Skip to main content
NCBI home page
The World Journal of Men's Health logoLink to The World Journal of Men's Health
. 2024 Aug 14;43(3):580–594. doi: 10.5534/wjmh.240065

Blocking TSP1 Ameliorates Diabetes Mellitus-Induced Erectile Dysfunction by Inhibiting the TGF-β/SMAD Pathway

Mancheng Xia 1,2,3,4,*, Yiming Yuan 1,2,3,4,*, Dong Fang 1,2,3,4, Xiaohui Tan 1,2,3,4, Fangzhou Zhao 1,2,3,4, Xinfei Li 1,2,3,4, Pengchao Gao 5, Zhuo Zhou 1,2,3,4, Tiegui Nan 5, Zhongcheng Xin 6,7, Xuesong Li 1,2,3,4,✉, Ruili Guan 1,2,3,4,✉
PMCID: PMC12257313  PMID: 39344111

Abstract

Purpose

To examine the role and mechanism of thrombospondin-1 (TSP1) in the development of fibrosis in diabetes mellitus-induced erectile dysfunction (DMED).

Materials and Methods

DMED was induced by intraperitoneal streptozotocin injection. All rats were categorized into three groups: control group (n=8), DMED group (n=8) and DMED+Leu-Ser-Lys-Leu (LSKL) group (n=8). After eight weeks following the induction of diabetes mellitus, the DMED+LSKL group was subjected to intraperitoneal injections of LSKL twice weekly for four weeks. To measure intracavernous pressure (ICP), a 25-gauge needle connected to a PE tube containing heparin was inserted into the corpus cavernosum (CC). Additionally, a needle was inserted into the carotid artery to measure mean arterial pressure (MAP). Sirius red staining and Masson trichrome staining were utilized to assess CC fibrosis. Moreover, high glucose (HG)-induced CC smooth muscle cells (CCSMCs) and CC fibroblasts (CCFs) were treated with or without LSKL. Western blotting and immunofluorescence were utilized to assess the phosphorylation and expression of related proteins.

Results

Compared with those in the control group, the ratio of the maximum ICP to the MAP markedly decreased in the DMED group, as did the ratio of smooth muscle to collagen and the ratio of collagen I to collagen III. These ratios were greater in the DMED+LSKL group than in the DMED group. TSP1 was highly expressed in the CC of DMED rats. In vitro experiments indicated that TSP1 expression significantly increased in the medium of CCSMCs and CCFs cultured in HG media and that the TGF-β pathway was activated in CCSMCs. Collagen IV was overexpressed in CCSMCs, indicating severe fibrosis was severe. Adding LSKL or knocking TSP1 down can prevent the activation of TGF-β signaling, as well as the overexpression of collagen IV in CCSMCs promoted by TSP1 secreted from CCSMCs itself or CCFs.

Conclusions

TSP1 expression is increased in the CC of DMED rats. HG-induced TSP1 secretion via autocrine signaling from CCSMCs and/or paracrine signaling from CCFs to accelerate penile fibrosis. LSKL, an antagonist of TSP1, could improve erectile dysfunction by inhibiting the TGF-β/SMAD pathway.

Keywords: Diabetes mellitus, Erectile dysfunction, Fibrosis, Transforming growth factor beta1

INTRODUCTION

The incidence of erectile dysfunction (ED) is greater in individuals with diabetes than in those without diabetes mellitus (DM) [1]. Furthermore, DM-induced ED (DMED) is more severe and has limited effectiveness when patients are treated with phosphodiesterase type 5 inhibitors [2,3] in comparison to non-diabetic individuals. The process of achieving and maintaining an erection involves the dilation of arteries, relaxation of smooth muscles, and constriction of veins in the penis [4,5]. Subsequently, the corpus cavernosum (CC) is filled with blood and can sustain erection [6]. Fibrosis in the CC could contribute to the development of diabetic ED [1,7,8,9,10].

Transforming growth factor-β1 (TGF-β1) exerts a substantial influence on the fibrosis of smooth muscle cells (SMCs) by modulating various pathways [11,12]. TGF-β1 is typically secreted in the form of an inactive precursor, which comprises a latency-associated peptide (LAP) and an active peptide [13,14,15]. Activation is necessary for mature TGF-β1 to bind to receptors on the cell membrane and carry out its functions [16].

Thrombospondin-1 (TSP1) has been suggested to be a natural activator of TGF-β1 [17,18,19]. The amino acid sequence Lys-Arg-Phe-Lys (KRFA) on TSP1 can bind to Leu-Ser-Lys-Leu (LSKL) on the terminus of LAP, which can promote active TGF-β1 release from the TGF-β1-LAP complex [20,21]. LSKL, an antagonist of TSP1, has been found to block the binding of TSP1 to LAP, thereby inhibiting fibrosis in fibrotic diseases affecting the heart, liver, brain, peritoneum, and kidney [13,22,23,24,25,26].

However, the function and mechanisms by which TSP1 causes the pathogenesis of cavernous fibrosis and DMED have not been elucidated and the function of CC fibroblasts (CCFs) in erection is not yet clear. Therefore, this study aimed to assess the protective effect of TSP-1 blockade on erectile function and CC fibrosis in DMED rats and the role of CCFs in erection.

MATERIALS AND METHODS

1. Construction of the DMED model

A total of twenty-four male Sprague-Dawley rats (aged 6–8 weeks) were supplied by the Laboratory Animal Center of Peking University First Hospital. The animal studies were performed after receiving approval from the Institutional Animal Care and Use Committee (IACUC) of Peking University (IACUC approval No. J2023076).

