2024 (Table S1). The sample size was determined based on the number of eligible patients during the study period and practical constraints related to tissue acquisition. All patients provided written informed consent prior to participation. Tumor and paired adjacent normal tissues were collected during diagnostic nasopharyngoscopic biopsy and stored at − 80 °C for further analysis. The sample size was determined based on the number of eligible patients during the study period and practical constraints related to tissue acquisition.

Inclusion criteria were: (1) age between 18 and 75 years; (2) newly diagnosed, untreated primary NPC; and (3) sufficient tissue sample obtained via nasopharyngoscopic biopsy. Exclusion criteria included: (1) prior radiotherapy, chemotherapy, or surgery; (2) concurrent autoimmune or chronic inflammatory diseases; and (3) history of other malignancies. During the biopsy procedure, both primary tumor tissues and adjacent histologically normal nasopharyngeal epithelial tissues were collected from the same patients. Based on pathological examination, samples were classified into two groups: the NPC tumor tissue group (NPC group) and the adjacent normal tissue group (Adjacent group). The use of adjacent normal tissues as internal controls was justified to minimize inter-individual variability, as these tissues were anatomically and genetically matched to the corresponding tumor samples, yet devoid of malignant features. All collected tissues were immediately snap-frozen in liquid nitrogen and subsequently stored at − 80 °C until further molecular analysis. The study was approved by the Ethics Committee of The First Affiliated Hospital of Jinan University (Approval No. KY-20240254) and conducted in accordance with the Declaration of Helsinki (as revised in 2013). Prior to enrollment, all patients were fully informed of the study objectives, procedures, risks, and benefits, and provided written informed consent. All patient data were anonymized to ensure confidentiality. Patients were screened consecutively according to the inclusion and exclusion criteria. No patients were excluded due to tissue insufficiency or protocol violations. All 20 patients who met the eligibility criteria were enrolled and included in the final analysis. No patients were excluded, and no missing data occurred.

Cell culture, reagents, treatment, and grouping

Human normal nasopharyngeal epithelial cell line NP69 and the radioresistant human NPC cell line CNE2 were utilized in this study. These cells were provided by the American Type Culture Collection (Manassas, VA, USA). The NP69 and CNE2 cells were cultured in Roswell Park Memorial Institute-1640 medium (Absin, China) containing 10% fetal bovine serum (Servicebio, China) and 1% penicillin-streptomycin solution (Servicebio, China) at 37 °C with 5% CO₂.

The buffer containing recombinant human RAD51 protein (rhRAD51) was purchased from Abcam (UK). Sterile phosphate-buffered saline (PBS) was added to prepare solutions of varying concentrations for cell treatment [20].

The solid RAD51 inhibitor B02 and Caspase-8-specific inhibitor Z-IETD-FMK were both obtained from MedChemExpress (USA). According to the manufacturer’s instructions, these compounds were dissolved in 0.5% dimethyl sulfoxide solution to create stock solutions, which were then diluted with sterile phosphate-buffered saline to prepare solutions of different concentrations for cell treatment [21].

As previous described, the prepared rhRAD51, B02, and Z-IETD-FMK solutions were added to the culture medium to treat CNE2 cells for 24 h [22, 23]. After treatment, cells were collected for subsequent experiments. Briefly, in this study, CNE2 cells were divided into the following groups:

(1) Control group: CNE2 cells received routine culture for 24 h without other treatment; (2) 50 ng/mL group: CNE2 cells were treated with 50 ng/mL rhRAD51 solution for 24 h; (3) 100 ng/mL group: CNE2 cells were subjected to 100 ng/mL rhRAD51 solution for 24 h; (4) 200 ng/mL group: CNE2 cells received 200 ng/mL rhRAD51 solution treatment for 24 h; (5) 5 µM group: CNE2 cells were treated with 5 µM B02 solution for 24 h; (6) 10 µM group: CNE2 cells were subjected to 10 µM B02 solution for 24 h; (7) 20 µM group: CNE2 cells received 20 µM B02 solution treatment for 24 h; (8) Z-IETD-FMK group: CNE2 cells were exposed to 40 µM Z-IETD-FMK solution for 24 h; (9) rhRAD51 group: CNE2 cells were treated with 200 ng/mL rhRAD51 solution for 24 h; (10) rhRAD51 + Z-IETD-FMK group: CNE2 cells were subjected to 200 ng/mL rhRAD51 solution and 40 µM Z-IETD-FMK solution for 24 h; (11) B02 group: CNE2 cells underwent 20 µM B02 solution for 24 h; (12) B02 + Z-IETD-FMK group: CNE2 cells were exposed to 20 µM B02 solution and 40 µM Z-IETD-FMK solution for 24 h.

