Skip to main content
NCBI home page
Poultry Science logoLink to Poultry Science
. 2025 Jun 25;104(9):105476. doi: 10.1016/j.psj.2025.105476

Sodium butyrate attenuates lipid metabolism disorder via improving mitochondrial function and activating autophagy in LMH cells

Sasa Miao a, Mengru Xu b, Fang Liu b, Xinyang Dong b, Xiaoting Zou b, Tao Zeng a, Lizhi Lu a,⁎
PMCID: PMC12269579  PMID: 40592290

Abstract

Hepatic steatosis is the main characteristic in fatty liver hemorrhagic syndrome (FLHS), sodium butyrate (NaB) has been shown to modulate hepatic metabolism, alleviate oxidative stress and restore mitochondrial function. However, the effects of NaB on avian cellular models have yet to be thoroughly investigated. Leghorn male hepatocyte (LMH) cells, due to their immortal characteristics, provide a stable and reliable model for studying avian hepatocyte steatosis. Steatosis was induced by treating LMH cells with 400 μM oleic acid (OA), while 1 mM NaB was applied to evaluate its potential protective effects against OA-induced lipid accumulation. Cells were divided into four groups: the Control group, OA group, OA+NaB group, and NaB group. The results revealed that NaB reduced lipid accumulation, as evidenced by decreased cholesterol and triglyceride levels; Additionally, NaB upregulated the expression of genes associated with fatty acid catabolism, while downregulating those related to fatty acid synthesis. NaB alleviated OA-induced oxidative stress by increasing superoxide dismutase activity and reducing malondialdehyde and reactive oxygen species levels. NaB preserved mitochondrial integrity and maintained mitochondrial membrane potential, preventing OA-induced impairment. NaB attenuated apoptosis induced by OA treatment, as evidenced by a decrease in the Bax expression, the Bax/Bcl-2 expression ratio and a lower percentage of apoptotic cells. NaB also promoted autophagosome formation and modulated the LKB1-AMPK-mTOR signaling pathway, increasing the LC3Ⅱ/LC3Ⅰ protein ratio while reducing P62 protein expression. Consequently, NaB protected LMH cells from OA-induced lipid metabolism disorders by improving mitochondrial function and activating autophagy, suggesting its potential as a promising feed additive for preventing lipid metabolism disorders in poultry production.

Keywords: Sodium butyrate, Oleic acid, LMH cells, Mitochondria, Autophagy

Graphical abstract

Image, graphical abstract

Open in a new tab

Introduction

Avian hepatocytes exhibit a high capacity for de novo lipogenesis but have a limited ability to store excess lipids (Cui et al., 2022). The accumulation of excessive lipids in hepatic tissue leads to a range of pathological disorders in chickens, with fatty liver hemorrhagic syndrome (FLHS) being the most prominent, significantly affecting the economic efficiency of the poultry industry (Miao et al., 2024). Although FLHS shares similarities with non-alcoholic fatty liver disease (NAFLD) (Hamid et al., 2019; Wu et al., 2019), its exact pathogenesis remains unclear. The establishment of in vitro models is essential for uncovering the underlying mechanisms of FLHS. Leghorn male hepatoma (LMH) cells, owing to their high proliferative capacity and phenotypic stability, have been widely recognized as a well-established in vitro model for investigating avian hepatic steatosis (Song et al., 2023).

NAFLD is a multifaceted condition with pathophysiological mechanisms involving a spectrum of contributing factors, including insulin resistance, oxidative stress, and endoplasmic reticulum stress (Paternostro and Trauner, 2022). Recent emerging evidence suggests that the pathogenesis of NAFLD may be primarily driven by autophagy inhibition and mitochondrial dysfunction (Jang et al., 2023; Li et al., 2020). Extensive research has established that lipid catabolism within hepatocytes is highly dependent on mitochondrial metabolism (Barbier-Torres et al., 2020). Beyond their roles in β-oxidation and adenosine triphosphate synthesis, mitochondria serve as critical regulators of intracellular reactive oxygen species (ROS) production and calcium (Ca2+) signaling modulation (Guo, 2024). Perturbations in mitochondrial function and structure exacerbate lipid accumulation in hepatocytes, triggering liver inflammation and fibrogenesis (Fernández-Sáez et al., 2023). A substantial body of research has demonstrated that autophagy plays a pivotal role in mitigating insulin resistance, hepatic lipotoxicity, oxidative stress, endoplasmic reticulum stress, and inflammation (Wang et al., 2021; Wu et al., 2022). In addition to eliminating damaged organelles and intracellular pathogens, autophagy has the capacity to regulate lipid metabolism, resulting in a significant reduction in cytoplasmic lipid accumulation (Zhang et al., 2021). Autophagy activation exerts a lipid-lowering effect by modulating the expression of lipid metabolism-related proteins, whereas autophagy deficiency exacerbates lipid accumulation and is accompanied by impaired mitochondrial function (Jang et al., 2023). Therefore, improving mitochondrial homeostasis and enhancing autophagy offer a promising approach for managing FLHS.

Butyrate is widely acknowledged for its antioxidant and anti-inflammatory properties (Ma et al., 2023), with its metabolic benefit well-documented in various metabolic disorders (Chen et al., 2024; Jia et al., 2020). Sodium butyrate (NaB) has been reported to modulate hepatic lipid homeostasis by acting as a histone deacetylase inhibitor, thereby regulating the expression of genes involved in fatty acid synthesis, oxidation, and transport (He and Moreau, 2019). Emerging evidence further indicates that NaB can alleviate endoplasmic reticulum stress and restore autophagic flux mechanisms that are critical for lipid droplet degradation and the prevention of hepatocellular lipotoxicity (Kushwaha et al., 2022). Our recent study in a laying hen model of FLHS demonstrated that NaB effectively alleviates mitochondrial dysfunction and reactivates impaired autophagy (Miao et al., 2024). These mechanisms highlight the therapeutic potential of NaB in FLHS, a condition characterized by mitochondrial dysfunction, lipid accumulation, and impaired autophagy (Li et al., 2024). Nevertheless, the underlying mechanisms of NaB in LMH cells, particularly its role in autophagy regulation remains unclear. Specifically, its involvement in coordinating mitochondrial function, autophagy, and apoptosis under lipotoxic conditions has not been fully elucidated. Furthermore, sodium oleate (OA) has been commonly used to establish in vitro high-lipid cell models (Fang et al., 2024; Yan et al., 2015). Based on this evidence, we hypothesized that NaB could restore lipid homeostasis and attenuate lipotoxicity by improving mitochondrial function and activating autophagy in OA-induced LMH cells. Therefore, this study aimed to investigate the protective effects of NaB on lipid accumulation, mitochondrial dysfunction, oxidative stress, autophagy, and apoptosis in an OA-induced high-lipid LMH cell model, thereby providing new insights into its potential for preventing hepatic metabolic disorders in poultry.

Material and methods

Preparation of NaB and OA solutions and LMH cell culture treatments

The OA solution and its solvent were procured from Xi’an Kunchuang Technology Development Co., Ltd. NaB (Aladdin, Shanghai, China) was prepared by dissolving 22.017 mg of NaB in 10 mL of dimethyl sulfoxide (DMSO) to obtain a 20 mM NaB solution. These solutions were subsequently diluted to the required concentrations for experimental use.