All rats’ baseline weights, as well as fasting blood glucose levels, were recorded in the first week. The DM rats were generated by injecting streptozotocin (60 mg/kg, S8050; Solarbio) dissolved in the vehicle. The criterion for a successful rat model was a fasting glucose concentration that exceeded 16.7 mmol/L 72 hours after injection.

The rats were categorized into multiple groups, each consisting of 8 rats. These groups included the control group, DMED group, and DMED+LSKL group (30 mg/kg LSKL, intraperitoneal injection). After eight weeks following the induction of DM, the DMED+LSKL group was subjected to intraperitoneal injections of LSKL twice weekly for four weeks, and the DMED group was treated with phosphate-buffered saline at the same frequency and volume. The remaining rats were kept under identical conditions for the same duration of four weeks. The dosage and duration of LSKL used in this study were determined based on previous publications [13,27].

2. Measurement of erectile function

Following a washout period of 3 days, rats were subjected to an evaluation of their erectile function through electrical stimulation [28]. Under general anesthesia, the major pelvic ganglion and cavernous nerves were exposed. To measure intracavernous pressure (ICP), a 25-gauge needle connected to a PE tube containing heparin was inserted into the CC. Additionally, a needle was inserted into the carotid artery to measure the mean arterial pressure (MAP). To initiate penile erection, a professional method involving the placement of an electronic stimulator equipped with a bipolar hook electrode underneath the cavernous nerves was used. The stimulation parameters consisted of frequency (20 Hz), pulse width (1 ms), voltage (10 V), and duration (60 seconds). During the electric field stimulation, a constant connection between the electrodes and the nerve was maintained. Throughout the electric field stimulation, the electrodes maintained continuous contact with the cavernous nerve. We recorded the ratio of the maximum ICP to the MAP of all animals. After completing the measurements, any excess fibrous connective tissue on the surface of the CC was removed, and the CC was divided into two distinct sections. One of these sections was designated for embedding in paraffin, while the remaining sections were promptly stored at a temperature of −80℃ to facilitate subsequent analysis.

3. Isolation and identification of primary CCSMCs and CCFs

CCSMCs and CCFs were primarily isolated from the CC of male Sprague-Dawley rats (aged 6–8 weeks). We then obtained CCFs and CCSMCs respectively through their ability to adhere to culture dishes. The CC was prepared by cutting it into approximately 1 mm3 pieces. The pieces were digested with collagenase II at 37℃ for 1 hour. The digestion neutralized by the addition of DMEM and thorough mixing. The mixture was filtered through a 200 mesh cell sieve. The filtrate was centrifuged at 150 g for 3 minutes, and then DMEM was used to resuspend and mix the precipitate. The suspension was transferred to a six-well plate and allowed to stand for 1 hour. The adherent cells in the suspension were mainly CCFs. The culture medium containing nonadherent cells was removed, and the cells were transferred to another six-well plate, which mainly contained CCSMCs. After 2–4 passages, the cells were used for subsequent experiments. The expression levels of α-smooth muscle actin (α-SMA) and decorin (DCN) were measured by immunofluorescence (IF) to identify CCSMCs and CCFs, respectively.

4. Treatment of primary CCSMCs and CCFs

Under standardized conditions (5% CO2, 37℃), The CCSMCs and CCFs were plated in DMEM (containing 10% FBS, 0.1 mg/mL streptomycin, and 100 U/mL penicillin). To determine the correlation between TSP1 and TGF-β/SMAD in CC fibrosis in DMED, we performed the following in vitro experiments. LSKL (MedChemExpress), an antagonist of TSP1 was used to block TSP1. The CCSMCs were divided into three groups: the control group, high glucose (HG) group (treated with 30 mM glucose), and HG+LSKL (containing 30 mM glucose and 2.5 µΜ LSKL) group. Mannitol was used to treat the control group and reduce the impact of osmotic pressure on the experimental results. After incubation for 24 hours, the CCSMCs, CCFs, and conditioned media were harvested for detection. In addition, the conditioned media from CCFs in different groups was used to cultivate CCSMCs for 24 hours, after which the CCSMCs were harvested for detection.

In another experiment, CCSMCs were stimulated with different concentrations of recombinant TSP1 (0, 2.5, 5, or 10 ng/mL) and/or LSKL (2.5 mΜ) for 1 day. To examine the impact of knocking down TSP1 on CCFs and CCSMCs, shCon or shTSP1 lentivirus particles were added to the culture media. Two short hairpin RNAs (shRNAs) were synthesized to create lentiviral vectors to suppress the expression of TSP1. The sequences of the shRNAs used were as follows: CAGAAGGACTCGATGGTGATGTCTCTTGAACATCACCATCAGAGTCCTTCTG and CAGTGGTACCTTCTTCATCAACTTCAAGAGAGTTGATGAAGAAGGTACCACTG. Experiments were performed 3 days after lentiviral infection.

5. Western blot analysis

Protein expressions in CCSMCs, CCFs, conditioned media derived from CCSMCs, and CCFs, as well as penile tissue samples, was evaluated using western blotting. The membranes were incubated overnight at 4℃ with primary antibodies against TSP1 (1:1,000, #37879; Cell Signaling Technology), TGF-β1 (1:1,000, #AB179695; Abcam), phospho-SMAD2/3 (Ser1177) (1:500, #8685; Cell Signaling Technology), collagen IV (1:1,000, #19674-1-AP; Proteintech), SMAD2/3 (1:2,000, #8828; Cell Signaling Technology), and β-actin (1:10,000, #66009-1-Ig; Proteintech). The membranes were incubated with HRP-conjugated secondary antibodies at room temperature for 60 minutes and then photographed using a Syngene G-Box. We used ImageJ software (National Institutes of Health) to quantify the band intensity. β-Actin and Ponceau S were used as internal loading controls.