Cell counting Kit-8 (CCK-8)

The treated CNE2 cells were seeded into 96-well plates at a density of 5 × 10³ cells/well. After 24 h of incubation, the cells were treated with drug solutions as described above. Next, 10 µL of CCK-8 solution (DOJINDO, Japan) was added to each well, followed by incubation for 2 h at 37 °C with 5% CO₂. Following incubation, the optical density of each well was measured at a wavelength of 450 nm using a multimode microplate reader (Thermo Fisher Scientific, USA) to assess cell viability. In addition, a blank control (culture medium without cells) was included to account for background interference.

Real-time quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted by uniformly mixing Trizol reagent (Sigma-Aldrich, USA) with clinical tissue samples or cell lines. Subsequently, the total RNA was reverse-transcribed into cDNA using the PrimeScript RT Reagent Kit (Takara Biotechnology, China), and RT-qPCR analysis was conducted using SYBR Premix Ex Taq (Takara Biotechnology, China) on a QuantStudio 6 Flex system (Applied Biosystems, USA) to assess the RAD51 expression levels. The PCR cycling conditions were as follows: initial denaturation at 95℃ for 30 s, followed by 40 cycles of denaturation at 95 °C for 30 s, annealing at 60℃ for 30 s, and extension at 72℃ for 30 s. GAPDH was used as an internal reference to normalize the RAD51 expression levels, and the results were quantified using the 2^−△△Ct method. The primers used for RT-qPCR are listed in Table 1.

Table 1.

RT-qPCR primer sequences

RNA	Sequences (5’ to 3’)
RAD51	5′-AGAGACCGAGCCCTAAGGAG-3′ (forward) 5′-TGCATTGCCATTAGCTCCAC-3′ (reverse)
GAPDH	5′- GTGGCTGGCTCAAAAAGG − 3′ (forward) 5′- GGGGAGATTCAGTGTGGTGG − 3′ (reverse)

RT-qPCR, real-time quantitative polymerase chain reaction; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Lactate dehydrogenase (LDH) assay

Firstly, 120 µL of the supernatant was collected from each group of CNE2 cell culture medium. Then, 60 µL of working solution from the LDH cytotoxicity assay kit (Beyotime Biotechnology, China) was added for thorough mixing, followed by 30 min of incubation in the dark at room temperature. The optical density at 490 nm was measured using a multimode microplate reader (Thermo Fisher Scientific, USA) to determine the LDH levels released by the cells.

Western blot

Total protein was extracted from treated CNE2 cells using radio-immunoprecipitation assay buffer containing protease and phosphatase inhibitors (Thermo Fisher Scientific, USA). The total protein concentration was measured using the bicinchoninic acid protein assay kit (Beyotime Biotechnology, China). Proteins were separated using 10–12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes (Servicebio, China). Then, the membranes were blocked with 5% skimmed milk at room temperature for 1 h. Subsequently, the membranes were incubated overnight at 4 °C with primary antibodies. The primary antibodies used were displayed as follows: Caspase-8 (1:1000, #4790, Cell Signaling Technology, USA), Cleaved-Caspase-8 (1:1000, #9496, Cell Signaling Technology, USA), Caspase-1 (1:1000, #2225, Cell Signaling Technology, USA), Cleaved-Caspase-1 (1:1000, #4199, Cell Signaling Technology, USA), Caspase-3 (1:1000, #9662, Cell Signaling Technology, USA), Cleaved-Caspase-3 (1:1000, #9661, Cell Signaling Technology, USA), gasdermin D (GSDMD, 1:1000, #39754, Cell Signaling Technology, USA), GSDMD-N (1:1000, #36425, Cell Signaling Technology, USA), interleukin-(IL) 18 (1:1000, #67775, Cell Signaling Technology, USA), IL-1β (1:1000, #12703, Cell Signaling Technology, USA), and GAPDH (1:1000, #2118, Cell Signaling Technology, USA). The following day, the membranes were washed three times with Tris buffered saline with Tween buffer. Afterward, the membranes were incubated with the Anti-rabbit IgG, Horseradish Peroxidase-linked Antibody (1:2000, #7074, Cell Signaling Technology, USA) at room temperature for 1 h. Ultimately, immunoreactive bands were detected using the Odyssey Infrared Imaging System (LiCor, USA), and ImageJ software (NIH, USA) was used for semi-quantitative analysis of each band. GAPDH was served as an internal reference to normalize the expression levels of target proteins.