The LMH cells, obtained from Shanghai Fuheng Biotechnology Co., Ltd, were cultured in specific complete LMH medium using standard cell culture dishes. The cells were divided into four experimental groups: Control, OA, NaB+OA, and NaB. The cells were maintained under controlled conditions of 37°C, 5 % CO₂, and 95 % humidity in a CO₂ incubator, with the medium renewal occurring every 48 hours. Upon reaching 80 %−90 % density, the cells were digested with 0.25 % trypsin without EDTA, followed by centrifugation at 1,000 rpm for 1 min. The resulting cell suspension was adjusted to a final concentration of 3 × 10⁵ cells/mL for subculture. Cell morphology was observed via optical microscope.

Assessment of cell viability

An appropriate number of LMH cells were seeded into 96-well plates, followed by the addition of 10 μL of CCK-8 reagent to each well. The plates were then incubated at 37°C in the dark, and the absorbance was measured at 450 nm.

Biochemical assessments

The activities or contents of total cholesterol (TC), TG, superoxide dismutase (SOD) and malondialdehyde (MDA) were measured according to the respective kit instruction manuals (Nanjing Jiancheng Bioengineering Institute, Nanjing, China).

Oil red O staining

After removing the culture medium, the cells were washed with PBS and fixed with 4 % paraformaldehyde at room temperature for 8-10 min, followed by two additional PBS washes. Subsequently, 60 % isopropanol was added to cover the cells for 15-20 seconds, after which it was removed and the cells were air-dried. The cells were incubated with Oil Red O working solution for 30 min in the dark. Following staining, the cells were differentiated in isopropanol for 3-5 seconds, followed by three washes with distilled water, each lasting 5 min. Finally, PBS was added to the wells for microscopic observation of lipid droplets.

Measurement of ROS levels by immunofluorescence (IF) and flow cytometry (FC)

Intracellular ROS levels were assessed using the ROS-sensitive probe DCFH-DA. Briefly, DCFH-DA was diluted 1:1000 in serum-free medium to a final concentration of 10 μM. Cells were incubated with 1 mL of the DCFH-DA solution per well at 37°C for 20 min. During incubation, the cell suspension was gently agitated at regular intervals to ensure uniform probe distribution. For IF analysis, ROS levels were visualized using a fluorescence microscope. For FC, approximately 5 × 10⁵ cells per sample were collected and analyzed using a flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA) immediately to evaluate ROS. DCF fluorescence, indicative of ROS levels, was detected in the FITC channel with excitation at 488 nm and emission at 530/30 nm. At least 10,000 events were collected per sample. Compensation was performed using single-stained controls to correct for spectral overlap. Gating was based on forward scatter (FSC) and side scatter (SSC) to exclude debris and dead cells.

Transmission electron microscopy (TEM)

LMH cell samples were initially fixed with 2.5 % glutaraldehyde solution, followed by post-fixation in 1 % osmium tetroxide (OsO4). Subsequent procedures, including dehydration, sectioning, and staining, were conducted following a previous study's protocol (Cao et al., 2020). Image were captured out using a transmission electron microscope (Hitachi, Japan).

IF staining detection of LC3B and P62

LMH cells were fixed, permeabilized, and blocked, and then incubated overnight with primary antibodies against LC3B (1:200 dilution) and P62 (1:500 dilution). After washing, secondary antibodies (1:500 dilution) were applied, and nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI). Images were acquired using a confocal microscope to assess autophagic flux and protein co-localization.

Mitochondrial membrane potential (MMP) analysis via IF and FC

MMP was evaluated using JC-1 staining. Briefly, cells were resuspended in serum-free medium and incubated with JC-1 working solution. For IF analysis, cells were fixed, and fluorescence was observed using a confocal microscope (Leica Microsystems, Wetzlar, Germany) to assess MMP changes. For FC, approximately 5 × 10⁵ cells per sample were collected and analyzed using a flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA) immediately to evaluate MMP changes. JC-1 monomers were detected in the FITC channel (excitation: 488 nm, emission: 530/30 nm), and JC-1 aggregates were detected in the PE channel (excitation: 561 nm, emission: 585/42 nm). At least 10,000 events were collected per sample. Compensation was conducted using single-stained controls to correct for spectral overlap. Gating was performed based on FSC and SSC to exclude debris and dead cells.

FC analysis of cell apoptosis

Cell apoptosis was evaluated using an Annexin V-FITC/Propidium Iodide (PI) dual staining assay. Briefly, after harvesting and washing, the cells were resuspended in binding buffer and stained with Annexin V-FITC and PI. The cells were incubated in the dark at 37 °C, then diluted with binding buffer and immediately analyzed by flow cytometry (BD Biosciences, Franklin Lakes, NJ, USA). A minimum of 10,000 events per sample was recorded. FITC fluorescence (Annexin V) was detected in the FL1 channel (excitation at 488 nm, emission at 530/30 nm), and PI fluorescence was detected in the FL2 or FL3 channel (excitation at 488 nm, emission at 585/42 nm). Early apoptotic cells were identified in Q3, while late apoptotic or necrotic cells were identified in Q2. Compensation was applied using single-stained controls, and data were analyzed with FlowJo software (version 10.8.1).

Quantitative real-time quantitative PCR (qRT-PCR)

Total RNA was extracted from LMH cells (n = 3) using Trizol reagent according to the manufacturer's guidelines. The cDNA was synthesized using the SuperScript Reverse Transcriptase Kit and the qRT-PCR was conducted with SYBR Green Master Mix. Relative gene expression levels were normalized to β-actin and calculated using the 2−ΔΔCt method (Livak and Schmittgen, 2001). Primer sequences are detailed in Table 1.

Table 1.

Primer used for real-time quantitative fluorescence PCR analysis.

Target Gene Primer Primer Sequence (5′−3′) Accession No.
β-Actin Forward TCCCTGGAGAAGAGCTATGAA NM_205518.1
Reverse CAGGACTCCATACCCAAGAAAG
SREBP-1c Forward GCCATCGAGTACATCCGCTT NM_204126.2
Reverse GGTCCTTGAGGGACTTGCTC
FASN Forward GAATCCAGAAGGGCCAACGA NM_205155.4
Reverse TCCAAGGGAGCAGCTTTTGT
ACC Forward TACAGAGGTACCGGAGTGGT NM_205505.1
Reverse TCTTCCCGAAGGGCAAAGAC
PPARα Forward AGGCCAAGTTGAAAGCAGAA NM_001001464.1
Reverse TTTCCCTGCAAGGATGACTC
Cpt1 Forward GGCTCTGGCAGGAGCTACA XM_040700878.2
Reverse CACTGCAGCTGGGATCTTGA
ACOX1 Forward ACTGAGCTGTGTCTCTTGTATG XM_015295164.2
Reverse GCTTCAGGTGTTTGTGGAAAG
Bax Forward GTGGTCAGTCCGAGCCTTTT XM001235092
Reverse TCCATTCAGGTTCTCTTGACC
Bcl-2 Forward ATCGTCGCCTTCTTCGAGTT NM205339
Reverse ATCCCATCCTCCGTTGTTCT
Open in a new tab

SREBP-1c, sterol regulatory element binding transcription factor 1c; FASN, fatty acid synthase; ACC, acetyl-CoA carboxylase alpha; PPARα, peroxisome proliferator activated receptor alpha; Cpt1, carnitine palmitoyltransferase 1; ACOX1, acyl-CoA oxidase 1; Bax, BCL2-associated X protein; Bcl-2, B-cell lymphoma-2.