6. Immunofluorescence

The relative proteins were detected through IF to determine their location and expression. The IF protocol was provided by the manufacturer. For IF, penile CC tissues, CCSMCs or CCFs were incubated with primary antibodies against collagen IV (1:500, #19674-1-AP; Proteintech), α-SMA (1:250, #ab124964; Abcam), DCN (1:250, #14667-1-AP; Proteintech) and fibronectin (1:500, #15613-1-AP; Proteintech). Images were collected by a digital camera (Olympus IX71).

7. Masson’s trichrome staining

The steps related to Masson’s trichrome staining were conducted according to the manufacturer’s instructions. The contents of collagen (represented by blue) and smooth muscle (represented by red) in the CC were quantified. The degree of CC fibrosis was indicated by the ratio of smooth muscle (represented by the color red) to collagen (represented by the color blue).

8. Sirius red staining

The ratio of collagen I (represented by the color yellow) to collagen III (represented by the color green) which reflects the extent of CC fibrosis was quantified using Sirius red staining [29]. The stained tissues were then imaged using a polarization microscope, and the stained area was quantified by ImageJ software.

9. Statistical analysis

The collected data were analyzed using GraphPad Prism version 9.0. To determine whether the data were normally distributed, the Kolmogorov-Smirnov test was used. Comparisons among normally distributed data were conducted using either a t-test or one-way ANOVA, followed by the Tukey test. Statistical significance was defined as a p-value less than 0.05.

RESULTS

1. Evaluation of erectile function and fibrosis

Compared with the control group, the DMED group exhibited a lower ratio of maximum ICP to MAP (Fig. 1A, 1B). There was no statistically significant difference in the MAP among these groups. This suggests that the DMED group experienced a severe impairment in erectile function. Compared with the DMED group, the DMED+LSKL group demonstrated a greater maximum ICP-to-MAP ratio (Fig. 1A, 1B). Before treatment, there were no significant differences observed among the groups in terms of fasting blood glucose levels or body weight. (Fig. 1C, 1D). In the diabetic groups, the average body weight was lower than that in the non-diabetic groups. However, in comparison to the non-diabetic group, the blood glucose level was significantly greater in the diabetic group. The ratio of smooth muscle to collagen in the DMED group was lower than that in the control group and this ratio was attenuated in the DMED+LSKL group (Fig. 1E, 1F), as shown by the collagen I to collagen III ratio (Fig. 1G, 1H).

Fig. 1. Evaluation of erectile function and fibrosis. (A) Typical graphs of hemodynamic changes after CN stimulation. (B) The ratio of maximum ICP to MAP; n=6–8. (C) Body weight (g) in different periods before sacrifice. (D) Fasting blood glucose (mmol/L) in different periods before sacrifice. Representative images of Masson trichrome staining (red and blue indicated the area of smooth muscle and collagen, respectively) (E) and semi-quantification (F) in CC of the three groups. Representative images of Sirius red staining (yellow and green indicated the area of collagen I and collagen III, respectively) (G) and semi-quantification (H) in CC of the three groups. ap<0.05, compared to control, bp<0.05, compared to DMED. ICP: intracavernous pressure, MAP: mean arterial pressure, DMED: diabetes mellitus-induced erectile dysfunction, LSKL: Leu-Ser-Lys-Leu, CN: cavernous nerve, CC: corpus cavernosum, STZ: streptozotocin.

Fig. 1

Open in a new tab

2. LSKL suppresses the TSP1/TGF-β/SMAD pathway and CC fibrosis in DMED rats

Fig. 2A–2C shows that the levels of TSP1, active TGF-β1, p-SMAD2/3, and collagen IV were greater in the DMED group than in the control group. Nevertheless, in the DMED+LSKL group, the levels of p-SMAD2/3 and collagen IV were reduced compared with those in the DMED group (Fig. 2D–2F). The p-SMAD2/3 to SMAD2/3 ratio also showed the same trend (Fig. 2E). We further used IF to measure the levels of collagen IV and fibronectin, which indicated that the level of fibrosis in the group treated with DMED was greater than that in the control group. However, this effect was inhibited after LSKL treatment (Fig. 2G–2J).

Fig. 2. LSKL suppresses TSP1/TGF-β/SMAD pathway and CC fibrosis in DM rats. (A) Representative immunoblot of TSP1, and active TGF-β1 in CC of the two groups. Semi-quantification of TSP1 (B) and active TGF-β1 (C) in CC of the two groups. (D) Representative immunoblot of p-SMAD2/3, SMAD2/3, and collagen IV in CC of the three groups after 4 weeks of treatment. Semi-quantification of the ratio of SMAD2/3 to their phosphorylated forms (E) and collagen IV (F) in CC of the three groups. Representative immunofluorescence (×200) (G) and semi-quantification (H) of collagen IV in CC of the three groups. Representative immunofluorescence (×200) (I) and semi-quantification (J) of fibronectin in CC of the three groups. ap<0.05, compared to control, bp<0.05, compared to DMED. DMED: diabetes mellitus-induced erectile dysfunction, TSP1: thrombospondin-1, TGF: transforming growth factor, LSKL: Leu-Ser-Lys-Leu, CC: corpus cavernosum, DM: diabetes mellitus.