Statistical analysis

Statistical analysis was performed using SPSS software (version 22.0). Normality of the data was assessed using the Shapiro-Wilk test, which confirmed that the data followed a normal distribution. Data are presented as means ± standard deviation (SD). The homogeneity of variances was evaluated using Levene’s test, and the assumption of equal variances was met. For comparisons between two groups, a two-tailed Student’s t-test was applied. For comparisons among multiple groups, one-way analysis of variance (ANOVA) was used, followed by Tukey’s post hoc test with Bonferroni correction for multiple testing. No missing data were observed in any of the experimental groups. All experiments were performed with at least three independent replicates. P < 0.05 was considered statistically significant.

Results

RAD51 expression is significantly up-regulated in nasopharyngeal carcinoma tissues and cells

Firstly, we examined the expression of RAD51 in NPC tissue samples and cell models. In clinical tissue samples, RT-qPCR results revealed a significant up-regulation of RAD51 mRNA in NPC tissues compared to adjacent non-cancerous tissues (P < 0.05; Fig. 1A), with markedly higher expression observed in the NPC group (95% CI: 3.070–3.402). In vitro, RAD51 mRNA expression in the CNE2 cell line was significantly higher than in the NP69 cell line (P < 0.05; Fig. 1B), with the CNE2 group exhibiting elevated levels (95% CI: 1.685–1.849). Consistently, Western blot analysis showed increased RAD51 protein expression in CNE2 cells (P < 0.05; Fig. 1C), with the highest protein levels observed in CNE2 (95% CI: 1.871–2.296). Overall, these findings suggested that up-regulation of RAD51 expression was a prominent feature of NPC.

Fig. 1.

RAD51 is significantly up-regulated in nasopharyngeal carcinoma tissues and cells (A) RT-qPCR was used to measure the RAD51 mRNA levels in clinical tissue samples from the NPC and adjacent tissue groups; (B–C) The RAD51 mRNA and protein levels in the NP69 and CNE2 cells were detected by RT-qPCR and Western Blot, respectively. **P < 0.01 vs. NPC group or NP69 group. RT-qPCR, real-time quantitative polymerase chain reaction.

rhRAD51 promotes nasopharyngeal carcinoma cell viability by inhibiting pyroptosis

Next, we explored the effects of RAD51 on NPC cells and its potential underlying mechanisms. RT-qPCR and Western blot results revealed that, compared to the Control group, RAD51 mRNA and protein expression levels were significantly elevated in the 50, 100, and 200 ng/mL rhRAD51-treated groups in a dose-dependent manner (P < 0.05) (Figs. 2A–B). Notably, RAD51 mRNA expression in the 200 ng/mL group was markedly increased (95% CI: 2.294–2.722), and protein levels were also significantly upregulated (95% CI: 1.856–2.064). These results confirmed that rhRAD51 effectively elevated RAD51 expression in CNE2 cells. In addition, the CCK-8 assay showed a significant and dose-dependent increase in cell viability following rhRAD51 treatment (P < 0.05) (Fig. 2C). OD values in the 200 ng/mL group were substantially higher (95% CI: 0.702–0.771) compared to the Control group, indicating enhanced cell viability upon RAD51 upregulation.

Fig. 2.

rhRAD51 enhances nasopharyngeal carcinoma cell viability by inhibiting pyroptosis (A–B) RT-qPCR and Western Blot were employed to assess the RAD51 mRNA and protein levels in CNE2 cells from the Control, 50 ng/mL, 100 ng/mL, and 200 ng/mL groups, respectively; (C) CCK-8 assay was adopted to measure CNE2 cell viability across different treatment groups; (D) The LDH levels in the supernatant of CNE2 cells in different treatment groups were detected; (E–) Western Blot was utilized to determine the protein levels of Casp8, cleaved-Casp8, Casp1, cleaved-Casp1, Casp3, cleaved-Casp3, GSDMD, GSDMD-N, IL-18, and IL-1β in CNE2 cells across different treatment groups. **P < 0.01 vs. Control group. RT-qPCR, real-time quantitative polymerase chain reaction; CCK-8, Cell Counting Kit-8; LDH, lactate dehydrogenase; Casp, Caspase; GSDMD, gasdermin D; IL, interleukin.

