ABSTRACT
Macroautophagy/autophagy is an evolutionarily conserved intracellular degradation pathway that relies on vacuoles or lysosomes. Over 40 ATG genes have been identified in yeast cells as participants in various types of autophagy, although these genes are non-essential. While some essential genes involved in autophagy have been identified using temperature-sensitive yeast strains, systematic research on essential genes in autophagy remains lacking. To address this, we established an essential protein conditional degradation library using the auxin-inducible degron (AID) system. By introducing the GFP-Atg8 plasmid, we identified 29 essential yeast genes involved in autophagy, 19 of which had not been previously recognized. In summary, the yeast essential protein conditional degradation library we constructed will serve as a valuable resource for systematically investigating the roles of essential genes in autophagy and other biological functions.
Abbreviation: AID: auxin-inducible degron; ALP: alkaline phosphatase; ATG: autophagy related; CSG: constitutive slow growth; DAmP: Decreased Abundance by mRNA Perturbation; GFP: green fluorescent protein; MMS: methyl methanesulfonate; ORF: open reading frame; PAS: phagophore assembly site; PCR: polymerase chain reaction; SD-G: glucose starvation medium; SD-N: nitrogen starvation medium; TOR: target of rapamycin kinase; YGRC: yeast genetic resource center; YPD: yeast extract peptone dextrose
KEYWORDS: Autophagy, auxin-inducible degron system, conditional degradation library, essential genes, yeast
Introduction
Autophagy is a highly conserved metabolic process in eukaryotic cells that relies on vacuoles or lysosomes to respond to stress from internal or external environmental changes, such as starvation, organelle damage, pathogen invasion, and protein aggregation. This process is crucial for cellular self-protection and maintaining homeostasis [1]. Increasing evidence has linked autophagy dysfunction to major human diseases, including neurodegenerative disorders, metabolic diseases, and cancer [2–4]. Therefore, identifying autophagy-regulating genes and understanding their molecular mechanisms could provide new targets and strategies for the prevention and treatment of diseases caused by autophagy defects.
Although the phenomenon of autophagy was first discovered in mammalian cells, research on its molecular regulatory mechanisms began with genetic studies in Saccharomyces cerevisiae [1]. To date, over 40 ATG genes have been identified as involved in different types of autophagy in yeast [1,5]. These genes include core ATG genes and non-core ATG genes [1]. Core ATG genes encoding proteins essential for all types of autophagy, include the Atg1 kinase complex, Atg9 and its cycling system, phosphatidylinositol 3-kinase complex I, and two ubiquitin-like protein conjugation systems [1]. For instance, Atg9-containing vesicles provide the membrane source for autophagosome formation [6], while Atg14 is responsible for recruiting phosphatidylinositol 3-kinase complex I to the phagophore assembly site (PAS) [7]. Non-core ATG genes encoding proteins that, although not essential for all types of autophagy, regulate specific types of selective autophagy. Examples include the receptor Atg32 [8,9], which regulates mitophagy, and Atg39 and Atg40, which regulate reticulophagy [10].
With the commercialization of the yeast non-essential gene knockout library, many more non-essential genes have been identified to participate in various types of autophagy. However, about 20% of essential genes in budding yeast, approximately 1100 genes, cannot be further studied through knockout due to lethality, hindering systematic research on their roles in autophagy [11]. Using temperature-sensitive yeast strains, researchers have identified several essential genes involved in the regulation of autophagy. For example, Ypt1 is crucial for recruiting the Atg1 kinase to the PAS during nitrogen starvation [12], Trs20 facilitates the trafficking of Atg proteins from the Golgi to the PAS [13], and the exocytic Q/t-SNARE proteins Sso1, Sso2 and Sec9 are critical for organizing Atg9 into tubulovesicular clusters [14]. Recently, Ykt6 has been identified as the autophagosomal SNARE essential for the fusion of autophagosomes with vacuoles [15,16]. However, only 499 essential genes have available temperature-sensitive yeast strains [17], leaving more than half without corresponding strains. Additionally, growth at 37°C can induce heat shock stress responses in these temperature-sensitive strains, potentially affecting the accuracy or completeness of phenotypic analysis regarding their essential biological functions. The DAmP (Decreased Abundance by mRNA Perturbation) library has also been used to study the biological functions of essential genes [18]. The DAmP collection contains 842 essential genes, each with its 3′ untranslated region/UTR disrupted by an antibiotic resistance cassette, leading to transcript destabilization. However, this method has several limitations: 1) Phenotypic variability: Because the DAmP library only partially reduces gene expression, different genes or experimental conditions may lead to diverse or unstable phenotypic effects, complicating the interpretation of results. 2) Residual gene function: Although gene expression is reduced, the remaining gene product might still be sufficient to maintain certain cellular functions, preventing the observation of expected phenotypic effects. Furthermore, unlike temperature-sensitive (ts) mutants or the auxin-inducible degron (AID) system, the DAmP method cannot rapidly and reversibly regulate target protein activity or expression. The AID system has been reported as a powerful tool for controlled protein degradation in eukaryotic cells, particularly in yeast [19]. This system consists of three main components: the AID tag, OsTIR1, and an E3 ubiquitin ligase. The protein of interest is tagged with the AID tag, and OsTIR1, an auxin receptor from Arabidopsis thaliana, recognizes this tag. Upon auxin addition, OsTIR1 binds to the AID-tagged protein and recruits an E3 ubiquitin ligase complex, leading to the ubiquitination of the AID-tagged protein, marking it for degradation by the proteasome [19]. Thus, the AID system enables rapid and reversible control of protein levels using the plant hormone auxin. To systematically study the biological functions of essential genes at normal yeast cell culture temperatures, we established a yeast essential proteins conditional degradation library using the AID system.
In this study, we established a conditional protein degradation library containing 954 essential genes using the AID system. This is the largest known yeast essential gene knockdown library. Utilizing this library, we assessed which essential genes are involved in autophagy and identified 29 genes involved in nitrogen starvation-induced autophagy. These genes include previously reported essential genes for autophagy as well as newly identified candidates. Our work provides a valuable resource for systematically elucidating the roles of essential yeast genes in autophagy and other biological functions.