Western blot analysis

Protein was extracted from LMH cells and quantified using the BCA assay. Then, the protein samples were resolved by SDS-PAGE (GenScript Corporation, Nanjing, China), transferred to the PVDF membrane, and incubated with primary antibodies overnight at 4°C. After washing, membrane was incubated with secondary antibodies at 25 °C. Chemiluminescence detection was performed using a ChemiScope 3400 imaging system (Clinx Science Instruments, China). The primary antibodies utilized in this study are detailed in Table 2.

Table 2.

Primary antibodies used for the western blotting experiment.

Antibody Source Cat. Number Isotype
LC3Ⅱ HuaAn Biotechnology (Hangzhou, China) ET1701-65 Rabbit
P62 HuaAn Biotechnology (Hangzhou, China) R1309-8 Rabbit
Bax Cell signaling technology (Boston, MA, USA) 2722T Rabbit
Bcl-2 Cell signaling technology (Boston, MA, USA) 15071T Mouse
p-LKB1 Cell signaling technology (Boston, MA, USA) 3054S Rabbit
LKB1 Cell signaling technology (Boston, MA, USA) 3047T Rabbit
p-AMPK Abcam (Cambridge, MA, USA) ERP5683 Rabbit
AMPK Abcam (Cambridge, MA, USA) Y365 Rabbit
p-mTOR Abcam (Cambridge, MA, USA) ERP426 Rabbit
mTOR Abcam (Cambridge, MA, USA) EPR390 Rabbit
β-actin Abcam (Cambridge, MA, USA) mAbcam 8226 Mouse
Open in a new tab

Statistical analysis

The data were analyzed using one-way ANOVA in SPSS 20.0 software, followed by post hoc multiple comparisons with Tukey's test. Graphs were generated using GraphPad Prism 8.0 software. Each experiment was repeated at least three times. Results are presented as mean ± SEM.

Results

The optimal dose of OA and NaB for treating LMH cells

To establish the high lipid model in vitro, LMH cells were exposed to varying concentrations of OA (0, 100, 200, 400, 600, 800 μM) for 24 hours. As shown in Fig. 1A, OA at concentrations of 400, 600, and 800 μM significantly decreased cell viability (P < 0.05). Therefore, 400 μM OA was selected for establishing the lipid metabolism disorder model. In addition, NaB were used to treat LMH cells for 24 hours to determine the optimal dose of NaB. Compared with the control group, 0.5 and 1 mM NaB increased cell viability (P < 0.05), while 4 and 8 mM NaB decreased cell viability (P < 0.05) (Fig. 1B) . Moreover, as shown in Fig. 1C, among NaB concentrations ranging from 0.25 to 2 mM, 1 mM was the most effective in alleviating the OA-induced reduction in cell viability caused by 400 μM OA (P < 0.05). Hence, a concentration of 400 μM OA and 1 mM NaB was selected for subsequent experiments, with the specific morphology of LMH cells presented in Fig. 1D.

Fig. 1.

Fig 1

Open in a new tab

The optimal dose of OA and NaB for treating LMH cells. (A) Varying concentrations of OA on LMH cell viability. (B) Varying concentrations of NaB on LMH cell viability. (C) Varying concentrations of NaB on the LMH cell viability treated by 400 μM OA. (D) The photomicrographs of LMH cells treated with 400 μM OA and 1 mM NaB (10 X). *indicates a significant difference compared to the Control group (P < 0.05); #indicates a significant difference compared to the OA group (P < 0.05). OA: oleic acid; NaB: sodium butyrate. Each experiment was repeated three times. Below is the same.

NaB ameliorated lipid deposition and metabolism in LMH cells exposed to OA

Oil Red O staining was performed to investigate the impact of OA and NaB on lipid accumulation in LMH cells. As shown in Figure 2A, OA exposure markedly increased the number of lipid droplets, whereas NaB supplementation significantly attenuated OA-induced lipid accumulation. Fig. 2B demonstrates a marked increase in TG and T-CHO levels in the OA group (P < 0.05), with NaB effectively inhibiting this OA-induced rise. Additionally, as descripted in Fig. 2C, OA exposure led to a notable upregulation of SREBP-1c and FASN mRNA levels, whereas NaB significantly reduced this enhancement (P < 0.05). Furthermore, OA treatment resulted in a substantial downregulation of PPARα, Cpt1, and ACOX1 mRNA expression, with NaB effectively reversing the OA-induced decrease in these expressions (P < 0.05).

Fig. 2.

Fig 2

Open in a new tab

Effect of NaB on lipid accumulation of LMH cells treated by OA. (A) Oil Red O staining (20 X). (B) TG and TC content. (C) The mRNA levels of lipid metabolism-related genes. OA: oleic acid; NaB: sodium butyrate. Different letters indicate statistically significant differences between groups (P < 0.05).

NaB mitigated oxidative stress in LMH cells treated With OA

To assess the impact of NaB on OA-induced oxidative stress, we detected the ROS level, SOD and MDA activities. As shown in Fig. 3A-B, ROS levels were markedly increased in the OA-treated group, whereas NaB addition markedly suppressed the ROS increase (P < 0.05). In the Fig. 3C, OA exposure resulted in a marked decrease in SOD activity and an increase in MDA levels (P < 0.05), both of which were effectively ameliorated by NaB supplementation (P < 0.05).

Fig. 3.

Fig 3

Open in a new tab

Effect of NaB on the levels of ROS in OA-treated LMH cells. (A) Fluorescence microscopy was utilized to detect intracellular ROS levels (10 X). (B) Flow cytometry was employed for ROS level detection and quantification. (C) The SOD and MDA activities in the LMH cells. OA: oleic acid; NaB: sodium butyrate. Different letters indicate statistically significant differences between groups (P < 0.05).

NaB alleviated mitochondrial dysfunction induced by OA in LMH cells

To evaluate the impact of NaB on mitochondrial function in OA-treated LMH cells, assessments were conducted on mitochondrial ultrastructure and MMP. The mitochondria displayed cristae disruption, mitochondrial swelling and vacuolization in the OA group, whereas NaB addition markedly improved mitochondrial structure (Fig. 4A). Furthermore, OA treatment reduced the fluorescence intensity of JC-1 polymers, while the NaB addition alleviated it (Fig. 4B). Consistent with the confocal microscopy results, FC analysis of JC-1 showed that OA group markedly increased the proportion of depolarized cells (P < 0.05), whereas NaB addition notably reduced the proportion of depolarized cells (Fig. 4C). Above results suggested that NaB can improve mitochondrial structure and function in LMH cells induced by OA.

Fig. 4.