The LDH levels in the cell culture supernatant were detected, and the results demonstrated that in comparison with the Control group, the LDH levels were remarkably reduced in the supernatant of the 50 ng/mL, 100 ng/mL, and 200 ng/mL groups (P < 0.05) in a dose-dependent manner. The higher rhRAD51 concentrations led to lower LDH levels (Fig. 2D). Additionally, according to the Western Blot results, there was a remarkable down-regulation in the protein levels of cleaved-Caspase-8, cleaved-Caspase-1, cleaved-Caspase-3, GSDMD-N, IL-18, and IL-1β in the 50 ng/mL, 100 ng/mL, and 200 ng/mL groups compared to the Control group (P < 0.05), and these processes were dose-dependent. In contrast, the protein levels of Caspase-8, Caspase-1, Caspase-3, and GSDMD were elevated, and the differences were not statistically significant (P > 0.05) (Figs. 2E). To sum up, these results suggested that rhRAD51 could significantly enhance CNE2 cell viability by inhibiting pyroptosis. This effect was dose-dependent, indicating that a higher concentration of rhRAD51 resulted in a gradual decrease in pyroptosis marker protein levels, along with a progressive enhancement in cell viability. However, further validation would be required to confirm the induction of pyroptosis.

RAD51 inhibitor B02 suppresses nasopharyngeal carcinoma cell viability by promoting pyroptosis

The RAD51 inhibitor B02 was added to the cell culture medium to verify the mechanism of RAD51 from an inverse perspective to further confirm that RAD51 influences NPC cell viability by modulating the pyroptosis pathway.

To verify the mechanism of RAD51 from an inverse perspective, the RAD51 inhibitor B02 was added to the cell culture medium. RT-qPCR and Western blot results showed that, compared to the Control group, RAD51 mRNA and protein levels in CNE2 cells were significantly reduced following treatment with 5, 10, and 20 µM B02 (P < 0.05), in a dose-dependent manner (Figs. 3A–B). Notably, RAD51 mRNA levels in the 20 µM group were markedly reduced (95% CI: 0.037–0.258), and protein levels also showed a significant decrease (95% CI: 0.471–0.642). These findings demonstrated that B02 effectively suppressed RAD51 expression, supporting its role in modulating RAD51-dependent signaling. Next, we assessed the effect of B02 on cell viability and pyroptosis. CCK-8 assay results revealed that CNE2 cell viability was significantly lower in the 20 µM B02 group compared to Control (P < 0.05), with OD values showing a pronounced decline (95% CI: 0.146–0.204) (Fig. 3C). The LDH levels in the CNE2 cell culture supernatant were determined, revealing that as opposed to the Control group, the LDH levels were markedly raised in the 5 µM, 10 µM, and 20 µM groups (P < 0.05) in a dose-dependent manner. Higher B02 concentrations could result in higher LDH levels (Fig. 3D). Additionally, as exhibited by Western Blot results, a marked elevation was observed in the protein levels of cleaved-Caspase-8, cleaved-Caspase-1, cleaved-Caspase-3, GSDMD-N, IL-18, and IL-1β in the 5 µM, 10 µM, and 20 µM groups relative to the Control group (P < 0.05) in a dose-dependent manner. Besides, the levels of Caspase-8, Caspase-1, Caspase-3, and GSDMD were reduced (P > 0.05), but these differences were not statistically significant (Fig. 3E).

Fig. 3.

B02 suppresses nasopharyngeal carcinoma cell viability by promoting pyroptosis (A–B) RT-qPCR and Western Blot were employed to measure the RAD51 mRNA levels in CNE2 cells across the Control, 5 µM, 10 µM, and 20 µM groups, respectively; (C) CNE2 cell viability in different treatment groups was evaluated using the CCK-8 assay; (D) The LDH levels in the culture supernatant of CNE2 cells in different treatment groups were measured; (E) Western Blot was utilized to detect the protein levels of Casp8, cleaved-Casp8, Casp1, cleaved-Casp1, Casp3, cleaved-Casp3, GSDMD, GSDMD-N, IL-18, and IL-1β in CNE2 cells across different treatment groups; The target protein levels were quantitatively analyzed. *P < 0.05, **P < 0.01 vs. Control group. RT-qPCR, real-time quantitative polymerase chain reaction; CCK-8, Cell Counting Kit-8; Casp, Caspase; GSDMD, gasdermin D; IL, interleukin.