Results
Construction of a yeast strain expressing Tir1–9XMYC protein
A degron system based on auxin for the rapid degradation of target proteins has been reported in yeast [19]. To construct an IAA-induced yeast essential protein conditional degradation library, we needed to express the Tir1–9×MYC protein in the BY4741 yeast strain background. For this purpose, we obtained the pNHK53 plasmid (NBRP ID: BYP6744) from the Yeast Genetic Resource Center (YGRC) in Japan [19]. To integrate the OsTIR1–9×MYC fragment into the yeast genome, we constructed a pFA6a-His3MX6-ProADH1-OsTIR1–9×MYC plasmid, which used for homologous recombination (Fig. S1A and Table S1). Subsequently, we used a homologous recombination method to replace the open reading frame (ORF) sequences of the yeast gene TRP1 with the His3MX6-ProADH1- OsTIR1–9×MYC fragment (Figure 1A). Genomic extraction and PCR analysis confirmed the successful integration of the His3MX6-ProADH1-OsTIR1–9×MYC fragment into the genome (Figure 1B) [20]. Western blot analysis detected the expression of the Tir1–9×MYC protein in the BY4741 yeast cells (Figure 1C). To determine whether the expression of the Tir1–9×MYC protein affects cellular growth, we performed a spotting assay and found that yeast cells expressing OsTIR1–9×MYC exhibited no difference in growth compared to the wild-type BY4741 on YPD plates, regardless of the presence of IAA, indicating that the expression of OsTIR1–9×MYC does not affect cell growth (Figure 1D).
Figure 1.

Construction of yeast strain expressing OsTIR1–9×MYC protein. (A) Schematic diagram of integrating the His3MX6-ProADH1-OsTIR1–9XMYC fragment into the genome of wild-type yeast cells. (B) PCR amplification to detect whether the His3MX6-ProADH1-OsTIR1–9XMYC fragment has replaced the ORF of TRP1. (C) Wild-type (BY4741) or yeast cells expressing OsTIR1–9XMYC were treated with or without 0.5 mm IAA for 2 h, the expression levels of OsTIR1–9XMYC protein were detected by using anti-myc antibody. Pgk1 served as a loading control. (D) Serial dilutions of wild-type (BY4741), OsTIR1–9XMYC yeast strains were plated in 3-fold serial dilution onto YPD plates with or without IAA. The plates were incubated at 30°C for 36 h, and spotting assays were performed to assess the growth phenotypes. (E) Wild-type, atg1∆, or OsTIR1–9XMYC yeast strains co-expressing GFP-Atg8 and Vph1-mCherry were treated with 0.5 mm IAA or left untreated for 2 h. Subsequently, the cells were subjected to nitrogen starvation in the presence or absence of IAA for 4 h. Images of the cells were captured using an inverted fluorescence microscope. Scale bar: 2 µm. (F) Cells from (E) were assessed for the translocation of GFP-Atg8 into vacuoles. n = 300 cells were pooled from three independent experiments. Data are presented as mean ± SD. ***p < 0.001; ns, no significance; two-tailed Student’s t tests were used. (G) Wild-type, atg1∆, or OsTIR1–9XMYC yeast strains co-expressing GFP-Atg8 and Vph1-mCherry were treated with 0.5 mm IAA or left untreated for 2 h. Subsequently, the cells were subjected to nitrogen starvation in the presence or absence of IAA for 4 h. The samples were analyzed by western blot for the cleavage of GFP-Atg8. Pgk1 served as a loading control. (H) the cleavage of GFP-Atg8 from (G) were quantified and presented as mean ± SD (n = 3). ***p < 0.001; NS, no significance; two-tailed Student’s t tests were used. (I) ALP activity was measured in wild-type, atg1∆, and OsTIR1–9×MYC cells at the indicated time points under SD-N conditions, with or without IAA treatment, based on data from three independent experiments (n = 3). Error bars represent standard deviation (SD). ***p < 0.001; ns: not significant; two-tailed Student’s t-tests were used.
Because the constructed yeast essential protein conditional degradation library will be used to detect autophagic activity under IAA treatment, we next sought to determine whether the expression of OsTIR1–9×MYC affects autophagy in yeast cells. To this end, we introduced plasmids co-expressing GFP-Atg8 and Vph1-mCherry into this yeast strain [21]. Fluorescence microscopy and statistical analysis showed that, compared to the wild-type BY4741, yeast cells expressing the OsTIR1–9×MYC protein did not exhibit any changes in the vacuolar localization of GFP-Atg8 under nitrogen starvation conditions, regardless of IAA treatment (Figure 1E, F). Consistently, GFP-Atg8 cleavage analysis indicated that the expression of the OsTIR1–9×MYC protein did not affect the generation of free GFP protein upon nitrogen starvation (Figure 1G, H). Furthermore, alkaline phosphatase (ALP) assays [22] confirmed that, compared to wild-type cells, the yeast strain expressing OsTIR1–9×MYC does not impair ALP activity under starvation conditions, whether or not IAA treatment (Figure 1I). Collectively, these results suggest that the expression of the OsTIR1–9×MYC protein in yeast cells does not affect cell growth or autophagic activity, regardless of the presence of IAA.
Establishment of a yeast essential protein conditional degradation library
In Saccharomyces cerevisiae, there are 1101 essential genes [17]. To construct an IAA-induced essential protein conditional degradation library, we needed to integrate the AID fragment at the C terminus of essential genes in yeast cells expressing the OsTIR1–9×MYC protein. For this purpose, we obtained the pSM409 plasmid (NBRP ID: BYP6851), which contains the mini-AID DNA sequence, from the Yeast Genetic Resource Center (YGRC) in Japan [23]. To facilitate the subsequent detection of expression levels of these essential proteins with the AID fragment under IAA induction, we PCR-amplified the AID fragment and inserted it in front of the 6×HA tag in the pYM16 plasmid [24] and then constructed a plasmid with the URA3 selection marker that can insert the AID-6×HA tag at the C terminus of target genes for homologous recombination in yeast (Fig. S1B and Table S2).