Fig. 2

Open in a new tab

3. HG activates the TSP1/TGF-β/SMAD pathway and induces fibrosis in CCSMCs

The identification of CCSMCs extracted from CCs via α-SMA, an SMC marker, was performed using IF (Fig. 3A). TSP-1 expression, the p-SMAD2/3 to SMAD2/3 ratio, and the collagen IV level were significantly greater in CCSMCs under HG conditions than in control cells (Fig. 3E–3I). Furthermore, the levels of TSP1 and active TGF-β1 were considerably greater in the HG-conditioned medium of CCSMCs than in the medium without HG (Fig. 3B–3D).

Fig. 3. HG activates TSP1/TGF-β/SMAD pathway and induces fibrosis in CCSMCs. (A) Representative immunofluorescence of α-SMA in CCSMCs in intro. Representative immunoblot (B) and semi-quantification of TSP1 (C), and active TGF-β1 (D) in conditioned medium of CCSMCs. Representative immunoblot (E) and semi-quantification of TSP1 (F), The ratio of SMAD2/3 to their phosphorylated forms (G), SMAD2/3 (H), and collagen IV (I) in CCSMCs. ap<0.05, compared to control. α-SMA: α-smooth muscle actin, HG: high glucose, TGF: transforming growth factor, TSP1: thrombospondin-1, CC: corpus cavernosum, SMCs: smooth muscle cells.

Fig. 3

Open in a new tab

4. LSKL suppresses TSP1/TGF-β/SMAD pathway activity and fibrosis induced by TSP1 in CCSMCs

Our studies showed that the expression of collagen IV and the p-SMAD2/3 to SMAD2/3 ratio were increased in a dose-dependent manner in CCSMCs treated with TSP1 (0, 2.5, 5, or 10 ng/mL) (Fig. 4A–4D). Furthermore, the expression of collagen IV and the p-SMAD2/3 to SMAD2/3 ratio were decreased by LSKL, while the opposite effect was observed for TSP1 (Fig. 4E–4J).

Fig. 4. LSKL suppresses TSP1/TGF-β/SMAD pathway and fibrosis induced by TSP1 in CCSMCs. (A) Representative immunoblot of p-SMAD2/3, SMAD2/3, and collagen IV in CCSMCs of the four groups after TSP1 treatment. Semi-quantification of the ratio of SMAD2/3 to their phosphorylated forms (B), SMAD2/3 (C), and collagen IV (D) in CC of the four groups. (F) Representative immunoblot of p-SMAD2/3, SMAD2/3, and collagen IV in CCSMCs of the three groups after TSP1 and LSKL treatment. Semi-quantification of the ratio of SMAD2/3 to their phosphorylated forms (E), SMAD2/3 (G), and collagen IV (H) in CCSMCs of the three groups. Representative immunofluorescence (I) and semi-quantification (J) of collagen IV among the groups in CCSMCs. ap<0.05, compared to control; bp<0.05, compared to HG. TSP1: thrombospondin-1, LSKL: Leu-Ser-Lys-Leu, TGF: transforming growth factor, CC: corpus cavernosum, SMCs: smooth muscle cells.

Fig. 4

Open in a new tab

5. Blocking TSP1 attenuates TGF-β/SMAD pathway activity and fibrosis induced by HG in CCSMCs

Western blot and IF (Fig. 5A–5F) analyses revealed similar results after treatment with HG and LSKL. In the HG group, in contrast to those in the control group, there was a notable increase in the levels of TSP1 and collagen IV and in the p-SMAD2/3 to SMAD2/3 ratio (p<0.05). In contrast, the presence of LSKL resulted in only slight changes in the aforementioned molecules (p<0.05). Fig. 5G–5O shows that compared with those in the control group, the levels of TSP1, active TGF-β1, and collagen IV and the p-SMAD2/3 to SMAD2/3 ratio in the HG group were significantly greater. Conversely, the expression of TSP1, active TGF-β1, and collagen IV and the p-SMAD2/3 to SMAD2/3 ratio were decreased in the HG+sh2052 and HG+sh3024 groups (p<0.05).

Fig. 5. Blockade of TSP1 attenuates TGF-β/SMAD pathway and fibrosis induced by HG in CCSMCs. Representative immunoblot (A) and semi-quantification of TSP1 (B), the ratio of SMAD2/3 to their phosphorylated forms (C), and collagen IV (D) in CCSMCs. Representative immunofluorescence (×200) (E) and semi-quantification (F) of collagen IV among the groups in CCSMCs. Representative immunoblot (G) and semi-quantification of TSP1 (H), and active TGF-β1 (I) in conditioned medium of CCSMCs. Representative immunoblot (J) and semi-quantification of TSP1 (K), the ratio of SMAD2/3 to their phosphorylated forms (L), and collagen IV (O) in CCSMCs. Representative immunofluorescence (×200) (M) and semi-quantification (N) of collagen IV among the groups in CCSMCs. ap<0.05, compared to control; bp or cp<0.05, compared to HG. HG: high glucose, LSKL: Leu-Ser-Lys-Leu, TSP1: thrombospondin-1, TGF: transforming growth factor, CC: corpus cavernosum, SMCs: smooth muscle cells.

Fig. 5

Open in a new tab

6. Secretion of TSP1 induced by HG in CCFs, stimulates fibrosis in CCSMCs

CCFs extracted from CC via DCN, a fibroblast marker, were identified using IF (Fig. 6A). Under HG condition, CCFs showed a significant elevation in TSP1 in comparison to the control group (Fig. 6B, 6C). Furthermore, expression of TSP1 and active TGF-β1 in the HG medium conditioned by CCFs was greater than that in the medium without HG (Fig. 6D–6F). As depicted in Fig. 6G–6J, the levels of TSP1 and collagen IV, and the p-SMAD2/3 to SMAD2/3 ratio in CCSMCs cultured with HG conditioned medium of CCFs were significantly greater than those in control cells.