The aforementioned results indicated that the RAD51 inhibitor B02 promoted pyroptosis in NPC cells by reducing the intracellular RAD51 protein levels, thereby evidently suppressing NPC cell viability. Such a result elucidated the potential pathway by which RAD51 contributed to the development of resistance to radiotherapy in NPC cells from another perspective [24].

Caspase-8 inhibitor Z-IETD-FMK enhances the effect of rhRAD51 in suppressing pyroptosis in nasopharyngeal carcinoma cells

After adding the Caspase-8-specific inhibitor, changes in pyroptosis markers were examined to further confirm that RAD51 enhances NPC cell viability by regulating the Caspase-8-mediated pyroptosis pathway.

The LDH levels in the cell supernatants, we found that compared to the Control group, the LDH levels were significantly reduced in the Z-IETD-FMK and rhRAD51 groups (P < 0.05), while they were markedly elevated in the B02 group (P < 0.05). Additionally, the LDH levels were remarkably lower in the rhRAD51 + Z-IETD-FMK group than those in the rhRAD51 group (P < 0.05). Moreover, the B02 + Z-IETD-FMK group exhibited a notable decrease in the LDH levels relative to the B02 group (P < 0.05) (Fig. 4A). Furthermore, Western Blot results indicated that as opposed to the Control group, the Z-IETD-FMK and rhRAD51 groups presented a remarkable reduction in the protein levels of cleaved-Caspase-8, cleaved-Caspase-1, cleaved-Caspase-3, GSDMD-N, IL-18, and IL-1β (P < 0.05), whereas these protein levels were significantly raised in the B02 group (P < 0.05). In comparison with the rhRAD51 group, there was a notable decline in the protein levels of cleaved-Caspase-8, cleaved-Caspase-1, cleaved-Caspase-3, GSDMD-N, IL-18, and IL-1β in the rhRAD51 + Z-IETD-FMK group (P < 0.05). Similarly, compared to the B02 group, a significant reduction was observed in the levels of cleaved-Caspase-8, cleaved-Caspase-1, cleaved-Caspase-3, GSDMD-N, IL-18, and IL-1β proteins in the B02 + Z-IETD-FMK group (P < 0.05) (Fig. 4B).

Fig. 4.

Z-IETD-FMK enhances the effect of rhRAD51 in suppressing pyroptosis in nasopharyngeal carcinoma cells (A) The LDH levels in the supernatant of CNE2 cells were measured in the Control, Z-IETD-FMK, rhRAD51, rhRAD51 + Z-IETD-FMK, B02, and B02 + Z-IETD-FMK groups; (B) Western Blot was utilized to detect the protein levels of Casp-8, cleaved-Casp-8, Casp-1, cleaved-Casp-1, Casp-3, cleaved-Casp-3, GSDMD, GSDMD-N, IL-18, and IL-1β in CNE2 cells in different treatment groups. **P < 0.01 vs. Control group; ^##P < 0.01 vs. rhRAD51 group; ^&&P< 0.01 vs. B02 group. LDH, lactate dehydrogenase; Casp, Caspase; GSDMD, gasdermin D; IL, interleukin.

These results suggested that the Caspase-8 inhibitor Z-IETD-FMK partially offsets B02-induced pyroptosis and enhances the effect of rhRAD51 in suppressing NPC cell pyroptosis by inhibiting the Caspase-8-mediated pyroptosis pathway. This finding highlighted that Caspase-8-mediated pyroptosis is a critical mechanism by which RAD51 affects resistance to radiotherapy in NPC.