Fig 4

Open in a new tab

Effect of NaB on mitochondrial function in OA-treated LMH cells. (A) Ultrastructural photos of mitochondria under transmission electron microscopy. (B) The changes in mitochondria labeled with JC-1 were observed using laser confocal microscopy. (C) Changes in MMP were analyzed using flow cytometry. OA: oleic acid; NaB: sodium butyrate. Different letters indicate statistically significant differences between groups (P < 0.05).

NaB triggered autophagy in OA-induced LMH cells

Autophagy-related proteins were analyzed using immunofluorescence staining and western blotting to evaluate the impact of NaB on autophagy in OA-treated cells. In Fig. 5A, OA group exhibited a notable decrease in LC3B immunofluorescence intensity and a increase in P62 immunofluorescence intensity, while NaB reversed these trend (P < 0.05). In the Fig. 5B, western blot analysis revealed that NaB treatment markedly upregulated LC3Ⅱ/LC3Ⅰ protein expression while downregulating P62 protein expression (P < 0.05). These findings are consistent with the immunofluorescence results, suggesting that NaB effectively promotes autophagy.

Fig. 5.

Fig 5

Open in a new tab

Effect of NaB on autophagy in OA-treated LMH cells. (A) Expression of LC3B and P62 observed under fluorescence microscopy (60X). (B) Autophagy-related proteins expression and quantification detected by Western blot analysis. OA: oleic acid; NaB: sodium butyrate. Different letters indicate statistically significant differences between groups (P < 0.05).

To further verify autophagy activation, autophagosome formation was evaluated by transmission electron microscopy (Figure 6). OA group exhibited a marked decline in autophagosome formation, whera NaB addition increased the autophagosome numbers in the cells. These results indicate that NaB effectively alleviates the autophagy suppression induced by OA treatment.

Fig. 6.

Fig 6

Open in a new tab

Autophagosomes images under TEM (red arrows). OA: oleic acid; NaB: sodium butyrate.

NaB inhibited apoptosis in LMH cells induced by OA

The apoptosis-related genes and proteins expression, as well as the apoptosis rate was analyzed using FC to explore the effect of NaB on apoptosis in OA-treated LMH cells. As illustrated in Fig.7A-B, OA significantly downregulated Bcl-2 gene and protein expression while upregulating Bax expression, resulting in an increased Bax/Bcl-2 ratio (P < 0.05). These alterations were effectively reversed by NaB treatment (P < 0.05). Furthermore, FC analysis (Fig. 7C) demonstrated that NaB reduced OA-induced apoptosis in LMH cells (P < 0.05), indicating that NaB suppresses OA-induced apoptosis in LMH cells.

Fig. 7.

Fig 7

Open in a new tab

Effect of NaB on apoptosis in OA-treated LMH cells. (A) apoptosis-related genes expression. (B) apoptosis-related proteins expression. (C) Detection apoptosis by flow cytometry. OA: oleic acid; NaB: sodium butyrate. Different letters indicate statistically significant differences between groups (P < 0.05).

NaB triggered autophagy via the LKB1-AMPK-mTOR signaling pathway

To further explore the underlying mechanisms of NaB in regulating autophagy in OA-treated LMH cells, the LKB1-AMPK-mTOR signaling pathway was examined (Fig. 8). The results showed that, OA treatment significantly downregulated the p-LKB1/LKB1 and p-AMPK/AMPK protein expression and upregulated p-mTOR/mTOR protein expression (P < 0.05). However, the addition of NaB effectively mitigated these OA-induced effects (P < 0.05). These findings suggest that NaB induces autophagy via the LKB1-AMPK-mTOR pathway.

Fig. 8.

Fig 8

Open in a new tab

Effects of NaB and OA on LKB1-AMPK-mTOR pathway in LMH cells. (A) Detection of LKB1-AMPK-mTOR pathway-associated proteins by Western blot. (B) Quantification of LKB1-AMPK-mTOR pathway-associated proteins. OA: oleic acid; NaB: sodium butyrate. Different letters indicate statistically significant differences between groups (P < 0.05).

Discussion

A substantial body of research has validated HepG2 hepatocellular carcinoma cells, LO2 hepatic cells, and human Zhang liver cells as models for investigating hepatic steatosis (Xie et al., 2016; Yan et al., 2015). However, significant physiological differences between avian and mammalian species, along with the challenges associated with isolating avian primary liver cells and their limited in vitro stability, have hindered the development of avian liver cell lines for widespread research use. Nevertheless, recent studies have identified that LMH cells possess rapid proliferative capacity and high stability, rendering them an appropriate choice for developing in vitro models to investigate avian hepatic steatosis (Song et al., 2023). Hence, LMH cells were selected for subsequent in vitro investigations in this study. OA, a monounsaturated fatty acid, has been widely employed to induce steatosis in various hepatic cell models (Fang et al., 2024). Recent findings suggest that OA concentrations ranging from 0 to 750 μM are optimal for inducing a high-lipid model in LMH cells (Song et al., 2023). In alignment with this, in this study, LMH cells were exposed to 400 μM OA for 24 hours, leading to a marked increase in lipid droplet accumulation, as demonstrated by Oil Red O staining, along with elevated intracellular TG and TC levels. This confirms the successful establishment of a steatosis model in LMH cells. Furthermore, recent research has reported that NaB can alleviate hepatic steatosis induced by free fatty acid in chicken liver cells via decreasing intracellular TG and TC levels (Ding et al., 2024). In line with these findings, our study showed that 1 mM NaB effectively reduced TG and TC levels in OA-treated LMH cells, thereby alleviating lipid accumulation.

Lipid metabolism in hepatocytes is predominantly modulated by the equilibrium between free fatty acid synthesis and oxidation (Zang et al., 2018). In our trial, OA treatment significantly upregulated the mRNA expression of SREBP-1c and FASN, while markedly downregulating the gene expression of ACOX1,Cpt1 and PPARα. The results are in agreement with earlier research using OA-treated HepG2 and LO2 cells, in which genes and proteins associated with lipogenesis were upregulated, whereas those involved in fatty acid oxidation were downregulated. This shift contributes to lipid droplet accumulation and increases in intracellular TG and T-CHO levels via the regulation of β-oxidation and lipogenesis (Yu et al., 2018). NaB is acknowledged for its anti-inflammatory, insulin-sensitizing, and lipid-lowering properties (Adeyanju et al., 2021). Our previous research indicated that coated sodium butyrate supplementation improved lipid metabolism in late-laying hens by downregulating FASN and ACC, and upregulating PPARα and Cpt1 expression (Miao et al., 2023). Moreover, NaB was found to alleviate lipid buildup triggered by free fatty acid in the chicken primary hepatocyte model by downregulating SREBP-1c and FASN expression and upregulating PPARα,AOCX1 and Cpt1 mRNA levels (Ding et al., 2024). In short, NaB mitigates OA-induced hepatic lipid deposition in LMH cells by inhibiting lipogenesis and promoting lipid oxidation.