To validate the effectiveness of this homologous recombination plasmid, we randomly selected two essential yeast genes, KAP95 and CEP3, for testing. Using this plasmid as the template, we designed corresponding homologous recombination primers. Through PCR amplification and yeast transformation, we integrated the AID-6×HA-URA3 homologous recombination fragment at the C terminus of the KAP95 or CEP3 genes in a yeast strain expressing the OsTIR1–9×MYC protein (Figure 2A). We then screened transformants on SD-His-Ura solid plates. By extracting yeast genomic DNA and performing PCR amplification analysis, we successfully identified yeast strains expressing the Kap95-AID-6×HA or Cep3-AID-6×HA proteins (Figure 2B). Next, we tested the degradation of the Kap95 and Cep3 fusion proteins upon IAA treatment in these yeast strains. Western blot results indicated that 2 h after IAA treatment, the Kap95-AID-6×HA or Cep3-AID-6×HA proteins were almost completely degraded (Figure 2C, D). A spotting assay further showed that yeast cells expressing Kap95-AID-6×HA or Cep3-AID-6×HA hardly grew on YPD solid plates containing IAA, while their growth phenotype on YPD solid plates was similar to that of wild-type BY4741 and yeast strain expressing the OsTIR1–9×MYC protein (Figure 2E). Taken together, these results demonstrate that our constructed IAA-induced essential protein conditional degradation yeast strains are effective.
Figure 2.

Construction of iaa-mediated yeast essential protein conditional degradation library. (A) a schematic diagram showing the integration of the mini-AID-6×HA-URA3 fragment into the C-terminus of the target gene. (B) PCR amplification to detect whether the mini-AID-6×HA-URA3 fragment has integrated the C-terminus of CEP3 or KAP95. (C and D) yeast cells expressing Cep3-mini-AID-6×HA(Cep3-mAID-ha) or Kap95-mini-AID-6×HA(Kap95-mAID-ha) was treated with 0.5 mm IAA for 0 h, 1 h, or 2 h. The expression levels of the proteins were detected using an Anti-ha antibody, with Pgk1 serving as a loading control. (E) Serial dilutions of wild-type (BY4741), OsTIR1–9XMYC, CEP3-mAID-HA, or KAP95-mAID-ha yeast strains were plated in 3-fold serial dilution onto YPD plates with or without IAA. The plates were incubated at 30°C for 36 h, and spotting assays were performed to assess the growth phenotypes. (F) Serial dilutions of wild-type (BY4741), OsTIR1–9XMYC, or the indicated yeast strains were plated in 3-fold serial dilution onto YPD plates with or without IAA. The plates were incubated at 30°C for 36 h, and spotting assays were performed to assess the growth phenotypes. (G) Based on the growth phenotypes of yeast strains from (F), they were classified into four categories: Severe, Influential, Normal, and Constitutive slow growth. The proportion of each growth phenotype was then calculated relative to the total number of strains in the library.
We then employed this strategy to design homologous recombination primers for all essential yeast genes. Through PCR amplification of homologous recombination fragments, subsequent yeast transformation, and screening of transformants on SD-His-Ura solid plates, followed by PCR verification and western blot analysis, we successfully incorporated the mAID-6×HA fragment at the C terminus of 906 essential genes. Through spotting assay, we categorized the growth phenotypes of these yeast strains into four types: 1. Severe: Growth on YPD plates was unaffected, but growth on YPD plates containing IAA was severely impaired or absent. This phenotype was observed in 321 of the 906 strains. 2. Influential: Growth on YPD plates was unaffected, but growth on YPD plates containing IAA was impaired. This phenotype was observed in 124 of the 906 strains. 3. Normal: Growth on YPD plates was unaffected, and growth on YPD plates containing IAA was also unaffected or slightly impaired. This phenotype was observed in 328 of the 906 strains. 4. Constitutive slow growth (CSG): Growth on both YPD plates and YPD plates containing IAA was severely inhibited (Figure 2F). This phenotype was observed in 133 of the 906 strains. Overall, we observed that 578 essential protein conditional degradation yeast strains exhibited significant impaired growth under IAA treatment conditions (Figure 2G and Data S1).
To determine whether protein degradation is indeed induced in these strains without growth defects, we randomly selected 24 yeast strains from this group. The results showed that most AID-tagged yeast strains exhibited protein degradation upon IAA treatment, while a few strains did not display notable degradation (Fig. S2). These findings suggest that although the AID-tagged essential proteins are largely degraded to varying extents, the level of IAA-induced protein degradation is insufficient to impair the function of the essential genes in regulating cell growth.
Screening yeast essential genes involved in autophagy
Next, we aimed to investigate which essential genes in yeast cells regulate nitrogen starvation-induced autophagy. To achieve this, we first needed to introduce the GFP-Atg8 plasmid into these yeast strains. Through yeast transformation, we obtained a yeast essential protein conditional degradation library containing the GFP-Atg8 plasmid. Subsequently, we treated these yeast cells, grown to the early logarithmic phase, with IAA for 2 h to induce degradation of essential proteins, and stained the cells with FM 4–64 to label the yeast vacuolar membrane [25]. After the 2 h IAA treatment, these yeast strains underwent 4 h of nitrogen starvation in SD-N+IAA medium. Subsequently, we examined the vacuolar localization of GFP-Atg8 using fluorescence microscopy (Figure 3A). By analyzing whether GFP-Atg8 localized to the vacuole, we found that IAA treatment impaired nitrogen starvation-induced autophagy in 25 yeast strains, among which the autophagic activity in 22 yeast strains was almost completely inhibited under IAA treatment (Figure 3B and Fig. S3).
Figure 3.

Identification of essential yeast genes involved in nitrogen starvation-induced autophagy. (A) a schematic diagram showing the process of identification of essential yeast genes involved in nitrogen starvation-induced autophagy. (B) Wild-type, atg1∆, or AID tag conditional degradation strains expressing GFP-Atg8 were treated with 0.5 mm IAA for 2 h. Subsequently, cells were subjected to nitrogen starvation in the presence of IAA for 4 h. Images of the cells were captured using an inverted fluorescence microscope. A total of 300 cells were assessed for GFP-Atg8 translocation into vacuoles. Screening identified essential genes that partially affect nitrogen starvation-induced autophagy and genes that completely inhibit it. (C) Conduct a biological functional classification of the essential genes identified as involved in nitrogen starvation-induced autophagy.