Discussion

In this study, the RAD51 expression levels were significantly up-regulated in clinical NPC tissue samples and cell models. In vitro experiments, treatment with rhRAD51 significantly increased the intracellular RAD51 protein levels in the radioresistant NPC cell line CNE2, thereby promoting cell proliferation and survival. Mechanistically, the effect of RAD51 protein on resistance to radiotherapy is likely to be achieved by negatively regulating the Caspase-8-associated pyroptosis pathway. Additionally, this study was the first to reveal the anti-pyroptotic role of RAD51 in NPC, providing a theoretical basis for targeting RAD51 to improve radiotherapy sensitivity in patients with NPC.

Currently, commonly used NPC cell lines include CNE1, CNE2, and HONE1, which differ significantly in differentiation status, Epstein-Barr virus infection status, invasiveness, and response to radiotherapy and chemotherapy. Therefore, selecting an appropriate cell line as an in vitro model is essential. As indicated by a previous study, the poorly differentiated squamous carcinoma cell line CNE2 exhibits higher resistance to radiotherapy; however, its underlying mechanism remains unclear [25]. Therefore, the CNE2 cells were used as an in vitro model in this study to further explore the mechanisms underlying the gradual development of resistance to radiotherapy in NPC.

Since oncogenes are typically overexpressed in tumor tissues while tumor suppressor genes are generally down-regulated, we first examined the RAD51 expression in NPC to infer its effect on the occurrence and development of NPC. This study displayed that the RAD51 mRNA and protein levels were notably elevated in both clinical NPC tissue samples and the in vitro cell model, suggesting that RAD51 might promote the occurrence and development of NPC. Previous studies have identified RAD51 overexpression as a common feature among NPC patients of various pathological types, with a significant negative correlation observed between its overexpression and overall survival [26, 27]. These findings were consistent with the results of this study. Furthermore, in the cell model, the addition of exogenous rhRAD51 increased the intracellular RAD51 protein levels, further enhancing NPC cell proliferation and survival. This result not only confirms the tumor promotion of RAD51 in NPC, but also indirectly suggests that elevated RAD51 protein levels might enhance NPC cell resistance to radiotherapy. Additionally, previous literature has reported that down-regulating RAD51 expression can increase NPC cell sensitivity to radiotherapy [28–30], consistent with the findings of this study.

Further investigation was conducted on the underlying mechanisms of RAD51 after identifying the potential role of RAD51 in enhancing resistance to radiotherapy in NPC cells. As previously mentioned, the anticancer effect of radiotherapy can be attributed to its ability to increase DNA damage in tumor cells to a critical level, thereby triggering apoptosis or pyroptosis to cause massive death of tumor cells [31]. Although apoptosis has long been recognized as the primary pathway for killing NPC cells by radiotherapy [32, 33], this single pathway is difficult to explain all cases of NPC cell resistance to radiotherapy and the poor efficacy of pro-apoptotic agents in combination with radiotherapy. This finding suggested that exploring the involvement of pyroptosis in the anti-NPC process of radiotherapy could help offer novel insights into overcoming resistance to radiotherapy and enhancing immune response. Based on this, this study focused on whether RAD51 could influence NPC cell proliferation and survival through the regulation of pyroptosis. The results showed that increased intracellular RAD51 protein levels resulted in a marked decline in the levels of cleaved-Caspase-8, cleaved-Caspase-1, cleaved-Caspase-3, GSDMD-N, IL-18, and IL-1β proteins, along with a remarkable decrease in LDH release. Currently, Caspase-8 has been reported to be a key molecule that initiates multiple pyroptosis pathways. Caspase-8, on one hand, can cleave and activate the downstream molecule Caspase-3 to form cleaved-Caspase-3. Further, cleaved-Caspase-3 can cleave GSDME to generate the GSDME-N fragment. This fragment disrupts cell membrane integrity, leading to leakage of intracellular contents and triggering inflammatory responses, which result in cells exhibiting morphological features similar to classical pyroptosis. Therefore, this pathway is referred to as the “Caspase-3-mediated non-classical pyroptosis pathway” [34]. On the other hand, Caspase-8 can serve as a compensatory molecule in the Caspase-1-mediated classical pyroptosis pathway. When the Caspase-1 levels are insufficient or its function is impaired, Caspase-8 can substitute for Caspase-1 to continue activating the downstream pyroptosis processes [35]. Additionally, IL-1β and IL-18 are inflammatory cytokines released during pyroptosis, and LDH is a representative substance excreted from the cells at the completion of pyroptosis [36, 37]. Changes in the levels of these markers help determine whether pyroptosis, rather than other forms of cell death, has occurred in NPC cells. Therefore, this study suggested that RAD51 enhanced NPC cell viability by negatively regulating multiple Caspase-8-mediated pyroptosis pathways, potentially increasing resistance to radiotherapy in NPC cells.