Excessive lipid accumulation can trigger lipid peroxidation, leading to the overproduction of ROS and a concomitant decline in antioxidant defense mechanisms in hepatocytes (Li et al., 2019). Diets enriched with fatty acids have been demonstrated to elevate TC levels in serum and tissues, which is linked to elevated lipid peroxidation (Astrup et al., 2011). Moreover, excessive intake of OA has been associated with elevated harmful lipid levels and an increased risk of oxidative stress-related diseases (Yu et al., 2018). LO2 or HepG2 cells treated with OA have been shown to elevate MDA and ROS levels, culminating in cell apoptosis and lipid peroxidation (Xie et al., 2016). In our study, OA-induced oxidative stress in LMH cells, evidenced by decreased SOD activity and increased MDA and ROS levels. Notably, these effects were significantly mitigated by NaB, which improved cell membrane integrity and alleviated oxidative damage. This aligns with previous findings showing that NaB mitigates oxidative damage by enhancing antioxidant enzyme activity and improving mitochondrial function in various models, including LPS-treated MAC-T cells, insulin-resistant obese mice, and laying ducks (Li et al., 2019; Mollica et al., 2017; Zeng et al., 2023).

During the progression of NAFLD, excessive ROS accumulation could impair mitochondrial function and induce apoptosis (Tsai et al., 2016). Alterations in MMP are recognized as effective biomarkers for assessing mitochondrial structural damage and functional impairment (Xing et al., 2017). In our research, the MMP was significantly reduced in the OA group. Additionally, TEM analysis revealed mitochondrial swelling and breakage of cristae, indicating that OA induces mitochondrial structural damage and dysfunction in LMH cells. However, NaB addition mitigated these detrimental effects, suggesting that NaB alleviates OA-induced mitochondrial dysfunction by the preservation of MMP. Lipotoxicity-induced hepatocyte apoptosis is a pivotal marker of NAFLD (Kuramoto et al., 2021). It has been established that the loss of MMP is a critical event in the initiation of apoptosis (Nieminen, 2023). A decrease in the MMP can cause biochemical changes, such as cytochrome c release, caspase activation, and a cascade of events leading to cell death (Xu et al., 2022). Among the regulators of apoptosis, Bcl-2 and Bax are prototypical anti-apoptotic and pro-apoptotic proteins, respectively (Pawlowski and Kcraft, 2000). In our study, OA exposure significantly increased the apoptotic rate in LMH cells, as evidenced by upregulated Bax expression and downregulated Bcl-2 expression. These results suggest that OA addition induces apoptosis in LMH cells, while NaB can counteract these effects, potentially by increasing MMP.

Autophagy is a crucial cellular process that preserves homeostasis by eliminating dysfunctional or surplus organelles, proteins, and other biomolecules (Dashti et al., 2024). It plays a protective role under external stress conditions by mitigating mitochondrial dysfunction and attenuating apoptosis (Xu et al., 2023). However, the specific pathways by which NaB enhances mitochondrial function, and reduces OA-induced apoptosis remain unclear and warrant further investigation. Autophagy has been widely implicated in regulating mitochondrial function, lipid metabolism, and oxidative stress. Notably, inhibition of autophagy can induce endoplasmic reticulum stress, lipid dyshomeostasis, and the onset of pancreatitis in mice (Biczo et al., 2018). Furthermore, numerous studies have demonstrated that autophagy deficiency is associated with liver disorders, including hepatic injury, NAFLD, and hepatocellular carcinoma (Ke, 2020). Conversely, autophagy activation has been demonstrated to reduce lipid buildup and improve cell health (Singh et al., 2009). ROS often leads to mitochondrial depolarization and subsequent damage. To maintain mitochondrial integrity and cellular homeostasis, cells selectively degrade damaged mitochondria via mitophagy, a specialized form of autophagy (Springer and Macleod, 2016). In mouse hepatocytes, treatment with fatty acid has been shown to suppress autophagy by upregulating P62 expression and downregulating Beclin-1 and LC3II/I expression, thereby impairing autophagosome-lysosome fusion and disrupting autophagic flux (Liang et al., 2021). In current study, LMH cells treated by OA inhibited autophagy through two distinct mechanisms: a reduction in LC3II/I expression accompanied by elevated P62 protein levels, and a significant decrease in autophagosome formation as confirmed by TEM analysis. Despite limited research on NaB-mediated regulation of autophagy in avian hepatocytes, previous studies have documented similar effects in other species. For instance, butyrate enhanced LC3II/LC3I expression and promoted autophagy in human colon cancer cells (Tang et al., 2011). Moreover, butyrate was shown to facilitate mitophagy by promoting the conversion of LC3I to LC3II in a piglet model (Wang et al., 2019). In current study, NaB could upregulate LC3II/LC3I expression, downregulate P62 protein levels, and increase autophagosome numbers, suggesting an overall enhancement of autophagy. Thus, NaB may mitigate hepatocyte apoptosis and dysregulated lipid metabolism by improving mitochondrial function through autophagy activation.

The exact mechanism through which NaB regulates autophagy is yet to be fully understood. AMP-activated protein kinase (AMPK) is a key regulator of metabolism and a t arget for treating obesity-related disorders like NAFLD (Day et al., 2017). The AMPK-mTOR pathway is widely recognized as a central mediator in the control of cellular autophagy and apoptosis (Gallagher et al., 2016), with the downstream effector ULK1 plays a pivotal role in autophagy initiation (Hung et al., 2021). Specially, the LKB1-AMPK-mTOR pathway acts as a key metabolic checkpoint that links cellular energy status to autophagic activity (Jung et al., 2020). Under conditions of energy stress or nutrient deprivation, LKB1 phosphorylates and activates AMPK, which subsequently inhibits mTOR (Zhao et al., 2020). In hepatocytes, lipid overload-such as palmitic acid exposure -has been shown to suppress the phosphorylation of both LKB1 and AMPK, thereby impairing autophagic signaling (Gai et al., 2020). In contrast, NaB has been reported to restore this signaling by enhancing LKB1 phosphorylation and promoting AMPKα activation (Luo et al., 2019). Additionally, NaB was reported to promote autophagy by activing the AMPK/mTOR signaling pathway (Wang et al., 2022). Consistent with these findings, our results revealed that NaB upregulated the protein expression P-LKB1/LKB1 and P-AMPK/AMPK, while downregulating P-mTOR/mTOR in OA-treated LMH cells, suggesting that the LKB1-AMPK-mTOR signaling pathway may be involve in NaB-induced autophagy and lipid metabolism regulation. However, further studies using gene knockout or inhibitor-based approaches are needed to confirm the mechanistic role of the LKB1-AMPK-mTOR pathway in autophagy regulation. Additionally, the findings of this study suggest that NaB holds promise as a functional feed additive to mitigate hepatic lipid metabolic disorders in poultry. However, as this study was conducted in vitro using LMH cells, the results may not fully capture the complexity of hepatic lipid metabolism in vivo. Therefore, further studies using primary chicken hepatocytes and/or in vivo models are warranted to confirm the physiological relevance and evaluate the practical applicability of NaB supplementation in poultry production.

