Skip to main content
NCBI home page
Epigenetics logoLink to Epigenetics
. 2025 Jul 14;20(1):2529358. doi: 10.1080/15592294.2025.2529358

CpG island demethylation and recruitment of SP1 to the promoter region regulates human thymic stromal lymphopoietin expression

Krishna Priya Ganti a,✉, Milan Surjit b
PMCID: PMC12269656  PMID: 40654309

ABSTRACT

Thymic Stromal Lymphopoietin (TSLP), an immunomodulatory cytokine, plays a pivotal role in the development and progression of atopic and allergic diseases. Atopy follows familial inheritance, and genome-wide studies have shown association of atopy with TSLP polymorphisms. Here, we analysed the conserved transcriptional regulatory elements in the human TSLP promoter, which revealed the presence of three CpG islands. Demethylation of the CpG island using 5-azacytidine or siRNA-mediated knockdown of DNA methyl transferases significantly upregulated TSLP expression. Sequence analysis revealed the presence of two overlapping SP1 transcription factor DNA-binding sites (DBSs), between −1494 and −1510 nucleotides on the human TSLP promoter. Further experiments showed that demethylation of the CpG island enables the binding of SP1 to its cognate DBS present on the TSLP promoter, resulting in its transcriptional activation. Moreover, retinoic acid-induced transcription of human TSLP was associated with CpG island demethylation and SP1 binding to the TSLP promoter. These findings unravel a distinct mechanism of transcriptional regulation of the human TSLP gene and suggest possible epigenetic regulation of TSLP expression in modulating atopic and allergic disease severity in different individuals.

KEYWORDS: TSLP transcription, epigenetics, CpG islands, methylation, SP1, atopic diseases

Introduction

Atopic and allergic diseases are complex genetic disorders which comprise atopic dermatitis, asthma, allergic rhinitis and food allergy, the prevalence of which is increasing worldwide with an alarming proportion, causing significant public health concern [1]. Individuals who develop atopic dermatitis (AD) in childhood tend to develop allergic rhinitis and/or asthma later in life in a phenomenon called ‘atopic march’ [2]. Importantly, atopy follows familial inheritance [3,4]. Multiple lines of evidence using both, mouse models of the disease and human atopic disease patient samples, have shown that Thymic Stromal Lymphopoietin (TSLP) is the master regulator of allergic inflammation [5]. Clinical trials using human TSLP monoclonal antibody, Tezepelumab, have shown promising results in the management of asthma [6]. GWAS of atopic dermatitis and asthma patients’ skin and lung epithelial samples, respectively, have shown the association of those diseases with TSLP [7,8].

TSLP is a cytokine expressed in a number of different cell types including the epithelial cells at barrier surfaces such as skin, lung, and intestine. It acts on cells of both myeloid and lymphoid lineage to promote TH2 differentiation and TH2 cytokine associated inflammation [9]. While constitutive TSLP expression in the intestinal epithelium confers tolerance against commensals and mediates the recovery from colonic inflammation [10,11], exacerbated expression of TSLP in the keratinocytes, bronchial epithelium, and oesophagus correlates with the onset of various allergic diseases in human such as atopic dermatitis [12], asthma [13], and food-allergy-associated eosinophilic oesophagitis [14,15]. Reports have also demonstrated the importance of TSLP in promoting breast and pancreatic tumors [16,17]. Collectively, these data illustrate various physiological and pathophysiological roles of TSLP throughout our life, thus suggesting that strict spatio-temporal control of TSLP expression is essential for maintaining homeostasis. Though the downstream signalling of TSLP is well characterized, its transcriptional regulation is partly understood; earlier studies have shown the functional significance of NFkB, AP1, and IRF3 elements in regulating human TSLP promoter activity [18,19]. A recent report has shown the presence of a negative Hypoxia Response Element (HRE) in the human TSLP promoter, which mediates inhibition of TNFα-induced TSLP activation [20]. An inverse correlation between promoter demethylation and increased TSLP expression was shown in the skin samples of atopic dermatitis patients and HaCaT cells (human keratinocyte-derived cell line) [21]. Previously, we reported the complex conundrum of the transcriptional regulation of the mouse TSLP gene transcription in skin epidermis and intestinal epithelium [22,23]. The present study was designed to compare the transcriptional regulation of mouse and human TSLP genes and identify the mechanism(s) controlling human TSLP expression. Analysis of human TSLP promoter and upstream regulatory sequences revealed the presence of three CpG islands, which were absent in the mouse DNA sequence. DNA methylation status analysis confirmed methylation of two CpG islands in the human TSLP promoter in normal condition. Further analysis identified the presence of two overlapping SP1 DNA-binding sites (DBSs) within the first CpG island. Biochemical or siRNA-mediated demethylation of the CpG islands enabled SP1 binding to the TSLP promoter and concomitant transcriptional activation of TSLP gene. Significance of these findings in epigenetic control of human TSLP expression and differential sensitivity of humans to allergic and atopic disease is discussed.