To make the conclusion of this study more reliable, the cell culture medium was supplemented with the RAD51 inhibitor B02 and the Caspase-8-specific inhibitor Z-IETD-FMK. The experimental results demonstrated that a reduction in RAD51 protein levels led to a significant increase in pyroptosis, while inhibiting Caspase-8 activity further strengthened the anti-pyroptotic effect of RAD51. These complementary findings, from both positive and negative perspectives, jointly confirm the role of RAD51 in inhibiting NPC cell pyroptosis, thereby strengthening the credibility of our conclusions and representing an important innovation in this study.

The clinical potential of RAD51 inhibition to enhance radiotherapy outcomes in NPC patients is promising, but several challenges must be addressed for effective clinical application. The specificity of RAD51 inhibitors like B02 needs thorough investigation to minimize off-target effects, and the potential toxicity and side effects of long-term inhibition must be carefully evaluated. Additionally, patient stratification based on tumor subtype and genetic factors is crucial, as not all patients may benefit equally from RAD51-targeted therapies. Personalized approaches will be essential for optimizing outcomes. Further preclinical validation in animal models, followed by clinical trials, is necessary to assess the therapeutic efficacy and identify biomarkers for patient selection. Combining RAD51 inhibitors with other therapies, such as immunotherapy or chemotherapy, may also help overcome resistance and improve long-term patient outcomes.

The clinical potential of RAD51 inhibition to enhance radiotherapy outcomes in NPC is promising, yet several challenges remain before clinical application. The specificity and long-term safety of RAD51 inhibitors like B02 require further evaluation to minimize off-target effects. Moreover, not all patients may benefit equally, highlighting the need for patient stratification based on tumor subtype and genetic background. Preclinical validation in animal models and subsequent clinical trials are essential to assess efficacy and identify predictive biomarkers. Combining RAD51 inhibitors with immunotherapy or chemotherapy may also help overcome resistance. To support clinical translation, future studies should investigate RAD51 expression as a stratification biomarker in early-phase (e.g., phase I/II) trials. Stratifying patients by RAD51 levels may help identify those most likely to benefit from targeted intervention. Given biological and geographic variation in NPC, our findings should be interpreted with caution. While non-keratinizing NPC predominates in Southeast Asia, keratinizing subtypes are more frequent in Western countries and may show different molecular behaviors. Broader validation across subtypes and regions is warranted. Finally, we acknowledge that the lack of confidence intervals limits the precision of our statistical results. Future studies should include more robust analyses and larger sample sizes to improve the reliability of findings.

In conclusion, this study is the first to identify RAD51 as a regulator of Caspase-8-mediated pyroptosis, revealing a novel mechanism by which it promotes radioresistance in NPC. RAD51 upregulation was consistently observed in both NPC cell models and tumor tissues from 20 patients, supporting its potential as a therapeutic target. These findings provide a foundation for developing RAD51-targeted strategies to enhance the efficacy of radiotherapy in NPC.

Author contributions

F.X.: Conceptualization; Data curation; Investigation; Methodology; Validation; Writing - original draft; Writing - review & editing. J.S.: Conceptualization; Formal analysis; Investigation; Resources; Visualization; Writing - original draft; Writing - review & editing. Y.T.: Data curation; Formal analysis; Methodology; Visualization; Writing - original draft; Writing - review & editing. X.Z.: Data curation; Formal analysis; Investigation; Methodology; Writing - review & editing. T.C.: Data curation; Formal analysis; Investigation; Methodology; Writing - review & editing. M.X.: Conceptualization; Formal analysis; Investigation; Supervision; Writing - review & editing.

Funding

This study was supported by Guangzhou Key Research and Development Plan of Science and Technology Grant (No.202206080012).

Data availability

The data used to support the findings of this study are available from the corresponding author upon request.

Declarations

Ethics approval and consent to participate

This study was reviewed and approved by the Ethics Committee of The First Affiliated Hospital, Jinan University (KY-20240254) and conducted in accordance with the Declaration of Helsinki (as revised in 2013). Informed consent was obtained from all patients prior to surgery.

Competing interests

The authors declare no competing interests.