Conclusion

In conclusion, our study provides evidence that LMH cells treated with 400 μM OA induces significant lipid accumulation, oxidative stress, and autophagy suppression. Conversely, 1 mM NaB alleviates these detrimental effects by promoting fatty acid oxidation, alleviating oxidative stress, blostering mitochondrial function, and inhibiting apoptosis. Moreover, NaB modulates lipid metabolism via the LKB1-AMPK-mTOR signaling pathway, thereby facilitating autophagy activation. Collectively, these results imply that NaB possesses therapeutic potential for managing lipid metabolic disorders in avian hepatocytes.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgements

This work was supported by the earmarked fund for the STI2030-Major Projects (2023ZD04064), National Key Research and Development Program of China (2022YFD1300100), Zhejiang Provincial Natural Science Foundation of China (LZ23C170001), China Agriculture Research System (CARS-42), and Zhejiang Province Agricultural New Breed Breeding Major Science and Technology Special Project (2021C02068).

References

  1. Adeyanju O.A., Badejogbin O.C., Areola D.E., Olaniyi K.S., Dibia C., Soetan O.A., Oniyide A.A., Michael O.S., Olatunji L.A., Soladoye A.O. Sodium butyrate arrests pancreato-hepatic synchronous uric acid and lipid dysmetabolism in high-fat diet-fed Wistar rats. Biomed. Pharmacother. 2021;133 doi: 10.1016/j.biopha.2020.110994. [DOI] [PubMed] [Google Scholar]
  2. Astrup A., Dyerberg J., Elwood P., Hermansen K., Hu F.B., Jakobsen M.U., Kok F.J., Krauss R.M., Lecerf J.M., LeGrand P., Nestel P., Risérus U., Sanders T., Sinclair A., Stender S., Tholstrup T., Willett W.C. The role of reducing intakes of saturated fat in the prevention of cardiovascular disease: where does the evidence stand in 2010? Am. J. Clin. Nutr. 2011;93(4):684–688. doi: 10.3945/ajcn.110.004622. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Barbier-Torres L., Fortner K.A., Iruzubieta P., Delgado T.C., Giddings E., Chen Y., Champagne D., Fernández-Ramos D., Mestre D., Gomez-Santos B., Varela-Rey M., de Juan V.G., Fernández-Tussy P., Zubiete-Franco I., García-Monzón C., González-Rodríguez Á., Oza D., Valença-Pereira F., Fang Q., Crespo J., Aspichueta P., Tremblay F., Christensen B.C., Anguita J., Martínez-Chantar M.L., Rincón M. Silencing hepatic MCJ attenuates non-alcoholic fatty liver disease (NAFLD) by increasing mitochondrial fatty acid oxidation. Nat. Commun. 2020;11(1):3360. doi: 10.1038/s41467-020-16991-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Biczo G., Vegh E.T., Shalbueva N., Mareninova O.A., Elperin J., Lotshaw E., Gretler S., Lugea A., Malla S.R., Dawson D., Ruchala P., Whitelegge J., French S.W., Wen L., Husain S.Z., Gorelick F.S., Hegyi P., Rakonczay Z., Jr., Gukovsky I., Gukovskaya A.S. Mitochondrial dysfunction, through impaired autophagy, leads to endoplasmic reticulum stress, deregulated lipid metabolism, and pancreatitis in animal models. Gastroenterology. 2018;154(3):689–703. doi: 10.1053/j.gastro.2017.10.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Cao S., Wang C., Yan J., Li X., Wen J., Hu C. Curcumin ameliorates oxidative stress-induced intestinal barrier injury and mitochondrial damage by promoting Parkin-dependent mitophagy through the AMPK-TFEB signal pathway. Free. Radic. Biol. Med. 2020;147:8–22. doi: 10.1016/j.freeradbiomed.2019.12.004. [DOI] [PubMed] [Google Scholar]
  6. Chen Q., Wu L., Zhang A., Wu C., Cai L., Xiao Y., Ni Y. Sodium butyrate alleviates fructose-induced non-alcoholic fatty liver disease by remodeling gut microbiota to promoteγ-amino butyric acid production. Food. Sci. Hum. Well. 2024;13(2):961–971. [Google Scholar]
  7. Cui Z., Jin N., Amevor F.K., Shu G., Du X., Kang X., Ning Z., Deng X., Tian Y., Zhu Q., Wang Y., Li D., Zhang Y., Wang X., Han X., Feng J., Zhao X. Dietary supplementation of salidroside alleviates liver lipid metabolism disorder and inflammatory response to promote hepatocyte regeneration via PI3K/AKT/Gsk3-β pathway. Poult. Sci. 2022;101(9) doi: 10.1016/j.psj.2022.102034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Dashti Z., Yousefi Z., Kiani P., Taghizadeh M., Maleki M.H., Borji M., Vakili O., Shafiee S.M. Autophagy and the unfolded protein response shape the non-alcoholic fatty liver landscape: decoding the labyrinth. Metabolism. 2024;154 doi: 10.1016/j.metabol.2024.155811. [DOI] [PubMed] [Google Scholar]
  9. Day E.A., Ford R.J., Steinberg G.R. AMPK as a therapeutic target for treating metabolic diseases. Trends Endocrinol. Metab. 2017;28(8):545–560. doi: 10.1016/j.tem.2017.05.004. [DOI] [PubMed] [Google Scholar]
  10. Ding J., Liu J., Chen J., Cheng X., Cao H., Guo X., Hu G., Zhuang Y. Sodium butyrate alleviates free fatty acid-induced steatosis in primary chicken hepatocytes via the AMPK/PPARα pathway. Poult. Sci. 2024;103(4) doi: 10.1016/j.psj.2024.103482. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Fang B., Luo J., Cui Z., Liu R., Wang P., Zhang J. Pea albumin alleviates oleic acid-induced lipid accumulation in LO2 cells through modulating lipid metabolism and fatty acid oxidation pathways. Foods. 2024;13(21):3482. doi: 10.3390/foods13213482. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Fernández-Sáez E.M., Losarcos M., Becerril S., Valentí V., Moncada R., Martín M., Burrell M.A., Catalán V., Gómez-Ambrosi J., Mugueta C., Colina I., Silva C., Escalada J., Frühbeck G., Rodríguez A. Uroguanylin prevents hepatic steatosis, mitochondrial dysfunction and fibrosis in obesity-associated NAFLD. Metabolism. 2023;147 doi: 10.1016/j.metabol.2023.155663. [DOI] [PubMed] [Google Scholar]
  13. Gai H., Zhou F., Zhang Y., Ai J., Zhan J., You Y., Huang W. Coniferaldehyde ameliorates the lipid and glucose metabolism in palmitic acid-induced HepG2 cells via the LKB1/AMPK signaling pathway. J. Food. Sci. 2020;85(11):4050–4060. doi: 10.1111/1750-3841.15482. [DOI] [PubMed] [Google Scholar]
  14. Gallagher L.E., Williamson L.E., Chan E.Y. Advances in autophagy regulatory mechanisms. Cells. 2016;5(2):24. doi: 10.3390/cells5020024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Guo L. F-ATP synthase inhibitory factor 1 and mitochondria-organelle interactions: new insight and implications. Pharmacol. Res. 2024;208 doi: 10.1016/j.phrs.2024.107393. [DOI] [PubMed] [Google Scholar]