Results

Human TSLP promoter contains distinct CpG islands, which are differentially methylated

Analysis of 5kb upstream and downstream sequences from the TATA box of the human TSLP promoter using the ‘EMBOSS CpG Plot’ programme revealed the presence of three CpG islands (Figures 1a,b and Supplementary material), containing >60% GC-content, of which CpG dinucleotide constituted ~19% in CpG2 island and ~14% in CpG1 and CpG3 islands. CpG2 and CpG3 islands have HpaII/MspI sites. Preliminary analysis by methylation-specific PCR revealed that CpG2 island is methylated and hence resistant to HpaII digestion, while CpG3 island is unmethylated and hence sensitive to HpaII (Figure S1A and S1B). CpG2 and CpG3 are both sensitive to MspI. Note that CpG1 island has no HpaII/MspI site (Figure S1A). Methylation status of the CpG islands was further confirmed by ‘bisulphite sequencing,’ which revealed that ~75% and 85% CpG residues were methylated in the CpG islands 1 and 2, respectively, in HaCaT cells, whereas CpG3 was unmethylated (Figures 2(a-d)). However, in A549 cells, CpG1 and CpG3 showed a similar profile as in HaCaT cells but methylation profile of CpG2 is comparatively less (approximately 60%) (Figures 2a-d).

Figure 1.

Figure 1.

Open in a new tab

Human TSLP promoter consists of distinct CpG islands.

(a) Schematic representation of CpG islands present in human TSLP gene. All coordinates are with reference to +1 (first base of the translation initiation codon).

(b) Sequence and position of CpG islands present in hTSLP. Underlined sequences represent CpG1 region, underlined sequences in italics represent CpG2 region and underlined sequences in bold letters represent CpG3 region.

Figure 2.

Figure 2.

Open in a new tab

CpG islands in the hTSLP promoter are differentially methylated.

(a) Schematic representation of bisulphite sequencing result of CpG island 1 in HaCaT (upper panel) and A549 (lower panel) cells. Black and white circles represent methylated and unmethylated cytosines, respectively. Boxes represent the position of CpG residues present within SP1 binding sites. Left and right panels represent the upper and lower strands, respectively.

(b) Schematic representation of bisulphite sequencing result of CpG island 2.

(c) Schematic representation of bisulphite sequencing result of CpG island 3.

(d) Quantification of %CpG methylation in TSLP CpG islands of HaCaT and A549 cells. Data are mean ± SEM of 9 sequences in each case.

Human TSLP transcription is mediated through CpG island demethylation-dependent binding of SP1 to its cognate DBS

To investigate whether these methylated CpGs repress TSLP transcription, HaCaT, and A549 cells were treated with 5-azacytidine, which is known to block replication-dependent DNA methylation [24], followed by quantification of TSLP transcript level. Treatment of HaCaT and A549 cells with 5-azacytidine for 72 h resulted in approximately 300- and 400-fold increase in the TSLP RNA level, respectively (Figure 3a). The involvement of CpG methylation in regulating TSLP transcription was further assessed by siRNA mediated depletion (knock-down) of DNA methyl transferase 1 (DNMT1), which is the main enzyme responsible for maintenance of DNA methylation pattern. siRNA could reduce DNMT1 RNA level by approximately 80% in A549 cells (Figure 3b). We also tested the efficacy of siRNAs against DNMT3a and DNMT3b to silence the respective transcripts. There was approximately 75% and 60% reduction in DNMT3a and DNMT3b RNA levels, respectively, in cells treated with the corresponding siRNAs (Figure 3c-d). TSLP transcript level was increased by approximately 6 folds in the cells treated with DNMT1 siRNA (Figure 3e). However, treatment with DNMT3a and DNMT3b siRNAs marginally increased the TSLP transcript level (Figure 3e). Methylated CpGs are known to be associated with cofactors such as methyl CpG binding protein 2 (MeCP2) and Methyl-CpG-binding domain protein 2 (MBD2), which recruits HDACs and maintain inactive state of the chromatin [25]. CpG islands are also known to harbour SP1 DNA-binding site, which promote transcription upon binding with the SP1 transcription factor [26]. A search for the presence of SP1-DBS in the human TSLP promoter region revealed the presence of two overlapping SP1-DBS in the CpG island 1 (Figure 4a).

Figure 3.

Figure 3.

Open in a new tab

CpG island methylation regulates the transcription of human TSLP gene.

(a) qRT-PCR mediated quantification of TSLP RNA level in the HaCaT and A549 cells, treated with 5-azacytidine for 72 h.

(b) qRT-PCR mediated quantification of DNMT1 RNA level in A549 cells treated with DNMT1 siRNA for 72 h.

(c) qRT-PCR mediated quantification of DNMT3a RNA level in A549 cells treated with DNMT3a siRNA for 72 h.

(d) qRT-PCR mediated quantification of DNMT3b RNA level in A549 cells treated with DNM3b siRNA for 72 h.

(e) qRT-PCR mediated quantification of TSLP RNA level in the A549 cells, treated with the indicated siRNAs for 72 h.

Figure 4.

Figure 4.

Open in a new tab

Recruitment of SP1 upon CpG island demethylation transactivates human TSLP gene expression.

(a) Sequence (upper case letters) and position of SP1 binding sites present in hTSLP promoter region.

(b) ChIP assay of A549 (upper panel) and HaCaT (lower panel) cells, treated as indicated, to detect the binding of MeCP2, MBD2, and SP1 to the CpG island 1 region of hTSLP promoter.

(c) ChIP assay of A549 cells, treated as indicated, to detect the binding of SP1 to the CpG island 1 region of hTSLP promoter.

(d) qRT-PCR mediated quantification of TSLP RNA level in the A549 cells, treated as indicated with the SP1 siRNA and/or Mithramycin A and 5-azacytidine.

(e) qRT-PCR mediated quantification of SP1 RNA level in the A549 cells, treated with the SP1 siRNAs for 72 h. NT is non-targeted

All qRT-PCR values are normalized to that of GAPDH and presented as mean ± SEM of three independent samples. * and ** denotes p < 0.05 and p < 0.005, respectively. p values were calculated with reference to the vehicle treated sample.

Chromatin immunoprecipitation (ChIP) assays performed in A549 and HaCaT cells revealed the association of MeCP2 and MBD2 at the CpG island 1 region and treatment with 5-azacytidine completely abolished this association (Figure 4b). ChIP assays also revealed a constitutive weak binding of SP1 to the cognate element, which was significantly increased upon 5-azacytidine treatment (Figure 4b,c). The binding was specific for SP1 as it could be completely inhibited by cotreatment of cells with 5-azacytidine and mithramycin A (SP1 inhibitor) [27] (Figure 4c).

To investigate the role of SP1 in enhanced TSLP transcription due to 5-azacytidine treatment, A549 cells were either treated with mithramycin A (SP1 inhibitor) or with SP1-specific siRNA. Both mithramycin A and SP1 siRNA could block 5-azacytidine-induced increase in TSLP RNA production (Figure 4d), suggesting that indeed SP1 played a functional role in inducing TSLP transcription. Note that SP1 siRNA treatment reduced the level of SP1 mRNA by approximately 85% in the same cells (Figure 4e).

Collectively, these results demonstrate that TSLP expression in human is mediated by CpG island-demethylation dependent SP1 binding to its cognate DBS present on the human TSLP promoter.

Vitamin D and retinoic acid activates human TSLP transcription

Our earlier study identified and characterized the functional role of multiple Vitamin D and Retinoic Acid response elements located on the mouse TSLP promoter upstream sequences in controlling mouse TSLP transcription [22]. Vitamin D3 (VD3)-bound Vitamin D receptor (VDR) associates with direct repeat (DR) elements having consensus sequence NGGTCA, separated by three nucleotides (DR3), while all-trans retinoic acid (RA)-bound Retinoic Acid Receptor (RAR) associates with a DR element spaced by either two or five nucleotides (DR2/DR5), respectively. Of note, both VDR and RAR are recruited as heterodimeric partners with RXR on their respective DNA binding response elements. A search for DR3 and DR2/DR5 elements in the human TSLP promoter and 50kb upstream DNA sequence revealed the presence of one DR2 (−23442 bp from +1) and four DR3 elements (−7055, −11446, −35899, −49949 bp from +1) (Figure 5a).

Figure 5.

Figure 5.

Open in a new tab

Human TSLP promoter and upstream regulatory region have active DR2/DR3 elements.

(a) Schematic of the DR2 and DR3 elements present on the human TSLP promoter and upstream regulatory region.

(b) qRT-PCR mediated quantification of TSLP RNA level in the A549 cells, treated for 6 h with vehicle, VD3 or RA, as indicated. Values were normalized to that of GAPDH and presented as mean ± SEM of three independent samples. **denotes p <0.005. p values were calculated with reference to the vehicle treated sample.

(c) ChIP assay of A549 cells using VDR and RXRα antibodies to detect VDR and RXRα binding to the various DR3 elements present on hTSLP promoter and upstream regulatory region. Ten percent input denotes 10% of the total amount of DNA used in each ChIP assay.

(d) ChIP assay of A549 cells using RAR and RXRα antibodies to detect RAR and RXRα binding to the DR2 element present on hTSLP promoter upstream regulatory region. Ten percent input denotes 10% of the total amount of DNA used in each ChIP assay.

(e) ChIP assay of vehicle or RA treated A549 cells using the indicated antibodies to detect the association of the corresponding transcription factor to the DR2 element present on hTSLP promoter upstream regulatory region. Ten percent input denotes 10% of the total amount of DNA used in each ChIP assay.

Treatment of A549 cells with VD3 or RA significantly increased the level of TSLP RNA (Figure 5b). ChIP assay of A549 cells showed association of VDR and RXRalpha with all the DR3 elements (Figure 5c). Similarly, RAR and RXRalpha was associated with the DR2 element (Figure 5d). We next tested if RA-mediated upregulation of TSLP RNA level was a result of increase in TSLP transcription in the RA-treated cells. A549 cells were treated with Vehicle (DMSO) or RA, followed by ChIP assay with antibodies specific to transcriptional corepressors SMRT and NCoR and coactivators SRC-1, SRC-2, SRC-3, p300, and pCAF and RNA Polymerase II (Pol II). RAR and SMRT were associated with DR2 region in vehicle treated cells. In contrast, SMRT was absent and SRC-2, SRC-3, p300, pCAF and Pol II were associated with the DR2 region in RA-treated cells, suggesting transcriptional activation of the TSLP promoter (Figure 5e).