Subsequently, we conducted a functional classification of essential genes that regulate nitrogen starvation-induced autophagy. Our findings indicate their involvement in processes such as exocytosis, mRNA splicing, RNA transcription, vesicle-mediated transport, and maintenance of actin cytoskeleton polarity. Notably, some of these genes, such as TRS20, TRS23, SEC24, EXO84, and TIP20, were previously identified in temperature-sensitive yeast strains as contributors to nitrogen starvation-induced autophagy [13,26–30], validating our screening method’s reliability. Additionally, we identified up to 17 essential genes that had not been previously recognized, including the TOR complex subunit LST8 [31], the inorganic pyrophosphatase IPP1 [32], and the ribosome biogenesis factor RPF1 [33] (Figure 3C).
Next, we observed which step of autophagy these essential genes are likely affected. By counting the number of GFP-Atg8 puncta in cells and examining vacuole morphology, our findings indicate that while these genes had minimal impact on vacuole morphology (Figure 4A), they significantly inhibited the vacuolar localization of GFP-Atg8 (Fig. S3). Furthermore, in yeast strains expressing AID-tagged Taf5, Fcf2, Ipp1, Taf10, and Trs20, treatment with IAA markedly suppressed the formation of GFP-Atg8 puncta (Figure 4B), suggesting that these genes may be directly or indirectly involved in Atg8 lipidation. In contrast, in yeast strains with AID-tagged Gdi1, Rpf1, Sec18, and Tip20, IAA treatment resulted in the appearance of multiple GFP-Atg8 puncta within the cells (Figure 4B), indicating that these genes may be involved in the fusion of autophagosomes and vacuoles. Our next steps will delve deeper into the specific molecular mechanisms by which these genes influence autophagy.
Figure 4.

Analysis of GFP-Atg8 puncta distribution in the indicated yeast strains under nitrogen starvation conditions. (A) Wild-type (WT, BY4741), atg1Δ, and the indicated yeast strains expressing GFP-Atg8 were treated with 0.5 mm IAA for 2 h. Following this, the cells were subjected to nitrogen starvation in the presence of IAA for 4 h. Images were captured using an inverted fluorescence microscope, with FM 4–64 used to stain the vacuolar membrane. The mAID tag refers to mini-AID-6×HA. Scale bar: 2 µm. (B) the number of GFP-Atg8 puncta per cell from (A) was quantified, with n = 300 cells pooled from three independent experiments.
The identified essential genes are required for glucose starvation and DNA damage-induced autophagy
Based on the above imaging results, we need to further verify the effects of these genes on autophagy using biochemical method. First, we performed a spotting assay to assess their growth on YPD solid plates with or without IAA. We found that, except for SEC18, PFY1, SPC34, TAF10, CSE4, and DIB1, most essential genes showed no significant differences in growth compared to the wild-type BY4741 on YPD solid plates without IAA. This indicates that adding the mAID-6×HA tag to the C-terminus of most genes did not affect their ability to maintain cell growth. However, the growth of most essential genes was severely or completely inhibited on YPD with IAA solid plates. Only the yeast strains expressing Trs31-mAID-6×HA and Cbf2-mAID-6×HA showed no or only slight growth inhibition (Fig. S4A). Consistent with the growth phenotypes, IAA-induced protein degradation assays indicated that the expression levels of Trs31-mAID-6×HA and Cbf2-mAID-6×HA proteins did not significantly decrease after adding IAA (Fig. S4B). We subsequently examined the effects of these 25 essential genes on nitrogen starvation-induced autophagy under IAA treatment using the GFP-Atg8 cleavage assay. In line with microscopy observations, the conditional degradation of these essential proteins under IAA treatment significantly impaired the generation of free GFP under nitrogen starvation (Fig. S5A). This further confirmed the involvement of these essential genes in nitrogen starvation-induced autophagy. Overall, these results indicate that even yeast strains that show no or only slight growth inhibition on YPD solid plates containing IAA can still impair autophagic activity.
Given that various stimuli can induce autophagy [34], we aimed to investigate whether these essential genes are also involved in autophagy under such conditions. In Saccharomyces cerevisiae, both glucose starvation and DNA damage trigger autophagy [35,36]. Therefore, we examined whether these genes play a role in autophagy induced by these types of stress. The GFP-Atg8 cleavage assays were subsequently conducted and we found that these genes are crucially involved in autophagy induced by glucose starvation or DNA damage (Figure 5). Interestingly, we observed that PFY1, a gene encoding the protein Profilin [37], significantly inhibited autophagy induced by nitrogen and glucose starvation when its protein was degraded, but appeared to have little effect on DNA damage-induced autophagy (Figure 5B), suggesting that DNA damage-induced autophagy may have its own unique molecular regulatory mechanisms. Overall, these data indicate that the identified essential genes involved in nitrogen starvation-induced autophagy are also required for glucose starvation and DNA damage-induced autophagy.
Figure 5.

Identification of essential yeast genes involved in nitrogen starvation-induced autophagy. (A) Wild-type, atg1∆, or the indicated yeast strains expressing GFP-Atg8 were treated with or without 0.5 mm IAA for 2 h. Subsequently, cells were subjected to glucose starvation in the presence or absence of IAA for 4 h. The samples were analyzed by western blot for the cleavage of GFP-Atg8. Pgk1 served as a loading control. The data are representative of three independent experiments. The mAID tag refers to mini-AID-6×HA. (B) Wild-type, atg1∆, or the indicated yeast strains expressing GFP-Atg8 were treated with or without 0.5 mm IAA for 2 h. Subsequently, cells were treated with 0.04% MMS in the presence or absence of IAA for 6 h. The samples were analyzed by western blot for the cleavage of GFP-Atg8. Pgk1 served as a loading control. The data are representative of three independent experiments. The mAID tag refers to mini-AID-6×HA.