  16. Hamid H., Zhang J.Y., Li W.X., Liu C., Li M.L., Zhao L.H., Ji C., Ma Q.G. Interactions between the cecal microbiota and non-alcoholic steatohepatitis using laying hens as the model. Poult. Sci. 2019;98(6):2509–2521. doi: 10.3382/ps/pey596. [DOI] [PubMed] [Google Scholar]
  17. He B., Moreau R. Lipid-regulating properties of butyric acid and 4-phenylbutyric acid: molecular mechanisms and therapeutic applications. Pharmacol. Res. 2019;144:116–131. doi: 10.1016/j.phrs.2019.04.002. [DOI] [PubMed] [Google Scholar]
  18. Hung C.M., Lombardo P.S., Malik N., Brun S.N., Hellberg K., Van Nostrand J.L., Garcia D., Baumgart J., Diffenderfer K., Asara J.M., Shaw R.J. AMPK/ULK1-mediated phosphorylation of Parkin ACT domain mediates an early step in mitophagy. Sci. Adv. 2021;7(15):eabg4544. doi: 10.1126/sciadv.abg4544. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Jang H.J., Lee Y.H., Dao T., Jo Y., Khim K.W., Eom H.J., Lee J.E., Song Y.J., Choi S.S., Park K., Ji H., Chae Y.C., Myung K., Kim H., Ryu D., Park N.H., Park S.H., Choi J.H. Thrap3 promotes nonalcoholic fatty liver disease by suppressing AMPK-mediated autophagy. Exp. Mol. Med. 2023;55(8):1720–1733. doi: 10.1038/s12276-023-01047-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Jia L., Cao M., Chen H., Zhang M., Dong X., Ren Z., Sun J., Pan L.L. Butyrate ameliorates antibiotic-driven type 1 diabetes in the female offspring of nonobese diabetic mice. J. Agric. Food. Chem. 2020;68(10):3112–3120. doi: 10.1021/acs.jafc.9b07701. [DOI] [PubMed] [Google Scholar]
  21. Jung T.Y., Ryu J.E., Jang M.M., Lee S.Y., Jin G.R., Kim C.W., Lee C.Y., Kim H., Kim E., Park S., Lee S., Lee C., Kim W., Kim T., Lee S.Y., Ju B.G., Kim H.S. Naa20, the catalytic subunit of NatB complex, contributes to hepatocellular carcinoma by regulating the LKB1-AMPK-mTOR axis. Exp. Mol. Med. 2020;52(11):1831–1844. doi: 10.1038/s12276-020-00525-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Ke P.Y. Mitophagy in the pathogenesis of liver diseases. Cells. 2020;9(4):831. doi: 10.3390/cells9040831. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Kuramoto K., Kim Y.J., Hong J.H., He C. The autophagy protein Becn1 improves insulin sensitivity by promoting adiponectin secretion via exocyst binding. Cell. Rep. 2021;35(8) doi: 10.1016/j.celrep.2021.109184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kushwaha V., Rai P., Varshney S., Gupta S., Khandelwal N., Kumar D., Nilkanth Gaikwad A. Sodium butyrate reduces endoplasmic reticulum stress by modulating CHOP and empowers favorable anti-inflammatory adipose tissue immune-metabolism in HFD fed mice model of obesity. Food. Chem. 2022;4 doi: 10.1016/j.fochms.2022.100079. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Li D., Cai H., Liu G., Han Y., Qiu K., Liu W., Meng K., Yang P. Lactiplantibacillus plantarum FRT4 attenuates high-energy low-protein diet-induced fatty liver hemorrhage syndrome in laying hens through regulating gut-liver axis. J. Anim. Sci. Biotechnol. 2024;15(1):31. doi: 10.1186/s40104-023-00982-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Li L., Wang H.H., Nie X.T., Jiang W.R., Zhang Y.S. Sodium butyrate ameliorates lipopolysaccharide-induced oxidative stress damage and apoptosis in cow mammary epithelial cells. J. Cell. Biochem. 2019;120(2):2370–2381. doi: 10.1002/jcb.27565. [DOI] [PubMed] [Google Scholar]
  27. Li Z., Zhang H., Li Y., Chen H., Wang C., Wong V.K.W., Jiang Z., Zhang W. Phytotherapy using blueberry leaf polyphenols to alleviate non-alcoholic fatty liver disease through improving mitochondrial function and oxidative defense. Phytomedicine. 2020;69 doi: 10.1016/j.phymed.2020.153209. [DOI] [PubMed] [Google Scholar]
  28. Liang Y., Zhang Z., Tu J., Wang Z., Gao X., Deng K., El-Samahy M.A., You P., Fan Y., Wang F. γ-linolenic acid prevents lipid metabolism disorder in palmitic acid-treated alpha mouse liver-12 cells by balancing autophagy and apoptosis via the LKB1-AMPK-mTOR pathway. J. Agric. Food Chem. 2021;69(29):8257–8267. doi: 10.1021/acs.jafc.1c02596. [DOI] [PubMed] [Google Scholar]
  29. Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25(4):402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  30. Luo S., Li Z., Mao L., Chen S., Sun S. Sodium butyrate induces autophagy in colorectal cancer cells through LKB1/AMPK signaling. J. Physiol. Biochem. 2019;75(1):53–63. doi: 10.1007/s13105-018-0651-z. [DOI] [PubMed] [Google Scholar]
  31. Ma L., Lyu W., Song Y., Chen K., Lv L., Yang H., Wang W., Xiao Y. Anti-inflammatory effect of clostridium butyricum-derived extracellular vesicles in ulcerative colitis: impact on host microRNAs expressions and gut microbiome profiles. Mol. Nutr. Food. Res. 2023;67(13) doi: 10.1002/mnfr.202200884. [DOI] [PubMed] [Google Scholar]
  32. Miao S., Li Y., Mu T., Wang X., Zhao W., Li R., Dong X., Zou X. Dietary coated sodium butyrate ameliorates hepatic lipid accumulation and inflammation via enhancing antioxidative function in post-peaking laying hens. Metabolites. 2023;13(5):650. doi: 10.3390/metabo13050650. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Miao S., Mu T., Li R., Li Y., Zhao W., Li J., Dong X., Zou X. Coated sodium butyrate ameliorates high-energy and low-protein diet-induced hepatic dysfunction via modulating mitochondrial dynamics, autophagy, and apoptosis in laying hens. J. Anim. Sci. Biotechnol. 2024;15(1):15. doi: 10.1186/s40104-023-00980-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Mollica M.P., Mattace Raso G., Cavaliere G., Trinchese G., De Filippo C., Aceto S., Prisco M., Pirozzi C., Di Guida F., Lama A., Crispino M., Tronino D., Di Vaio P., Berni Canani R., Calignano A., Meli R. Butyrate regulates liver mitochondrial function, efficiency, and dynamics in insulin-resistant obese mice. Diabetes. 2017;66(5):1405–1418. doi: 10.2337/db16-0924. [DOI] [PubMed] [Google Scholar]
  35. Nieminen A.L. Apoptosis and necrosis in health and disease: role of mitochondria. Int. Rev. Cytol. 2003;224:29–55. doi: 10.1016/s0074-7696(05)24002-0. [DOI] [PubMed] [Google Scholar]