RA-induced transcription of the human TSLP gene involves demethylation of the CpG islands located on TSLP promoter

There is no CpG island in the mouse TSLP promoter region or upstream sequences. Our results indicated transcriptional silencing of the human TSLP gene expression by CpG island methylation. We wondered whether demethylation of the CpG islands preceded RA-induced TSLP transcription. A549 cells were treated with siRNAs against DNMTs in the presence and absence of RA, followed by measurement of TSLP RNA level. DNMT1 siRNA enhanced TSLP RNA level, which was further enhanced upon treatment with RA. DNMT3a and DNMT3b siRNAs moderately increased the TSLP RNA level, which was not significantly altered upon RA treatment (Figure 6a). Next, effect of SP1 inhibitor Mithramycin A on RA-induced TSLP transcription was checked. Cotreatment with Mithramycin A completely abolished TSLP RNA level (Figure 6b). Finally, we measured the level of TSLP CpG island methylation in RA treated A549 cells. There was significant reduction in the CpG island methylation status in RA-treated cells (Figure 6c). Collectively, these findings suggest that RA-induced demethylation of the TSLP CpG island.

Figure 6.

Figure 6.

Open in a new tab

Treatment of A549 cells with RA leads to demethylation of the human TSLP promoter CpG islands.

(a) qRT-PCR mediated quantification of TSLP RNA level in the A549 cells, treated with the indicated siRNAs for 72 h and treated with vehicle or RA for 6 h, wherever indicated. Values were normalized to that of GAPDH and presented as mean ± SEM of three independent samples. * and ** denote p < 0.05 and p < 0.005, respectively. p values were calculated with reference to the vehicle treated sample.

(b) qRT-PCR mediated quantification of TSLP RNA level in the A549 cells, treated for 6 h with vehicle, Mithramycin A or RA, as indicated. Values were normalized to that of GAPDH and presented as mean ± SEM of three independent samples. ** denotes p < 0.005. p values were calculated with reference to the vehicle treated sample.

(c) Quantification of %CpG methylation in TSLP CpG islands of A549 cells treated with RA for 1, 3 and 6 h, as indicated. Data are mean ± SEM of 8 sequences in each case. * and ** denote p < 0.05 and p < 0.005, respectively. p values were calculated between untreated upper strand with 1-, 3- and 6-h RA treated upper strand, and untreated lower strand with 1-, 3- and 6-h RA treated lower strand, respectively.

Discussion

The current study analysed the methylation status of the three CpG islands present on human TSLP promoter and explored the molecular mechanism by which demethylation of the CpG islands promoted TSLP expression. A correlation between promoter demethylation and enhanced TSLP expression has been observed earlier in AD patient skin samples and HaCaT cells [21]. However, the underlying mechanism was not explored. Here, we show that CpG island demethylation permits the binding of SP1 transcription factor to its cognate DBS located on human TSLP promoter, resulting in transcriptional activation of the TSLP promoter and upregulation of TSLP expression.

HaCaT (human keratinocyte-derived cell line) and A549 (human lung epithelial cell line) cells were used in all our experiments as they represent the two major cell types that express TSLP in vivo. Both cell types showed similar CpG island methylation profile, enhanced SP1-binding to the promoter region, and increased TSLP expression upon CpG island demethylation.

Our study also reveals the presence of functional VDRE and RARE in the human TSLP promoter upstream sequence. We also observed that RA treatment-induced CpG island demethylation and lack of DNMT1 further enhanced RA-induced upregulation of TSLP transcription. Inhibition of SP1 function in RA-treated cells prevented TSLP transcription. Taken together, these observations suggest that CpG island demethylation and SP1-binding precedes transcriptional activation of the human TSLP promoter.

Neither CpG island nor SP1 binding sites are present in the mouse TSLP regulatory sequences. One possible explanation concerning the evolution of an additional regulatory mechanism for controlling TSLP transcription by means of CpG DNA methylation might be attributed to our diurnal life style. Being frequently exposed to the UV radiation present in the day light, which in principle would induce TSLP transcription through the activation of NF-κB and AP1 pathways leading to spontaneous AD development; having a mechanism for maintaining TSLP gene in a repressed state by means of CpG DNA methylation will serve as an additional protective strategy against AD. It remains to be checked whether UV radiation demethylates human TSLP CpG island. It could also be possible that in the absence of CpG island methylation, TSLP promoter might be more susceptible to environmental challenges and could easily be activated, leading to allergic disorders. It would be interesting to find out the status of TSLP promoter CpG island methylation in large cohort of people suffering from hypersensitivity to atopic diseases. More studies are also warranted to understand the role of TSLP methylation in tumorigenesis. Methylation status of the TSLP promoter region (CpG 1 and CpG2 islands) could be used as a prognostic marker for disease susceptibility.

An alternate possibility for having methylated CpG islands in the TSLP promoter region might be ascribed to the evolution of additional sophisticated transcriptional regulatory mechanisms in higher mammals. It may be possible that in higher mammals, TSLP transcription activation by environmental allergens might involve selective demethylation of the CpG residues in the target gene, as has been reported for Estrogen induced transcription of PS2 gene [28]. Nonetheless, elucidating the mechanism(s) of selective demethylation upon allergen or inflammatory agent treatment might provide important insights regarding the evolution of stringency in the control of human TSLP gene expression.

In summary, the current study establishes SP1 as a crucial transcription factor that drives human TSLP transcription upon CpG island demethylation in the TSLP promoter region. Our study also demonstrates that RA-induced transcriptional activation of TSLP requires CpG island demethylation and SP1 binding to its cognate DBS. Future studies may focus on large-scale sequence data analysis to probe the link between epigenetic regulation of TSLP expression and predisposition to atopic and allergic diseases at population level.

Materials and methods

Mammalian cell culture, siRNA transfection, inhibitor treatment

HaCaT (normal human immortalized keratinocytes), A549 (immortalized human lung epithelial cells) cells were procured from ATCC and cultured as instructed. Briefly, HaCaT cells were maintained in DMEM and A549 cells were maintained in F-12K medium. The media was supplemented with 10% FBS and Penicillin/Streptomycin during maintenance. Cells were maintained in a 37°C humidified incubator, supplied with 5% CO2. All cell lines used, tested negative for Mycoplasma contamination. For siRNA-mediated gene silencing, A549 cells were transfected with 25 nM of the indicated siRNA, using Lipofectamine 2000 transfection reagent, as per manufacturer’s recommendation (Thermo Scientific, MA, USA). Following siRNAs were used: DNMT1 (L-056796-01, Dharmacon, OR, USA), DNMT3a (RI11559, Abgent, USA), DNMT3b (L-044164-01, Dharmacon, OR, USA), SP1 (L-026959-00–01, Dharmacon, OR, USA). Seventy-two hours post transfection, cells were harvested for further experiment. Inhibitor compounds were added to cells at the following final concentration: 5-Azacytidine: 10 µM; Mithramycin A: 5 µM,VD3: 1 µM; all-trans retinoic acid: 1 µM.

RNA isolation and RT-qPCR analysis

Total RNA was isolated using TRI reagent (MRC, MA, USA) following the manufacturer’s protocol. cDNA was synthesized using superscript II reverse transcription kit (Thermo Scientific, MA, USA). Real-time quantitative PCR (RT-qPCR) was performed using SYBR green-based kit, following manufacturer’s instruction (Qiagen, Germany). Twenty ul reaction volume was taken and PCR performed by following conditions: 95°C for 10 min, (94°C – 10s, 56°C − 20 s, 72°C −15 s) for 30 cycles. GAPDH was used as internal control for normalizing the data. Following primers were used: hGAPDH fp: 5′ GAGTCAACGGATTTGGTCGT; hGAPDH rp: 5′ TTGATTTTGGAGGGATCTCG; hTSLP fp: 5′ CCAGGCTATTCGGAAACTCA; hTSLP rp: 5′ TGGTGCTGTGAAATATGACCA; hDNMT1 fp: 5′AGAATTATCCGAGGAGGGCT; hDNMT1 rp: 5′ ACTTCTTGCTTGGTTCCCGT; hDNMT3a fp: 5′ AGGACCGAAAGGACGGAGA; hDNMT3a rp: 5′ ATCACCGCAGGGTCCTTTG; hDNMT3b fp: 5′ CTCAATGGAGAGGAGGACGC; hDNMT3b rp: 5′ ATCGCCTGTCAAGTCCTGTG; hSP1 fp: 5′ GAGGAGGAGGGCAGGAGTC; hSP1 rp: 5′ AGTTGTGTGGCTGTGAGGTC.

Methylation specific PCR

Genomic DNA was isolated from A549 and HaCaT cells using Qiagen DNeasy kit following manufacturer’s instructions. Isolated DNA was subject to HpaII (R0171S, NEB, MA, USA) and MspI (R0106S, NEB, MA, USA) restriction digestion, followed by PCR amplification of the CpG2 and CpG3 islands. Primer sequences are as follows. CpG2 fp: 5′ CATCTCGATGCTTCTCCTGTCTCT, CpG2 rp: 5′ CCACCTTCACAGTCCCACTCTT, CpG3 fp: 5′ CCAGGGAGACGCCAGG, CpG3 rp: 5′ CGTTCCCTCGTCCCAGTTCC.

Bisulfite sequencing

Genomic DNA was modified by bisulfite treatment using Imprint DNA Modification Kit (Sigma, Missouri, USA), as instructed. Briefly, DNA modification solution was prepared as instructed and added to the isolated genomic DNA, and incubated at 99°C for 6 min, immediately followed by incubation at 65°C for 90 min. After the one-step modification, following manufacturer’s protocol DNA was captured, cleaned, and eluted for further use. Modified DNA was used to PCR amplify the CpG island-containing regions. PCR products were cloned into the pGEMT easy vector (Promega, Wisconsin, USA), positive clones identified by PCR screening, followed by sequencing of 8–10 clones for each sample. Primer sequences are listed below: hCpg1 bisulfite pcr upper strand fp: 5′-AGGAATTTTTTAAGGATTAGAG; hcpg1 bisulfite pcr upper strand rp: 5′-CCAACAACACCAATAAAAAA; hcpg2 bisulfite pcr upper strand fp: 5′-TGTTTTTTTTGTTTTTAAAATTGG; hcpg2 bisulfite pcr upper strand rp: 5′- TCCTCTAACACTTTCTAACAAATA; hcpg3 bisulfite pcr upper strand fp: 5′- AGTGTTGTTGGTTTTTTTTAG; hcpg3 bisulfite pcr upper strand rp: 5′- AATTCCCAATTTACCTTTCCT; hcpg1 bisulfite pcr lower strand fp: 5′-AATTTATCCCCTACTCTTTTC; hcpg1 bisulfite pcr lower strand rp: 5′-GAGATGAATTTTTTGTTTTTTTTTGG; hcpg2 bisulfite pcr lower strand fp: 5′- TCCCTAACTCACTTTACTATACT; hcpg2 bisulfite pcr lower strand rp: 5′- GTTTTTTAGTATTTTTTAGTAGGTG; hcpg3 bisulfite pcr lower strand fp: 5′- CATTTTAAAAAAAAAATATCCTAC; hcpg3 bisulfite pcr lower strand rp: 5′- TGAGTAGAGTAAGGAAGAATTAA.

ChIP assay

ChIP assay was as carried out as described [23], with a few modifications. A549 cells were cross-linked by adding formaldehyde to a final concentration of 1% and incubated on a flip- flop rocker for 10 min at 25 °C, followed by addition of 2 M glycine (0.125 M final concentration) and incubation for 5 min. Cells were pelleted (400 × g, 5 min) at 4 °C and washed twice in ice-cold PBS. Cross-linked A549 cells were resuspended in 300 μL of ice-cold lysis buffer [50 mM Tris·HCl (pH 8.1), 1% (wt/vol) SDS, 10 mM EDTA, 1× protease inhibitor cocktail (Roche)], and all lysates were sonicated at 4 °C to generate 300- to 500-bp chromatin fragments (Bioruptor sonicator; Diagenode). Cellular debris was removed by spinning (10,000 × g, 10 min) at 4 °C, and the supernatant was precleared by incubating with 60 μL of protein G-agarose beads (pre-blocked with salmon sperm DNA and BSA) for 20 min at 4°C over a flip-flop rocker. Beads were pelleted (100 × g, 1 min) at 4 °C and discarded. Equal amounts of lysates were used for immunoprecipitation. Following antibodies were used: SP1 (Cat no. SC-59), MeCP2 (Cat no. SC-20700), MBD2 (Cat no. SC-5914062), VDR (Cat no. SC-59), RAR (Cat no. SC-773), SRC-1 (Cat no. SC-32789), SRC-3 (Cat no. SC-9119), p300 (Cat no. SC-585), pCAF (Cat no. SC-13124) antibodies were from Santacruz Biotechnology (USA). SMRT (Cat no. ab24551), NCoR (Cat no. ab3482) antibodies were from Abcam (USA). RXRα (clone 4RX3A2), SRC-2 (clone 4C11), RNA Pol II (clone 7C2) antibodies were in house generated and characterized [23]. Ten percent of the lysate amount used for each immunoprecipitation reaction was saved to be used as input DNA in PCR amplification. Individual samples were diluted 1:8 (vol/vol) in ChIP dilution buffer [16.7 mM Tris·HCl (pH 8.1), 0.01% (wt/vol) SDS, 1.1% (vol/vol) Triton-X 100, 1.2 mM EDTA, 16.7 mM NaCl, 1× protease inhibitor mixture] and incubated overnight with different primary antibodies at 4°C on a flip-flop rocker, followed by incubation with 60 μL of protein G-agarose beads (pre-blocked with salmon sperm DNA and BSA) for 90 min. Immuno-absorbed complexes were recovered by centrifugation (100 × g, 1 min) at 4 °C. Protein G beads were then washed once in low-salt buffer [20 mM Tris·HCl (pH 8.1), 0.1% (wt/vol) SDS, 1% (vol/vol) Triton X-100, 2 mM EDTA, 150 mM NaCl], once in high-salt buffer [20 mM Tris·HCl (pH 8.1), 0.1% (wt/vol) SDS, 1% (vol/vol) Triton T-100, 2 mM EDTA, 500 mM NaCl], once in LiCl buffer [10 mM Tris·HCl (pH 8.1), 250 mM LiCl, 1% (vol/vol) Nonidet p-40, 1% (wt/vol) sodium deoxycholate, 1 mM EDTA], and finally twice in 1 mL of TE buffer [10 mM Tris·HCl (pH 8.0), 1 mM EDTA]. Chromatin was released from the beads by incubation with 150 μL of elution buffer [1% (wt/vol) SDS, 100 mM NaHCO3] for 15 min at room temperature with intermittent vortexing. The elution step was repeated, and both eluates were pooled. One microliter of 10 mg/mL RNase A and 5 M NaCl (200 mM final concentration) were added to the eluate and incubated at 65 °C overnight. One microliter of 30 mg/mL Proteinase K was then added to the samples and incubated at 50 °C for 1 h. DNA was subsequently purified from the eluate using a Qiagen PCR Purification Kit (Qiagen, Germany) in a final volume of 50 μL. Three microliters of the purified DNA was used as a template in different PCR amplifications. The sequence of the various primers is listed below. The number of PCR cycles was optimized to maintain linear amplification in all experiments. PCR products were resolved by 2% (wt/vol) agarose gel electrophoresis. Images of ethidium bromide-stained DNA were acquired using an UV transilluminator equipped with a digital camera. Following primers were used: DR2 fp: 5′ AGCTCCACAGAAAAGCATGG; DR2 rp: 5′ TTTGTGAGACAGAGTCTTACTGTGC; DR3a fp: 5′ CAGGTTTTGTAAAATCGCAAAG; DR3a rp: 5′ CCGAAACCTGCAATTTCTCC; DR3b fp: 5′ ATTGCCCAACTGGACAAGAC; DR3b rp: 5′ CAAATAGGTGGGACCACAGG; DR3c fp: 5′TAGTGGAGCTGGCATTTCAA; DR3c rp: 5′ CACATTGGACCTGTGCAGTTA; DR3d fp: 5′ GAGCTGAAGAGTAGACAGTACAAAGC; DR3d rp: 5′ATAGCCCCCTGAGCTTCATT; CpG island 1 ChIP fp: CGCATGGCCTGTGACATTT; CpG island 1 ChIP rp: CGATCAGGTTGCTGAGATGA.

Statistical analysis

Data are represented as mean ± SEM of at least three independent experiments, and were analysed by the Student t-test. p < 0.05 was considered significant.

Supplementary Material

Supplemental Material
KEPI_A_2529358_SM6302.zip (906.6KB, zip)

Funding Statement

The authors reported there is no funding associated with the work featured in this article.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Data availability statement

The authors confirm that the data supporting the findings of this study are available within the article. Raw data generated is available as supplementary material.

Supplementary material

Supplemental data for this article can be accessed online at https://doi.org/10.1080/15592294.2025.2529358

References

  • [1].Simon FT. Epidemiology and natural history of atopic diseases. Eur Clin Respir J. 2015;2(1):10. doi: 10.3402/ecrj.v2.24642 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [2].Han H, Roan F, Ziegler SF. The atopic march: current insights into skin barrier dysfunction and epithelial cell-derived cytokines. Immunol Rev. 2017. Jul;278(1):116–13. doi: 10.1111/imr.12546 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [3].Wadonda-Kabondo N, Sterne JAC, Golding J, et al. Association of parental eczema, hayfever, and asthma with atopic dermatitis in infancy: birth cohort study archives of disease in childhood. 2004;89:917–921. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [4].Apfelbacher CJ, Diepgen TL, Schmitt J. Determinants of eczema: population-based cross-sectional study in Germany. Allergy. 2011;66(2):206–213. doi: 10.1111/j.1398-9995.2010.02464.x [DOI] [PubMed] [Google Scholar]
  • [5].Liu YJ. Thymic stromal lymphopoietin: master switch for allergic inflammation. J Exp Med. 2006;203(2):269–273. doi: 10.1084/jem.20051745 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [6].Corren J, Ambrose CS, Sałapa K, Roseti S.L, Griffiths J.M, Parnes JR, Colice G.J. Efficacy of Tezepelumab in patients with severe, uncontrolled asthma and perennial allergy. Allergy Clin Immunol Pract. 2021. Aug 3;S2213–2198(21) 00886–2. DOI: 10.1016/j.jaip.2021.07.045 [DOI] [PubMed] [Google Scholar]
  • [7].Vicente CT, Revez JA, Manuel AR. Ferreira lessons from ten years of genome-wide association studies of asthma. Clinical & Translational Immunology. 2017;6:e165. doi: 10.1038/cti.2017.54 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [8].Bin L, Leung DY. Genetic and epigenetic studies of atopic dermatitis. Allergy Asthma Clin Immunol. 2016. Oct 19;12(1):52. doi: 10.1186/s13223-016-0158-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [9].Sf Z, Roan F, Bd B, et al. The biology of thymic stromal lymphopoietin (TSLP). Adv Pharmacol. 2013;66:129–155. doi: 10.1016/B978-0-12-404717-4.00004-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [10].Rimoldi M, Chieppa M, Salucci V, et al. Intestinal immune homeostasis is regulated by the crosstalk between epithelial cells and dendritic cells. Nat Immunol. 2005. May;6(5):507–514. doi: 10.1038/ni1192 [DOI] [PubMed] [Google Scholar]
  • [11].Reardon C, Lechmann M, Brüstle A, et al. Thymic stromal lymphopoietin-induced expression of the endogenous inhibitory enzyme SLPI mediates recovery from colonic inflammation. Immunity. 2011. Aug 26;35(2):223–235. doi: 10.1016/j.immuni.2011.05.015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [12].Soumelis V, Reche PA, Kanzler H, et al. Human epithelial cells trigger dendritic cell mediated allergic inflammation by producing TSLP. Nat Immunol. 2002. Jul;3(7):673–680. doi: 10.1038/ni805 [DOI] [PubMed] [Google Scholar]
  • [13].Ying S, O’Connor B, Ratoff J, et al. Thymic stromal lymphopoietin expression is increased in asthmatic airways and correlates with expression of Th2-attracting chemokines and disease severity. J Immunol. 2005;174(12):8183–8190. doi: 10.4049/jimmunol.174.12.8183 [DOI] [PubMed] [Google Scholar]
  • [14].Marc ER, Jonathan MS, Joseph DS, et al. Hakon Hakonarson. Common variants at 5q22 associate with pediatric eosinophilic esophagitis. Nat Genet. 2010. Apr;42(4):289–291. doi: 10.1038/ng.547 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [15].Joseph DS, Pei-Song G, Emily MS, et al. Variants of thymic stromal lymphopoietin and its receptor associate with eosinophilic esophagitis. J Allergy Clin Immunol. 2010. Jul;126(1):160–5.e3.A. doi: 10.1016/j.jaci.2010.04.037 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [16].Pedroza-Gonzalez A, Xu K, Wu T-C, et al. A Karolina Palucka. Thymic stromal lymphopoietin fosters human breast tumor growth by promoting type 2 inflammation. J Exp Med. 2011;208(3):479–490. doi: 10.1084/jem.20102131 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [17].Lucia DM, Michele R, Elena T, et al. Intratumor T helper type 2 cell infiltrate correlates with cancer-associated fibroblast thymic stromal lymphopoietin production and reduced survival in pancreatic cancer. J Exp Med. 2011. Mar 14;208(3):469–478. doi: 10.1084/jem.20101876 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [18].Naresh SR, Ali S, Andrew JH, et al. Essential role of NF-κB and AP-1 transcription factors in TNF-α-induced TSLP expression in human airway smooth muscle cells. Am J Physiol Lung Cell Mol Physiol. 2011. Mar;300(3):L479–85. doi: 10.1152/ajplung.00301.2009 [DOI] [PubMed] [Google Scholar]
  • [19].Negishi H, Miki S, Sarashina H, et al. Essential contribution of IRF3 to intestinal homeostasis and microbiota-mediated Tslp gene induction. Proc Natl Acad Sci USA. 2012;109(51):21016–21021. doi: 10.1073/pnas.1219482110 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [20].Tashiro N, Segawa R, Tobita R, et al. Noriyasu Hirasawa (2019) hypoxia inhibits TNF-α-induced TSLP expression in keratinocytes. PLOS ONE. 2019;14(11):e0224705. doi: 10.1371/journal.pone.0224705 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [21].Luo Y, Zhou B, Zhao M, et al. Promoter demethylation contributes to TSLP overexpression in skin lesions of patients with atopic dermatitis. Clin Exp Dermatol. 2014. Jan;39(1):48–53. doi: 10.1111/ced.12206 [DOI] [PubMed] [Google Scholar]
  • [22].Krishna Priya Ganti, Atish Mukherji , Milan Surjit , Mei Li , Pierre Chambon. Similarities and differences in the transcriptional control of expression of the mouse TSLP gene in skin epidermis and intestinal epithelium. Proc Natl Acad Sci USA. 2017. Feb 7;114(6):E951–E960. doi: 10.1073/pnas.1620697114 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [23].Surjit M, Ganti KP, Mukherji A, et al. Widespread negative response elements mediate direct re-pression by agonist-liganded glucocorticoid receptor. Cell. 2011;145(2):224–241. doi: 10.1016/j.cell.2011.03.027 [DOI] [PubMed] [Google Scholar]
  • [24].Christman JK. 5-Azacytidine and 5-Aza-2’-deoxycytidine as inhibitors of DNA methylation: mechanistic studies and their implications for cancer therapy. Oncogene. 2002. Aug 12;21(35):5483–5495. doi: 10.1038/sj.onc.1205699 [DOI] [PubMed] [Google Scholar]
  • [25].Bird AP, Wolffe AP. Methylation-induced repression–belts, braces, and chromatin. Cell. 1999. Nov 24;99(5):451–454. doi: 10.1016/s0092-8674(00)81532-9 [DOI] [PubMed] [Google Scholar]
  • [26].Gardiner-Garden M, Frommer M. CpG islands in vertebrate genomes. J Mol Biol. 1987. Jul 20;196(2):261–282. doi: 10.1016/0022-2836(87)90689-9 [DOI] [PubMed] [Google Scholar]
  • [27].Métivier R, Gallais R, Tiffoche C, et al. Cyclical DNA methylation of a transcriptionally active promoter. Nature. 2008;452(7183):45–50. doi: 10.1038/nature06544 [DOI] [PubMed] [Google Scholar]
  • [28].Long GW, Anna CF. Mithramycin targets sp1 and the androgen receptor transcription level-potential therapeutic role in advanced prostate cancer. Transl Oncogenomics. 2006. Oct 11;1:19–31. PMID: 23662037. [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental Material
KEPI_A_2529358_SM6302.zip (906.6KB, zip)

Data Availability Statement

The authors confirm that the data supporting the findings of this study are available within the article. Raw data generated is available as supplementary material.

Articles from Epigenetics are provided here courtesy of Taylor & Francis

RESOURCES