Fig. 6. Secretion of TSP1 induced by HG in CCFs stimulates fibrosis in CCSMCs. (A) Representative immunofluorescence of DCN in CCFs in intro. Representative immunoblot (B) and semi-quantification of TSP1 (C) in CCFs. Representative immunoblot (E) and semi-quantification of TSP1 (D), and active TGF-β1 (F) in conditioned medium of fibroblasts. Representative immunoblot (H) and the ratio of SMAD2/3 to their phosphorylated forms (I), SMAD2/3 (G), and collagen IV (J) in CCSMCs cultured by conditioned medium of CCFs. ap<0.05, compared to control. DCN: decorin, HG: high glucose, TSP1: thrombospondin-1, TGF: transforming growth factor, CCFs: CC fibroblasts, CC: corpus cavernosum, SMCs: smooth muscle cells.

Fig. 6

Open in a new tab

7. Blocking TSP1 in CCFs induced by HG attenuates fibrosis in CCSMCs

After knocking down TSP1 in CCFs, the levels of TSP1 and active TGF-β1 present in the medium conditioned by CCFs were considerably lower than those in the medium without TSP1 knockdown (Fig. 7A–7E). As depicted in Fig. 7F–7I, the p-SMAD2/3 to SMAD2/3 ratio, expression of collagen IV in CCSMCs cultured in HG medium conditioned by CCFs with TSP1 knockdown dropped compared with those without knocking TSP1 down (p<0.05).

Fig. 7. Blockade of TSP1 in CCFs induced by HG attenuates fibrosis in CCSMCs. Representative immunoblot (A) and semi-quantification of TSP1 (B) in CCFs. Representative immunoblot (C) and semi-quantification of TSP1 (D), and active TGF-β1 (E) in conditioned medium of CCFs. Representative immunoblot (F) and the ratio of SMAD2/3 to their phosphorylated forms (G), SMAD2/3 (H), and collagen IV (I) in CCSMCs cultured by conditioned medium of CCFs. Data are expressed as means±standard deviation. ap<0.05, compared to control; bp or cp<0.05, compared to HG. HG: high glucose, TSP1: thrombospondin-1, TGF: transforming growth factor, CC: corpus cavernosum, SMCs: smooth muscle cells, CCFs: CC fibroblasts.

Fig. 7

Open in a new tab

DISCUSSION

The development of DMED is influenced by fibrosis in CCSMCs [30]. Currently, the exact mechanisms that lead to fibrosis in CC are not fully understood, and effective interventions for CC fibrosis are lacking. Therefore, the investigations conducted in this study hold significant clinical importance. Our work revealed that TSP1 was upregulated in the CC of DMED rats and that blocking TSP1 improved the impairment of erectile function induced by DM. Fibrosis in the CC was alleviated after TSP1 blockade. In addition, TSP1 secreted by CCFs and CCSMCs can induce fibrosis in CCSMCs, and blocking TSP1 can attenuate fibrosis induced by HG in CCSMCs.

TGF-β1 plays an important role in the process of fibrosis, and its excessive activation may lead to the occurrence and development of pathological fibrosis [14]. TGF-β1 signaling pathway has become an important target for fibrosis treatment. Inhibiting the activity of TGF-β1 may help slow down or prevent the progression of fibrosis. HG-induced activation of TGF-β1 is likely influenced by multiple factors. TGF-β1 promotes fibrogenesis by affecting SMAD molecules and other pathways that are not dependent on SMAD [10,31,32]. Cells can secrete TGF-β1 in the form of TGF-β1-LAP complex. The TGF-β1-LAP complex can be activated and release active TGF-β1 by various stimuli [13,33].

TSP1 has been proposed as a natural stimulant for TGF-β1 activation. The specific amino acid sequence KRFA present on TSP1 has the ability to interact with LSKL located at the terminus of LAP, thereby facilitating the release of active TGF-β1 from the TGF-β1-LAP complex, which can lead to the occurrence and development of pathological fibrosis. TSP1 is related to the occurrence of fibrosis in the liver, heart, peritoneum, kidney, and salivary gland [13,22,33,34,35], however, the real role of TSP1 in CC fibrosis is unclear. Previously, LSKL, an inhibitor of TSP1, was used to explore the effect of TSP1 in fibrosis of organisms [36,37,38]. In our study, LSKL was applied to explore the impact of TSP1 on erectile function and cavernous fibrosis in DMED rats.

In our study, TSP1, activated TGF-β1, p-SMAD2/3, and collagen IV were upregulated in the CC of DMED rats. The expression of collagen IV and p-SMAD2/3 was downregulated in the presence of LSKL, thereby improving the erectile function of DMED rats. As indicated by the ratios of collagen I to collagen III and collagen to smooth muscle and the level of collagen IV, CC fibrosis was suppressed by LSKL. This discovery suggests that the TSP1/TGF-β pathway could contribute to the development of CC fibrosis and DMED. Although blocking TSP1 in our study was not limited to penile tissues, it did not result in any noticeable systemic effects, such as changes in blood glucose levels or arterial pressure. Additionally, blocking TSP1 caused some changes in the CC, indicating that the protective effects on erectile function and CC fibrosis in DMED rats were unlikely to be secondary to its systemic effects.

We further confirmed that HG can induce an increase in TSP1 secretion within CCSMCs, thereby activating the TGF-β/SMAD/collagen IV pathway, but this process can be inhibited by LSKL or TSP1 knockdown (Fig. 8). In addition, we found that exogenous TSP1 can activate the TGF-β/SMAD pathway and upregulate collagen IV in a dose-dependent manner, which can be inhibited by LSKL.

Fig. 8. Proposed mechanism of effects of TSP1 on DMED. STZ: streptozotocin, DMED: diabetes mellitus-induced erectile dysfunction, TGF-β1: transforming growth factor-β1, LSKL: Leu-Ser-Lys-Leu, TSP1: thrombospondin-1, CCFs: corpus cavernosum fibroblasts, CCSMCs: corpus cavernosum smooth muscle cells.

Fig. 8

Open in a new tab

Considering that CCFs and CCSMCs are closely related in penile tissue, we investigated the effect of CCFs on CCSMCs. We found that CCFs can also secrete TSP1 under HG conditions and promote the activation of the TGF-β/SMAD pathway and the production of collagen IV in CCSMCs (Fig. 8).

To our knowledge, for the first time, we isolated both CCSMCs and CCFs from the same CC, which greatly saved our cell source. Our research indicated that the upregulation of TSP1 is associated with DMED. Additionally, LSKL was found to improve DMED by reducing CC fibrosis. Under HG conditions, TSP1 secreted by CCFs and CCSMCs can induce fibrosis in CCSMCs (Fig. 8).

However, there are certain limitations to this study. We did not investigate how TSP1 was upregulated under diabetic conditions. Previous studies have suggested that HG can upregulate TSP1 through Sestrin2, YAP/TAZ, E2F-1, NOL7, and USF2 [18,39,40,41,42,43]. Whether these factors mediate TSP1 upregulation in the CC of diabetic rats needs further investigation. However, further investigations are needed to explore the role of related pathways in the alterations stimulated by TSP1 in the CC. Additional investigations are necessary to examine the involvement of pathways associated with the alterations induced by TSP1 in the CC.

CONCLUSIONS

The expression of TSP1 is upregulated in the CC of DMED rats. HG-induced TSP1 secretion in a manner of autocrine from CCSMCs and/or paracrine from CCFs to accelerate penile fibrosis. LSKL, an antagonist of TSP1, could improve ED by inhibiting the TGF-β/SMAD pathway.

ACKNOWLEDGEMENTS

The authors would like to thanks for the excellent graphing tool provided by the website “Figdraw” (https://www.figdraw.com/).

Footnotes

Conflict of Interest: The authors have nothing to disclose.

Funding: This work was supported by the Beijing Natural Science Foundation (Grant No. 7222189) and the National Natural Science Foundation of China (Grant No. 82001534).

Author Contribution:
  • Conceptualization: RG, XSL, ZX.
  • Data curation: MX, YY.
  • Formal analysis: DF, XT, FZ.
  • Funding acquisition: RG, DF.
  • Investigation: XFL, PG.
  • Methodology: RG, XSL.
  • Project administration: RG, DF.
  • Resources: RG, XSL, ZX.
  • Software: PG, ZZ, TN.
  • Supervision: RG, XSL.
  • Validation: RG, XSL.
  • Visualization: MX, YY.
  • Writing – original draft: MX, YY, DF.
  • Writing – review & editing: RG, XSL, ZX.

Data Sharing Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

References

  • 1.Li H, Xu W, Liu X, Wang T, Wang S, Liu J, et al. JAK2 deficiency improves erectile function in diabetic mice through attenuation of oxidative stress, apoptosis, and fibrosis. Andrology. 2021;9:1662–1671. doi: 10.1111/andr.13061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Xu W, Sun T, Wang J, Wang T, Wang S, Liu J, et al. GPX4 alleviates diabetes mellitus-induced erectile dysfunction by inhibiting ferroptosis. Antioxidants (Basel) 2022;11:1896. doi: 10.3390/antiox11101896. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Liu DF, Jiang H, Hong K, Zhao LM, Tang WH, Ma LL. Influence of erectile dysfunction course on its progress and efficacy of treatment with phosphodiesterase type 5 inhibitors. Chin Med J (Engl) 2010;123:3258–3261. [PubMed] [Google Scholar]
  • 4.Ji M, Chen D, Shu Y, Dong S, Zhang Z, Zheng H, et al. The role of mechano-regulated YAP/TAZ in erectile dysfunction. Nat Commun. 2023;14:3758. doi: 10.1038/s41467-023-39009-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Shamloul R, Ghanem H. Erectile dysfunction. Lancet. 2013;381:153–165. doi: 10.1016/S0140-6736(12)60520-0. [DOI] [PubMed] [Google Scholar]
  • 6.Yafi FA, Jenkins L, Albersen M, Corona G, Isidori AM, Goldfarb S, et al. Erectile dysfunction. Nat Rev Dis Primers. 2016;2:16003. doi: 10.1038/nrdp.2016.3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Sun T, Xu W, Wang J, Song J, Wang T, Wang S, et al. Paeonol ameliorates diabetic erectile dysfunction by inhibiting HMGB1/RAGE/NF-kB pathway. Andrology. 2023;11:344–357. doi: 10.1111/andr.13203. [DOI] [PubMed] [Google Scholar]
  • 8.Mao Y, Sun J, Wang Z, Liu Y, Sun J, Wei Z, et al. Combining transcriptomic analysis and network pharmacology to explore the mechanism by which Shaofu Zhuyu decoction improves diabetes mellitus erectile dysfunction. Phytomedicine. 2023;119:155006. doi: 10.1016/j.phymed.2023.155006. [DOI] [PubMed] [Google Scholar]
  • 9.Feng H, Liu Q, Deng Z, Li H, Zhang H, Song J, et al. Human umbilical cord mesenchymal stem cells ameliorate erectile dysfunction in rats with diabetes mellitus through the attenuation of ferroptosis. Stem Cell Res Ther. 2022;13:450. doi: 10.1186/s13287-022-03147-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Liu K, Cui K, Feng H, Li R, Lin H, Chen Y, et al. JTE-013 supplementation improves erectile dysfunction in rats with streptozotocin-induced type I diabetes through the inhibition of the rho-kinase pathway, fibrosis, and apoptosis. Andrology. 2020;8:497–508. doi: 10.1111/andr.12716. [DOI] [PubMed] [Google Scholar]
  • 11.Ganguly R, Wen AM, Myer AB, Czech T, Sahu S, Steinmetz NF, et al. Anti-atherogenic effect of trivalent chromium-loaded CPMV nanoparticles in human aortic smooth muscle cells under hyperglycemic conditions in vitro. Nanoscale. 2016;8:6542–6554. doi: 10.1039/c6nr00398b. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Wang S, Lincoln TM, Murphy-Ullrich JE. Glucose downregulation of PKG-I protein mediates increased thrombospondin1-dependent TGF-{beta} activity in vascular smooth muscle cells. Am J Physiol Cell Physiol. 2010;298:C1188–C1197. doi: 10.1152/ajpcell.00330.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Jiang N, Zhang Z, Shao X, Jing R, Wang C, Fang W, et al. Blockade of thrombospondin-1 ameliorates high glucose-induced peritoneal fibrosis through downregulation of TGF-β1/Smad3 signaling pathway. J Cell Physiol. 2020;235:364–379. doi: 10.1002/jcp.28976. [DOI] [PubMed] [Google Scholar]
  • 14.Campbell MG, Cormier A, Ito S, Seed RI, Bondesson AJ, Lou J, et al. Cryo-EM reveals integrin-mediated TGF-β activation without release from latent TGF-β. Cell. 2020;180:490–501.e16. doi: 10.1016/j.cell.2019.12.030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Moses HL, Roberts AB, Derynck R. The discovery and early days of TGF-β: a historical perspective. Cold Spring Harb Perspect Biol. 2016;8:a021865. doi: 10.1101/cshperspect.a021865. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Massagué J. TGFβ signalling in context. Nat Rev Mol Cell Biol. 2012;13:616–630. doi: 10.1038/nrm3434. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Yao L, Lu F, Koc S, Zheng Z, Wang B, Zhang S, et al. LRRK2 Gly2019Ser mutation promotes ER stress via interacting with THBS1/TGF-β1 in Parkinson's disease. Adv Sci (Weinh) 2023;10:e2303711. doi: 10.1002/advs.202303711. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Song S, Shi C, Bian Y, Yang Z, Mu L, Wu H, et al. Sestrin2 remedies podocyte injury via orchestrating TSP-1/TGF-β1/Smad3 axis in diabetic kidney disease. Cell Death Dis. 2022;13:663. doi: 10.1038/s41419-022-05120-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Gu J, Sun Y, Song J, Zhao R, Di X, Zhang Y, et al. Irradiation induces DJ-1 secretion from esophageal squamous cell carcinoma cells to accelerate metastasis of bystander cells via a TGF-β1 positive feedback loop. J Exp Clin Cancer Res. 2022;41:259. doi: 10.1186/s13046-022-02471-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Ruschkowski BA, Esmaeil Y, Daniel K, Gaudet C, Yeganeh B, Grynspan D, et al. Thrombospondin-1 plays a major pathogenic role in experimental and human bronchopulmonary dysplasia. Am J Respir Crit Care Med. 2022;205:685–699. doi: 10.1164/rccm.202104-1021OC. [DOI] [PubMed] [Google Scholar]
  • 21.Nickel S, Vlaic S, Christ M, Schubert K, Henschler R, Tautenhahn F, et al. Mesenchymal stromal cells mitigate liver damage after extended resection in the pig by modulating thrombospondin-1/TGF-β. NPJ Regen Med. 2021;6:84. doi: 10.1038/s41536-021-00194-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Zhang Z, Li H, Wang G, Zhao G, Li C, Cao Y. Thrombospondin-1 and prolyl 4-hydroxylase subunit alpha 3 as potential biomarkers of salivary gland fibrosis. J Dent Sci. 2023;18:1243–1250. doi: 10.1016/j.jds.2023.02.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Chang C, Zhao Q, Gonzalez JP, Kim JH, Alzahrani K, Del Re D, et al. Hematopoietic Id deletion triggers endomyocardial fibrotic and vascular defects in the adult heart. Sci Rep. 2017;7:3079. doi: 10.1038/s41598-017-03160-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Liao F, Li G, Yuan W, Chen Y, Zuo Y, Rashid K, et al. LSKL peptide alleviates subarachnoid fibrosis and hydrocephalus by inhibiting TSP1-mediated TGF-β1 signaling activity following subarachnoid hemorrhage in rats. Exp Ther Med. 2016;12:2537–2543. doi: 10.3892/etm.2016.3640. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Kuroki H, Hayashi H, Nakagawa S, Sakamoto K, Higashi T, Nitta H, et al. Effect of LSKL peptide on thrombospondin 1-mediated transforming growth factor β signal activation and liver regeneration after hepatectomy in an experimental model. Br J Surg. 2015;102:813–825. doi: 10.1002/bjs.9765. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Lu A, Miao M, Schoeb TR, Agarwal A, Murphy-Ullrich JE. Blockade of TSP1-dependent TGF-β activity reduces renal injury and proteinuria in a murine model of diabetic nephropathy. Am J Pathol. 2011;178:2573–2586. doi: 10.1016/j.ajpath.2011.02.039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Wang W, Chen Y, Yin Y, Wang X, Ye X, Jiang K, et al. A TMT-based shotgun proteomics uncovers overexpression of thrombospondin 1 as a contributor in pyrrolizidine alkaloid-induced hepatic sinusoidal obstruction syndrome. Arch Toxicol. 2022;96:2003–2019. doi: 10.1007/s00204-022-03281-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Gu SJ, Li M, Yuan YM, Xin ZC, Guan RL. A novel flavonoid derivative of icariside II improves erectile dysfunction in a rat model of cavernous nerve injury. Andrology. 2021;9:1893–1901. doi: 10.1111/andr.13065. [DOI] [PubMed] [Google Scholar]
  • 29.Zhou F, Xin H, Liu T, Li GY, Gao ZZ, Liu J, et al. Effects of icariside II on improving erectile function in rats with streptozotocin-induced diabetes. J Androl. 2012;33:832–844. doi: 10.2164/jandrol.111.015172. [DOI] [PubMed] [Google Scholar]
  • 30.Hu Z, Zhang Y, Chen J, Luo M, Wang N, Xiao Y, et al. Testosterone attenuates senile cavernous fibrosis by regulating TGFβR1 and galectin-1 signaling pathways through miR-22-3p. Mol Cell Biochem. 2023;478:1791–1802. doi: 10.1007/s11010-022-04641-8. [DOI] [PubMed] [Google Scholar]
  • 31.Nolan KA, Brennan EP, Scholz CC, Cullen C, Ryan A, Taylor CT, et al. Paricalcitol protects against TGF-β1-induced fibrotic responses in hypoxia and stabilises HIF-α in renal epithelia. Exp Cell Res. 2015;330:371–381. doi: 10.1016/j.yexcr.2014.07.034. [DOI] [PubMed] [Google Scholar]
  • 32.Abdalla M, Sabbineni H, Prakash R, Ergul A, Fagan SC, Somanath PR. The Akt inhibitor, triciribine, ameliorates chronic hypoxia-induced vascular pruning and TGFβ-induced pulmonary fibrosis. Br J Pharmacol. 2015;172:4173–4188. doi: 10.1111/bph.13203. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Murphy-Ullrich JE. Thrombospondin 1 and its diverse roles as a regulator of extracellular matrix in fibrotic disease. J Histochem Cytochem. 2019;67:683–699. doi: 10.1369/0022155419851103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Hosseini-Fard SR, Dehpour AR, Emamgholipour S, Golestani A. Naltrexone protects against BDL-induced cirrhosis in Wistar rats by attenuating thrombospondin-1 and enhancing antioxidant defense system via Nrf-2. Life Sci. 2022;300:120576. doi: 10.1016/j.lfs.2022.120576. [DOI] [PubMed] [Google Scholar]
  • 35.Chiasson V, Takano APC, Guleria RS, Gupta S. Deficiency of MicroRNA miR-1954 promotes cardiac remodeling and fibrosis. J Am Heart Assoc. 2019;8:e012880. doi: 10.1161/JAHA.119.012880. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Xu S, He L, Ding K, Zhang L, Xu X, Wang S, et al. Tanshinone IIA ameliorates streptozotocin-induced diabetic nephropathy, partly by attenuating PERK pathway-induced fibrosis. Drug Des Devel Ther. 2020;14:5773–5782. doi: 10.2147/DDDT.S257734. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Narmada BC, Chia SM, Tucker-Kellogg L, Yu H. HGF regulates the activation of TGF-β1 in rat hepatocytes and hepatic stellate cells. J Cell Physiol. 2013;228:393–401. doi: 10.1002/jcp.24143. [DOI] [PubMed] [Google Scholar]
  • 38.Xie XS, Li FY, Liu HC, Deng Y, Li Z, Fan JM. LSKL, a peptide antagonist of thrombospondin-1, attenuates renal interstitial fibrosis in rats with unilateral ureteral obstruction. Arch Pharm Res. 2010;33:275–284. doi: 10.1007/s12272-010-0213-6. [DOI] [PubMed] [Google Scholar]
  • 39.Arun A, Rayford KJ, Cooley A, Rachakonda G, Villalta F, Pratap S, et al. Thrombospondin-1 plays an essential role in yes-associated protein nuclear translocation during the early phase of Trypanosoma cruzi infection in heart endothelial cells. Int J Mol Sci. 2020;21:4912. doi: 10.3390/ijms21144912. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Mankame TP, Zhou G, Lingen MW. Identification and characterization of the human NOL7 gene promoter. Gene. 2010;456:36–44. doi: 10.1016/j.gene.2010.02.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Ji W, Zhang W, Xiao W. E2F-1 directly regulates thrombospondin 1 expression. PLoS One. 2010;5:e13442. doi: 10.1371/journal.pone.0013442. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Shi L, Liu S, Nikolic D, Wang S. High glucose levels upregulate upstream stimulatory factor 2 gene transcription in mesangial cells. J Cell Biochem. 2008;103:1952–1961. doi: 10.1002/jcb.21585. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Liu S, Shi L, Wang S. Overexpression of upstream stimulatory factor 2 accelerates diabetic kidney injury. Am J Physiol Renal Physiol. 2007;293:F1727–F1735. doi: 10.1152/ajprenal.00316.2007. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Articles from The World Journal of Men's Health are provided here courtesy of Korean Society for Sexual Medicine and Andrology

RESOURCES