Construction of IAA-Mediated conditional degradation strains with N-Terminal AID tag fusion
During the construction of strains with an AID tag at the C-terminus of the target gene, we observed that 133 yeast strains exhibited constitutive slow growth, and approximately 200 strains could not be obtained. Since placing the AID tag at the C terminus best preserves the gene’s transcriptional consistency with the wild type, we opted for C-terminal tagging. However, we also recognized that certain genes are unsuitable for C-terminal tagging as it can affect their cellular localization or function. For example, studies show that C-terminal tagging of the essential gene YPT1 disrupts its membrane anchoring, requiring the tag to be placed at the N terminus instead [38]. Therefore, we reviewed the relevant literature and found that tagging the N terminus of proteins encoded by 48 essential yeast genes is generally more functionally favorable (Data S1). Based on this finding, we added the 6×HA-mini-AID tag to the N-terminus of these proteins (Figure 6A-E, Fig. S5B, and Table S3).
Figure 6.

Construction of iaa-mediated yeast essential protein conditional degradation strain with N-terminal fusion AID tag. (A) a schematic diagram showing the integration of the ProCYC1-6×HA-mini-AID fragment into the N terminus of the target gene. (B) PCR amplification to examine whether the ProCYC1-6×HA-mini-AID fragment has integrated the N-terminus of YPT1 or RPC17. (C and D) yeast cells expressing 6×HA-mini-AID-Ypt1(HA-mAID-Ypt1) (C) or 6×HA-mini-AID-Rpc17(HA-mAID-Rpc17) (D) was treated with 0.5 mm IAA for 0 h, 1 h, or 2 h. The expression levels of the proteins were detected using an anti-ha antibody, with Pgk1 serving as a loading control. (E) Serial dilutions of wild-type (BY4741), OsTIR1–9XMYC, HA-mAID-YPT1, or HAha-mAID-RPC17 yeast strains were plated in 3-fold serial dilution onto YPD plates with or without IAA. The plates were incubated at 30°C for 36 h, and spotting assays were performed to assess the growth phenotypes. (F) Serial dilutions of wild-type (BY4741), OsTIR1–9XMYC, or the indicated yeast strains were plated in 3-fold serial dilution onto YPD plates with or without IAA. The plates were incubated at 30°C for 36 h, and spotting assays were performed to assess the growth phenotypes. (G) Based on the growth phenotypes of yeast strains shown in (F), they were classified into four categories: Severe, Influential, Normal, and Constitutive slow growth, and the number of yeast strains in each growth phenotype category was counted.
Spotting assays revealed distinct growth phenotypes among these 48 yeast strains: 20 strains exhibited an “influential” growth phenotype, 14 strains showed a “severe” phenotype, 6 strains displayed a “normal” phenotype, and 8 strains exhibited a “constitutive slow growth” phenotype (Figure 6F, G). Notably, 6 essential gene strains with a “constitutive slow growth” phenotype (YPT1, YKT6, SFT1, MEC1, MCM1, and CDC4) were not included in the C-terminal tagging library, while NOB1 and TOA2 exhibited a “constitutive slow growth” phenotype in the C-terminal tagging library as well (Data S1).
We then introduced GFP-Atg8 and Vph1-mCherry plasmids into these 48 yeast strains. Imaging data and GFP-Atg8 cleavage assays demonstrated that IAA-mediated degradation of Cse4, Rpa135, Rpl18A, Ypt1, or Ykt6 almost completely inhibited GFP-Atg8 vacuolar localization and cleavage under nitrogen starvation (Fig. S6A-D), indicating that these genes are required for nitrogen starvation-induced autophagy. Among them, CSE4 had already been identified in the C-terminal tagging library as crucial for autophagy, and YPT1 and YKT6 have been previously reported as being required for autophagy [12,15,16]. Based on these findings, we newly identified RPA135 (RNA polymerase I second largest subunit) and RPL18A (Ribosomal 60S subunit protein L18A) as essential genes involved in nitrogen starvation-induced autophagy. Furthermore, we demonstrated that these five essential genes are also required for autophagy induced by glucose starvation and DNA damage (Fig. S6E, 6F). Collectively, these results show the essential roles of these five genes in autophagy across different induction conditions.
Discussion
In this study, we utilized a degron system to construct an IAA-induced yeast essential protein conditional degradation library (Data S1). These resulting strains were categorized into four phenotypes based on their growth on YPD solid plates with or without IAA: “Severe,” “Influential,” “Normal,” and “Constitutive slow growth.” To investigate essential genes involves in nitrogen starvation-induced autophagy, we introduced a GFP-Atg8 plasmid into these strains and used fluorescence microscopy to observe the cellular localization of GFP-Atg8 under IAA treatment. Through this approach, we identified 29 essential genes that regulate nitrogen starvation-induced autophagy, including both previously reported and newly identified genes.
Our findings suggest that essential genes regulating nitrogen starvation-induced autophagy also contribute to autophagy induced by glucose starvation and DNA damage, suggesting shared regulatory mechanisms across different autophagy-inducing conditions. However, we observed that PFY1 had only a minimal impact on DNA damage-induced autophagy, implying that unique pathways may be involved in the molecular regulation of autophagy under DNA damage. In future studies, we aim to identify essential genes that specifically regulate autophagy in response to glucose starvation or DNA damage.
For essential genes whose growth was unaffected by IAA treatment, we deduced that the degradation of their fusion proteins was insufficient to disrupt their roles in cell growth regulation. Notably, despite the presence of the AID tag on TRS31 and CBF2, these proteins did not degrade significantly following IAA treatment and had no noticeable impact on yeast cell growth. However, they strongly inhibited autophagy induced by nitrogen starvation, glucose starvation, and DNA damage, highlighting their critical roles in autophagy. Additionally, while many essential genes are involved in ribosome biogenesis, we identified RPF1 and RPL18A as participants in autophagy. This finding suggests that these genes play a dual role in ribosome biogenesis and autophagy through a specific mechanism.
Throughout the study, we meticulously monitored the transformation efficiency of AID strains. If the efficiency was low, resulting in fewer than ten single colonies on the plate, the transformation was repeated. In practice, nearly all yeast strains with the AID tag exhibited relatively high transformation efficiency, allowing us to obtain at least three verified strains with consistent growth phenotypes. Although we have not performed whole-genome sequencing on the 133 constitutively slow-growing strains, the likelihood of other mutations is low. However, we cannot entirely rule out the possibility of unidentified suppressor mutations in addition to the expected AID knock-in.
We successfully constructed 954 yeast strains for AID-mediated degradation of essential proteins. This library consists of 906 strains with AID tags added to the C-terminus of essential genes and 48 strains with AID tags at the N-terminus (Data S1). Despite this extensive collection, we are not yet able to fully investigate the functions of all essential genes. To address this limitation, we plan to combine the AID library with the yeast temperature-sensitive mutant library and/or the DAmP library to study the autophagic and other biological functions of essential genes. By comparing the AID and temperature-sensitive libraries, we identified 123 genes present in the temperature-sensitive library but absent from the AID library (Fig. S6G). This combined approach will enable us to investigate autophagy and biological roles of nearly 95% of essential genes.
In summary, we successfully established an IAA-induced yeast essential protein conditional degradation library and identified multiple previously unrecognized essential genes involved in autophagy. This work provides a valuable platform for further elucidating the biological functions of essential genes and advancing our understanding of autophagy.
Materials and methods
Yeast strains, plasmids, and growth conditions
All yeast strains used in this study are listed in Table S4 and were sequenced by Tsingke Biotechnology, Beijing. The wild type (BY4741) and atg1∆ yeast strains were purchased from Invitrogen (95401.H2). The IAA-induced yeast essential protein degradation strains were verified by polymerase chain reaction (PCR; Vazyme, P505-d1) or western blot analysis using the anti-HA antibody. Yeast cells were cultured at 30°C in synthetic medium (SD; 0.17% yeast nitrogen base without amino acids and ammonium sulfate, 0.5% ammonium sulfate, 2% glucose, and corresponding auxotrophic amino acids and vitamins). For autophagy induction, cells were grown to early-log phase and then treated with nitrogen starvation (SD−N; 0.17% yeast nitrogen base without amino acids and ammonium sulfate, 2% glucose), glucose starvation (SD-G; 0.17% yeast nitrogen base without amino acids and ammonium sulfate, 0.5% ammonium sulfate, 0.5% casamino acid), or 0.04% MMS (Sigma-Aldrich 129,925) treatment for the corresponding time points.
Construction of pFA6a-His3MX6-ProADH1-OsTIR1–9×MYC plasmid (pYC01)
The ADH1 promoter and the OsTIR1–9×MYC DNA sequence were amplified by PCR from the pNHK53 plasmid, and then used to replace the GAL1 promoter and the 3×HA DNA sequence in the pFA6a-His3MX6-ProGAL1-3×HA plasmid [39]. This resulted in the pFA6a-His3MX6-ProADH1-OsTIR1–9×MYC plasmid, which was used for homologous recombination.
Construction of pFa6a-mini-AID-6XHA-URA3 plasmid (pYC02)
The mini-AID fragment was amplified by PCR and inserted it in front of the 6×HA tag in the pYM16 plasmid [23,24]. The modification allows for the detection of target protein expression levels via an anti-HA antibody. To make the constructed essential protein conditional degradation library more cost-effective and practical, the hphNT1 selection marker in the pYM16 plasmid was replaced with the URA3 selection marker. Finally, a plasmid with the URA3 selection marker that can insert the AID-6×HA tag at the C-terminus of target genes was constructed for homologous recombination in yeast.
Construction of pFA6a-natNT2-ProCYC1-6×HA-mini-AID plasmid (pYC03)
The mini-AID fragment was amplified by PCR and inserted downstream of the 6×HA tag in the pYM-N12 plasmid [23,24], which contains a CYC1 promoter. The modification allows for the detection of target protein expression levels via an anti-HA antibody. Finally, a plasmid with the natNT2 selection marker that can insert the ProCYC1-6×HA-mini-AID tag at the N terminus of target genes was constructed for homologous recombination in yeast.
Antibodies
Antibodies used in this study were as follows: anti-Pgk1 (Nordic Immunology, NE130/7S; 1:10000), anti-MYC (Vazyme, RA1005–01; 1:3000), anti-HA (Abmart, M20003L; 1:3000), anti-GFP (Roche 11,814,460,001; 1:2500), goat anti-mouse IgG1, human ads-HRP (SouthernBiotech, 1070–05; 1:10000); and goat anti-rabbit, human ads-HRP (SouthernBiotech, 4010–05; 1:10000).
Primers
The test primers from Figure 1B are as follows: Upper primer: CCAATCAGTAAAAATCAACGGTT, Lower primer: GTATTTATATACTAAGCTGCCGG. CEP3 test primers are as follows: Upper primer: CGGTTCAAAACTAGATAAACTAG, Lower primer: CATCTGATGCATCGTTGTCAG; KAP95 test primers are as follows: Upper primer: GTATCATGTTAAACGAGTATAGAA, Lower primer: AGAGAGAATTGA. YPT1 test primers are as follows: Upper primer: GCTGCTATGTCACTCCAATTG, Lower primer: CACGCCGTTGAAGGATTCTTG; RPC17 test primers are as follows: Upper primer: GCTGCAAGGTTGAAAGATAATTA, Lower primer: TCATCAACTCAGCAAAGCTTTC.
Auxin treatment and ALP assays
Yeast strains co-expressing OsTIR1–9XMYC with Cep3-mini-AID-6XHA or Kap95-mini-AID-6XHA were grown to the early logarithmic phase, and then subjected to 0.5 mm IAA (indole-3-acetic acid; Sigma, I2886) treatment for 2 h. The expression level of these proteins was detected by the anti-HA antibody. The ALP assay was performed as described previously [40].
Imaging and western blots
Imaging, yeast protein extraction, and western blotting followed previously established protocols [21,39]. Yeast strains engineered for IAA-mediated essential protein degradation and expressing the GFP-Atg8 plasmid were cultured to an OD600 of 0.6 ~ 0.8. They were then treated with 0.5 mm IAA for 2 h. Following IAA treatment, cells were subjected to nitrogen starvation, glucose starvation, or MMS, with IAA remaining in the medium throughout. After the specific treatments, 200 µL of the yeast culture was transferred to an eight-chambered cover glass (Thermo Fisher 155,411). Following cell settlement, fluorescence microscopy was conducted at room temperature using an inverted fluorescence microscope (IX83; Olympus) fitted with a U Plan Super Apochromat 100×/1.4 oil objective (Olympus). Images were captured with the microscope systems and subsequently processed and analyzed using ImageJ software.
Spotting assay
IAA-induced yeast essential protein degradation strains were grown overnight in 3 mL SD-His-Ura liquid medium at 30°C. We then measured the OD600 and prepared a dilution with sterile H2O to achieve OD600 = 1 (total volume 1 ml). Next, we made serial dilutions of 10°, 10−1, 10−2, and 10−3, and dropped 3 μl of each dilution onto YPD plates with or without IAA. The plates were incubated at 30°C for the indicated timepoints.
Quantification and statistical analysis
Quantification of fluorescence microscopy and immunoblotting data were conducted using ImageJ software. For all quantitative analyses, the mean values are displayed with standard deviation (s.d.) as error bars. Detailed statistical analyses and the number of independent experiments are provided in each figure legend. Statistical tests were executed in GraphPad Prism, utilizing an unpaired two-tailed t test. Significance levels were determined based on the specified p values.
Supplementary Material
Funding Statement
We are grateful to Prof. Du Feng (Guangzhou Medical University) and Prof. Rong Liu (China Agricultural University) for their valuable feedback and discussions on this manuscript. We also thank Dr. Cheng Ma from the Core Facilities at Zhejiang University School of Medicine for their technical support. This research was supported by the National Natural Science Foundation of China [grants 32070739, 32122028, and 92254307] and Zhejiang Provincial Natural Science Foundation of China under Grant No. [LRG25C070001] to Cong Yi, and by the National Natural Science Foundation of China [grant 32100600] to Weijing Yao. Additionally, the National Key Research and Development Program of China [Grant 2021YFC2600104] provided support to Liqin Zhang, and Zhejiang Province Natural Science Funds Grant [No. LTGD23H090006] to Xiankuan Xie.
Disclosure statement
No potential conflict of interest was reported by the author(s).
Supplementary material
Supplemental data for this article can be accessed online at https://doi.org/10.1080/15548627.2025.2469189
References
- [1].Ohsumi Y. Historical landmarks of autophagy research. Cell Res. 2014;24(1):9–23. doi: 10.1038/cr.2013.169 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [2].Yamamoto H, Zhang S, Mizushima N. Autophagy genes in biology and disease. Nat Rev Genet. 2023;24(6):382–400. doi: 10.1038/s41576-022-00562-w [DOI] [PMC free article] [PubMed] [Google Scholar]
- [3].Klionsky DJ, Petroni G, Amaravadi RK, et al. Autophagy in major human diseases. Embo J. 2021;40(19):e108863. doi: 10.15252/embj.2021108863 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [4].Choi AM, Ryter SW, Levine B. Autophagy in human health and disease. N Engl J Med. 2013;368(7):651–662. doi: 10.1056/NEJMra1205406 [DOI] [PubMed] [Google Scholar]
- [5].Isoda T, Takeda E, Hosokawa S, et al. Atg45 is an autophagy receptor for glycogen, a non-preferred cargo of bulk autophagy in yeast. iScience. 2024;27(6):109810. doi: 10.1016/j.isci.2024.109810 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [6].Yamamoto H, Kakuta S, Watanabe TM, et al. Atg9 vesicles are an important membrane source during early steps of autophagosome formation. J Cell Biol. 2012;198(2):219–233. doi: 10.1083/jcb.201202061 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [7].Obara K, Sekito T, Ohsumi Y. Assortment of phosphatidylinositol 3-Kinase complexes—Atg14p directs association of complex i to the pre-autophagosomal structure in Saccharomyces cerevisiae. Mol Biol Cell. 2006;17(4):1527–1539. doi: 10.1091/mbc.e05-09-0841 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [8].Okamoto K, Kondo-Okamoto N, Ohsumi Y. Mitochondria-anchored receptor Atg32 mediates degradation of mitochondria via selective autophagy. Dev Cell. 2009;17(1):87–97. doi: 10.1016/j.devcel.2009.06.013 [DOI] [PubMed] [Google Scholar]
- [9].Kanki T, Wang K, Cao Y, et al. Atg32 is a mitochondrial protein that confers selectivity during mitophagy. Dev Cell. 2009;17(1):98–109. doi: 10.1016/j.devcel.2009.06.014 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [10].Mochida K, Oikawa Y, Kimura Y, et al. Receptor-mediated selective autophagy degrades the endoplasmic reticulum and the nucleus. Nature. 2015;522(7556):359–362. doi: 10.1038/nature14506 [DOI] [PubMed] [Google Scholar]
- [11].Tong AH, Evangelista M, Parsons AB, et al. Systematic genetic analysis with ordered arrays of yeast deletion mutants. Science. 2001;294(5550):2364–2368. doi: 10.1126/science.1065810 [DOI] [PubMed] [Google Scholar]
- [12].Wang J, Menon S, Yamasaki A, et al. Ypt1 recruits the Atg1 kinase to the preautophagosomal structure. Proc Natl Acad Sci USA. 2013;110(24):9800–9805. doi: 10.1073/pnas.1302337110 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [13].Taussig D, Lipatova Z, Segev N. Trs20 is required for TRAPP III complex assembly at the PAS and its function in autophagy. Traffic. 2014;15(3):327–337. doi: 10.1111/tra.12145 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [14].Nair U, Jotwani A, Geng J, et al. SNARE proteins are required for macroautophagy. Cell. 2011;146(2):290–302. doi: 10.1016/j.cell.2011.06.022 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [15].Gao J, Reggiori F, Ungermann C. A novel in vitro assay reveals SNARE topology and the role of Ykt6 in autophagosome fusion with vacuoles. J Cell Biol. 2018;217(10):3670–3682. doi: 10.1083/jcb.201804039 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [16].Bas L, Papinski D, Licheva M, et al. Reconstitution reveals Ykt6 as the autophagosomal SNARE in autophagosome–vacuole fusion. J Cell Biol. 2018;217(10):3656–3669. doi: 10.1083/jcb.201804028 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [17].Li Z, Vizeacoumar FJ, Bahr S, et al. Systematic exploration of essential yeast gene function with temperature-sensitive mutants. Nat Biotechnol. 2011;29(4):361–367. doi: 10.1038/nbt.1832 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [18].Breslow DK, Cameron DM, Collins SR, et al. A comprehensive strategy enabling high-resolution functional analysis of the yeast genome. Nat Methods. 2008;5(8):711–718. doi: 10.1038/nmeth.1234 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [19].Nishimura K, Fukagawa T, Takisawa H, et al. An auxin-based degron system for the rapid depletion of proteins in nonplant cells. Nat Methods. 2009;6(12):917–922. doi: 10.1038/nmeth.1401 [DOI] [PubMed] [Google Scholar]
- [20].Looke M, Kristjuhan K, Kristjuhan A. Extraction of genomic DNA from yeasts for pcr-based applications. Biotechniques. 2011;50(5):325–328. doi: 10.2144/000113672 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [21].Yi C, Ma M, Ran L, et al. Function and molecular mechanism of acetylation in autophagy regulation. Science. 2012;336(6080):474–477. doi: 10.1126/science.1216990 [DOI] [PubMed] [Google Scholar]
- [22].Cheong H, Klionsky DJ. Biochemical methods to monitor autophagy-related processes in yeast. Autophagy Lower Eukaryotes Non-Mamm Syst Pt A. 2008;451:1–26. [DOI] [PubMed] [Google Scholar]
- [23].Yesbolatova A, Saito Y, Kitamoto N, et al. The auxin-inducible degron 2 technology provides sharp degradation control in yeast, mammalian cells, and mice. Nat Commun. 2020;11(1):5701. doi: 10.1038/s41467-020-19532-z [DOI] [PMC free article] [PubMed] [Google Scholar]
- [24].Janke C, Magiera MM, Rathfelder N, et al. A versatile toolbox for pcr-based tagging of yeast genes: new fluorescent proteins, more markers and promoter substitution cassettes. Yeast. 2004;21(11):947–962. doi: 10.1002/yea.1142 [DOI] [PubMed] [Google Scholar]
- [25].Ishii A, Kurokawa K, Hotta M, et al. Role of Atg8 in the regulation of vacuolar membrane invagination. Sci Rep. 2019;9(1):14828. doi: 10.1038/s41598-019-51254-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [26].Singh S, Kumari R, Chinchwadkar S, et al. ExocysT subcomplex functions in autophagosome biogenesis by regulating Atg9 trafficking. J Mol Biol. 2019;431(15):2821–2834. doi: 10.1016/j.jmb.2019.04.048 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [27].Chen L, Zhang C, Liang Y, et al. Autophagy requires Tip20 in Saccharomyces cerevisiae. J Biosci. 2019;44(1). doi: 10.1007/s12038-018-9839-1 [DOI] [PubMed] [Google Scholar]
- [28].Zou SS, Liu Y, Min GY, et al. Trs20, Trs23, Trs31 and Bet5 participate in autophagy through GTPase Ypt1 in Saccharomyces cerevisiae. Arch Biol Sci (Beogr). 2018;70(1):109–118. doi: 10.2298/ABS170408030Z [DOI] [Google Scholar]
- [29].Ishihara N, Hamasaki M, Yokota S, et al. Autophagosome requires specific early Sec proteins for its formation and NSF/SNARE for vacuolar fusion. Mol Biol Cell. 2001;12(11):3690–3702. doi: 10.1091/mbc.12.11.3690 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [30].Hamasaki M, Noda T, Ohsumi Y. The early secretory pathway contributes to autophagy in yeast. Cell Struct Funct. 2003;28(1):49–54. doi: 10.1247/csf.28.49 [DOI] [PubMed] [Google Scholar]
- [31].Loewith R, Jacinto E, Wullschleger S, et al. Two TOR complexes, only one of which is rapamycin sensitive, have distinct roles in cell growth control. Mol Cell. 2002;10(3):457–468. doi: 10.1016/S1097-2765(02)00636-6 [DOI] [PubMed] [Google Scholar]
- [32].Kolakowski LF, Schloesser M, Cooperman BS. Cloning, molecular characterization and chromosome localization of the inorganic pyrophosphatase (Ppa) gene from S-Cerevisiae. Nucleic Acids Res. 1988;16(22):10441–10452. doi: 10.1093/nar/16.22.10441 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [33].Wehner KA, Baserga SJ. The σ70-like Motif. Mol Cell. 2002;9(2):329–339. doi: 10.1016/S1097-2765(02)00438-0 [DOI] [PubMed] [Google Scholar]
- [34].Gomez-Virgilio L, Silva-Lucero MD, Flores-Morelos DS, et al. Autophagy: a key regulator of homeostasis and disease: an overview of molecular mechanisms and modulators. Cells. 2022;11(15):11. doi: 10.3390/cells11152262 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [35].Yao WJ, Li YX, Wu LM, et al. Atg11 is required for initiation of glucose starvation-induced autophagy. Autophagy. 2020;16(12):2206–2218. doi: 10.1080/15548627.2020.1719724 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [36].Eapen VV, Waterman DP, Bernard A, et al. A pathway of targeted autophagy is induced by DNA damage in budding yeast. Proc Natl Acad Sci U S A. 2017;114(7):E1158–E1167. doi: 10.1073/pnas.1614364114 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [37].Marcoux N, Cloutier S, Zakrzewska E, et al. Suppression of the profilin-deficient phenotype by the RHO2 signaling pathway in Saccharomyces cerevisiae. Genetics. 2000;156(2):579–592. doi: 10.1093/genetics/156.2.579 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [38].Thomas LL, Joiner AMN, Fromme JC. The TRAPPIII complex activates the GTPase Ypt1 (Rab1) in the secretory pathway. J Cell Biol. 2018;217(1):283–298. doi: 10.1083/jcb.201705214 [DOI] [PMC free article] [PubMed] [Google Scholar]
- [39].Longtine MS, Mckenzie Iii A, Demarini DJ, et al. Additional modules for versatile and economical pcr-based gene deletion and modification in Saccharomyces cerevisiae. Yeast. 1998;14(10):953–961. doi: 10.1002/(SICI)1097-0061(199807)14:10<953::AID-YEA293>3.0.CO;2-U [DOI] [PubMed] [Google Scholar]
- [40].Araki Y, Kira S, Noda T. Quantitative assay of macroautophagy using Pho8∆60 assay and GFP-Cleavage assay in yeast. Methods Enzymol. 2017;588:307–321. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