  36. Paternostro R., Trauner M. Current treatment of non-alcoholic fatty liver disease. J. Intern. Med. 2022;292(2):190–204. doi: 10.1111/joim.13531. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Pawlowski J., Kraft A.S. Bax-induced apoptotic cell death. Proc. Natl. Acad. Sci. U S A. 2000;97:529–531. doi: 10.1073/pnas.97.2.529. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Singh R., Kaushik S., Wang Y., Xiang Y., Novak I., Komatsu M., Tanaka K., Cuervo A.M., Czaja M.J. Autophagy regulates lipid metabolism. Nature. 2009;458(7242):1131–1135. doi: 10.1038/nature07976. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Song H., Yang R., Zhang J., Sun P., Xing X., Wang L., Sairijima T., Hu Y., Liu Y., Cheng H., Zhang Q., Li L. Oleic acid-induced steatosis model establishment in LMH cells and its effect on lipid metabolism. Poult. Sci. 2023;102(1) doi: 10.1016/j.psj.2022.102297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Springer M.Z., Macleod K.F. In brief: mitophagy: mechanisms and role in human disease. J. Pathol. 2016;240(3):253–255. doi: 10.1002/path.4774. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Tang Y., Chen Y., Jiang H., Nie D. The role of short-chain fatty acids in orchestrating two types of programmed cell death in colon cancer. Autophagy. 2011;7(2):235–237. doi: 10.4161/auto.7.2.14277. [DOI] [PubMed] [Google Scholar]
  42. Tsai S.Y., Chung P.C., Owaga E.E., Tsai I.J., Wang P.Y., Tsai J.I., Yeh T.S., Hsieh R.H. Alpha-mangostin from mangosteen (Garcinia mangostana Linn.) pericarp extract reduces high-fat diet-induced hepatic steatosis in rats by regulating mitochondria function and apoptosis. Nutr. Metab. 2016;13:88. doi: 10.1186/s12986-016-0148-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Wang C., Cao S., Zhang Q., Shen Z., Feng J., Hong Q., Lu J., Xie F., Peng Y., Hu C. Dietary tributyrin attenuates intestinal inflammation, enhances mitochondrial function, and induces mitophagy in piglets challenged with diquat. J. Agric. Food. Chem. 2019;67(5):1409–1417. doi: 10.1021/acs.jafc.8b06208. [DOI] [PubMed] [Google Scholar]
  44. Wang H., Dou S., Zhu J., Shao Z., Wang C., Cheng B. Regulatory effects of ghrelin on endoplasmic reticulum stress, oxidative stress, and autophagy: therapeutic potential. Neuropeptides. 2021;85 doi: 10.1016/j.npep.2020.102112. [DOI] [PubMed] [Google Scholar]
  45. Wang R., Yang X., Liu J., Zhong F., Zhang C., Chen Y., Sun T., Ji C., Ma D. Gut microbiota regulates acute myeloid leukaemia via alteration of intestinal barrier function mediated by butyrate. Nat. Commun. 2022;13(1):2522. doi: 10.1038/s41467-022-30240-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Wu Q., Tang H., Wang H. The anti-oxidation and mechanism of essential oil of Paederia scandens in the NAFLD model of chicken. Animals. 2019;9(10):850. doi: 10.3390/ani9100850. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Wu Z., Geng Y., Buist-Homan M., Moshage H. Scopoletin and umbelliferone protect hepatocytes against palmitate- and bile acid-induced cell death by reducing endoplasmic reticulum stress and oxidative stress. Toxicol. Appl. Pharmacol. 2022;436 doi: 10.1016/j.taap.2021.115858. [DOI] [PubMed] [Google Scholar]
  48. Xie C., Chen Z., Zhang C., Xu X., Jin J., Zhan W., Han T., Wang J. Dihydromyricetin ameliorates oleic acid-induced lipid accumulation in L02 and HepG2 cells by inhibiting lipogenesis and oxidative stress. Life. Sci. 2016;157:131–139. doi: 10.1016/j.lfs.2016.06.001. [DOI] [PubMed] [Google Scholar]
  49. Xing W., Yang L., Peng Y., Wang Q., Gao M., Yang M., Xiao X. Ginsenoside Rg3 attenuates sepsis-induced injury and mitochondrial dysfunction in liver via AMPK-mediated autophagy flux. Biosci. Rep. 2017;37(4) doi: 10.1042/BSR20170934. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Xu B., Zhou Z., Fang J., Wang J., Tao K., Liu J., Liu S. Exosomes derived from Schwann cells alleviate mitochondrial dysfunction and necroptosis after spinal cord injury via AMPK signaling pathway-mediated mitophagy. Free Radic. Biol. Med. 2023;208:319–333. doi: 10.1016/j.freeradbiomed.2023.08.026. [DOI] [PubMed] [Google Scholar]
  51. Xu C., Huang X., Yan G., Wang D., Hu M., Tang C. Tolvaptan improves contrast-induced acute kidney injury. J. Renin. Angiotensin. Aldosterone. Syst. 2022;2022 doi: 10.1155/2022/7435292. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Yan D., Dou Q.L., Wang Z., Wei Y.Y. Establishment of a hepatocyte steatosis model using Chang liver cells. Genet. Mol. Res. 2015;14(4):15224–15232. doi: 10.4238/2015.November.25.10. [DOI] [PubMed] [Google Scholar]
  53. Yu Q., Liu Y., Wu Y., Chen Y. Dihydrocurcumin ameliorates the lipid accumulation, oxidative stress and insulin resistance in oleic acid-induced L02 and HepG2 cells. Biomed. Pharmacother. 2018;103:1327–1336. doi: 10.1016/j.biopha.2018.04.143. [DOI] [PubMed] [Google Scholar]
  54. Zang Y., Fan L., Chen J., Huang R., Qin H. Improvement of lipid and glucose metabolism by capsiate in palmitic acid-treated HepG2 cells via activation of the AMPK/SIRT1 signaling pathway. J. Agric. Food. Chem. 2018;66(26):6772–6781. doi: 10.1021/acs.jafc.8b01831. [DOI] [PubMed] [Google Scholar]
  55. Zeng T., Sun H., Huang M., Guo R., Gu T., Cao Y., Li C., Tian Y., Chen L., Li G., Lu L. Dietary supplementation of coated sodium butyrate improves growth performance of laying ducks by regulating intestinal health and immunological performance. Front. Immunol. 2023;14 doi: 10.3389/fimmu.2023.1142915. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Zhang Y., Li K., Kong A., Zhou Y., Chen D., Gu J., Shi H. Dysregulation of autophagy acts as a pathogenic mechanism of non-alcoholic fatty liver disease (NAFLD) induced by common environmental pollutants. Ecotoxicol. Environ. Saf. 2021;217 doi: 10.1016/j.ecoenv.2021.112256. [DOI] [PubMed] [Google Scholar]
  57. Zhao D.Y., Yu D.D., Ren L., Bi G.R. Ligustilide protects PC12 cells from oxygen-glucose deprivation/reoxygenation-induced apoptosis via the LKB1-AMPK-mTOR signaling pathway. Neural. Regen. Res. 2020;15(3):473–481. doi: 10.4103/1673-5374.266059. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES