Skip to main content
NCBI home page
Veterinary Medicine and Science logoLink to Veterinary Medicine and Science
. 2025 Jul 23;11(5):e70510. doi: 10.1002/vms3.70510

Biofilm Formation and Antibiotic Resistance Genes of Escherichia coli From Poultry Farms and Clinical Samples

Arina Sasoon 1,2, Farhad Nikkhahi 1, Amir Javadi 1, Samira Sabzi 1, Mohadeseh Ostovari Deilamani 1, Niloofar Kiaheyrati 1,2, Amin Karampour 1, Amir Peymani 1, Fatemeh Fardsanei 1,✉
PMCID: PMC12285606  PMID: 40699552

ABSTRACT

Background

Escherichia coli affects human health through intestinal and extraintestinal infections. Avian pathogenic E. coli (APEC) contributes to colibacillosis in poultry and can develop public health risks. Antibiotic resistance and biofilm‐producer strains are challenges in infection control options.

Objective

This study aimed to characterize phenotypic and genotypic antibiotic resistance profiles as well as biofilm formation assay in E. coli isolates from clinical and poultry samples.

Methods

In the study, 42 E. coli isolates were collected and confirmed from clinical and poultry sources. The isolates were evaluated for pathotypes using polymerase chain reaction (PCR). Antibiotic resistance was evaluated using the disk diffusion technique and minimum inhibitory concentration (MIC) tests. PCR was utilized to identify antimicrobial resistance genes associated with fluoroquinolones, sulphonamides, tetracyclines and beta‐lactams. Biofilm formation was evaluated using a 96‐well microtiter plate.

Results

Three clinical isolates, including enteropathogenic E. coli (EPEC), enteroaggregative E. coli (EAEC) and enterotoxigenic E. coli (ETEC), were identified as pathogenic strains. The highest rates of resistance were recorded against tylosin (100%), neomycin (92.85%), tetracycline (85.7%), ampicillin (73.8%), doxycycline (71.4%), ciprofloxacin (64.28%), trimethoprim/sulfamethoxazole (64.28%) and enrofloxacin (57.1%). The most prevalent resistance genes detected as blaTEM and gyrA/B (97.6% and 76.1%, respectively). The overall prevalence of blaCTX, sul1, sul2, tetA and tetB genes were 21.4%, 45.2%, 11.9%, 33.3% and 7.1%, respectively. The qnrB, qnrB4 and qnrS genes were absent in the clinical samples, whereas present in poultry isolates. All isolates were biofilm producers, and 96.4% of poultry isolates had strong biofilm formation capacity.

Conclusion

The alarming levels of resistance genes and biofilm formation of isolates in the present study emphasize the need for antibiotic management practices and further research on resistance transmission dynamics in the food industry.

Keywords: antibiotics resistance, biofilm formation, Escherichia coli, poultry

Three clinical isolates, including EPEC, EAEC and ETEC, were identified as pathogenic strains. All isolates were biofilm producers, and 96.4% of poultry isolates had strong biofilm formation capacity. The highest rates of resistance were recorded against tylosin (100%), neomycin (92.85%), tetracycline (85.7%), ampicillin (73.8%), doxycycline (71.4%), ciprofloxacin (64.28%), trimethoprim/sulfamethoxazole (64.28%) and enrofloxacin (57.1%).

graphic file with name VMS3-11-e70510-g002.jpg

1. Introduction

Escherichia coli (E. coli), a multifaceted facultative anaerobic bacteria, is a commensal resident of the intestines in humans and animals (Foster‐Nyarko and Pallen 2022). This microorganism is commonly classified on the basis of its pathogenicity into nonpathogenic, intestinal pathogenic and extraintestinal pathogenic strains. In healthcare settings, E. coli is a well‐known pathogen that causes various infections, from urinary tract infections (UTIs) to more severe conditions like bloodstream infections and gastrointestinal diseases (Vihta et al. 2018). Intestinal pathogenic E. coli is classified into various pathogenic groups on the basis of their virulence genes. These pathotypes include enterohemorrhagic E. coli (EHEC), enteropathogenic E. coli (EPEC), enteroinvasive E. coli (EIEC), enterotoxigenic E. coli (ETEC) and enteroaggregative E. coli (EAEC) (Pokharel et al. 2023). ETEC is commonly found in low‐ and middle‐income countries and is a significant cause of travellers’ diarrhoea, especially in children in these regions. EAEC is often linked to a higher risk of persistent diarrhoea. At the same time, EPEC is related to long‐lasting diarrhoea in developing countries and may also play a role in causing diarrhoea in more developed nations (Gomes et al. 2016).

Avian pathogenic E. coli (APEC) is accounting for causing colibacillosis in chicken and poultry, leading to extraintestinal infections (Cunha et al. 2017). Avian colibacillosis manifests in various forms, such as acute septicaemia, chronic respiratory diseases, cellulitis, salpingitis, pericarditis and other extraintestinal diseases (Panth 2019). Pathogenic E. coli isolates in animals and birds served as reservoirs, facilitating the spread of these strains among different livestock (Yuan et al. 2021). This can lead to contamination of the environment and increase the risk of infection in humans through direct exposure and consumption of contaminated food or water (Schmithausen et al. 2018).

The development of antibiotic resistance in gram‐negative bacteria, particularly in E. coli, poses a serious threat to global public health. E. coli is commonly used as an indicator for monitoring antibiotic resistance in the environment, as it has shown a strong capability to acquire multiple antibiotic resistances (Anjum et al. 2021). There are concerns about the transmission of antibiotic‐resistant bacteria from animals to humans due to the widespread use of antibiotics in animals for prevention and growth promotion (Aworh et al. 2021; Osman et al. 2018). Increasing antibiotic resistance among foodborne bacteria like E. coli has resulted in higher rates of human fatalities, longer hospital stays and increased healthcare costs (Mathers et al. 2015).

Biofilms are coatings produced by microorganisms that adhere to surfaces, creating protective layers as a survival strategy (Li et al. 2023). Biofilm has been recognized as a significant contributor to the development of antimicrobial resistance and serves as a protective barrier that prevents the effective targeting of microorganisms in living tissues by antimicrobial agents, antibodies, and immune cells (Kumar et al. 2017). APECs in poultry water systems are survived by biofilm, which is present on all equipment used in food production, including waterers and pipes used for drinking (Gunathilaka et al. 2024). This study aims to determine and characterize the antibiotic resistance patterns, and formation of bacterial biofilms in E. coli strains obtained from both clinical samples and poultry infected with colibacillosis.

2. Materials and Methods

2.1. Sampling and Bacterial Isolation

A total of 42 E. coli strains were identified in samples collected from humans and poultry from April to September 2022 in Qazvin, Iran. Out of these, 28 strains were isolated from the liver and intestine samples of poultry infected with colibacillosis, and 14 strains were obtained from clinical samples. Enrichment was performed using peptone water and Rappaport Vassiliadis for poultry samples, and the stool samples were transferred into gram‐negative broth (GN Broth) incubated at 37°C for 8 h. Then, the cultures were again sub‐cultured on EMB (eosin methylene blue) and XLD (xylose lysine deoxycholate) agar. Suspected colonies were subjected to standard biochemical tests, including oxidase, catalase, TSI agar, methyl red‐Voges–Proskauer (MRVP), citrate consumption (Simmons citrate agar) and urease production. All isolates that were glucose positive, lactose negative, MR positive, VP negative, indole positive, motility positive, hydrogen sulphide negative, and citrate negative were considered E. coli isolates by phenotypic tests. Stocks of all isolates were stored frozen at −80°C in microtube containing Tryptic Soy Broth (TSB) complemented with 10% (v/v) glycerol until required. Bacteria were recovered from freezing by transferring 100 µL into 5 mL of TSB, incubating overnight at 37°C, and sub‐culturing prior to use in assays.

2.2. Molecular Confirmation of E. coli Strains

2.2.1. DNA Extraction

E. coli isolates were cultured overnight on Trypticase soy agar (Sigma Aldrich, USA) plates, followed by the extraction of genomic DNA using the boiling method (da Silva et al. 2012). Briefly, bacteria were suspended in double‐distilled water and lysed by heating at 100°C for 10 min. After centrifugation, the supernatant containing DNA was collected and stored at −20°C until polymerase chain reaction (PCR) analysis.

2.2.2. PCR Assay

The PCR assay was conducted to detect different pathotypes of diarrheagenic E. coli strains by targeting virulence genes related to these strains. The specific primer sequences (Havt et al. 2017) are listed in Table 1. The pathotypes tested included EHEC (stx1, stx2 and hlyA genes), ETEC (lt and st genes), EAEC (aggR, sigA and astA genes) and EPEC (eae gene). The PCR products were separated by electrophoresis on a 1% agarose gel.

TABLE 1.

Primer sequences used for the identification of different Escherichia coli pathotypes by polymerase chain reaction (PCR).

Pathotype Target gene Primer sequence (5′–3′) PCR product (bp)
EHEC Stx1 F: ATGTCATTCGCTCTGCAATAGGTAC 1020
R: GAAGAAGAGACTGAAGATTCCATCTG
EHEC Stx2 F: GGCACTGTCTGAAACTGCTCCTGT 625
R: ATTAAACTGCACTTCAGCAAATCC
EHEC hlyA F: AGCTGCAAGTGCGGGTCTG 569
R:TACGGGTTATGCCTGCAAGTTCAC
EPEC eae F: ATGCTTAGTGCTGGTTTAGG 248
R: GCCTTCATCATTTCGCTTTC
ETEC st F: AGGAACGTACATCATTGCCC 170
R: CAAAGCATGCTCCAGCACTA
ETEC lt F: GGCGAC AGA TTATACCGTGC 450
R: CGG TCT CTA TAT TCC CTG TT
EAEC aggR F: CTAATTGTACAATCGATGTA 430
R: ATGAAGTAATTCTTGAAT
EAEC sigA F: CCGACTTCTCACTTTCTCCCG 430
R: CCATCCAGCTGCATAGTGTTTG
EAEC astA F: ATGCCATCAACACAGTATAT 110
R: GCGAGTGACGGCTTTGTAGT
Open in a new tab

Abbreviations: EAEC, enteroaggregative E. coli; EHEC, enterohemorrhagic E. coli; ETEC, enterotoxigenic E. coli.

2.3. Antibiotic Susceptibility Testing

The disk diffusion method, as per the Clinical & Laboratory Standards Institute guidelines (CLSI 2023), was used to test the susceptibility of isolates to various antibiotics. Various antibacterial discs (Thermo Fisher Scientific, USA), including cefepime (20 µg), cefotaxime (30 µg), ceftazidime (30 µg), cefoxitin (5 µg), neomycin (30 µg), ciprofloxacin (5 µg), lincospectin (30 µg), tylosin (40 µg), danofloxacin (40 µg), Tetracycline (30 µg), Enrofloxacin (10 µg), Doxycycline (30 µg), Trimethoprim/Sulfamethoxazole (25 µg), imipenem (10 µg), ampicillin (30 µg), florfenicol (30 µg) and levofloxacin (5 µg), were selected and tested. In addition, the minimum inhibitory concentration (MIC) of colistin was determined. Extended Spectrum Beta‐Lactamase (ESBL)‐producing isolates were identified using phenotypic methods as described previously (Rupp and Fey 2003). E. coli ATCC 25922 served as the standard strain for comparison.

2.4. Antimicrobial Resistance Gene Identification

PCRs with specific primers were applied to evaluate the presence of 14 antibiotic‐resistant genes among different classes of antibiotics. Isolates were screened for fluoroquinolone resistance: qnrA, qnrB, qnrB4, qnrC, qnrD, qnrS, gyrA and gyrB; sulfonamide resistance: sul1, sul2 and sul3; tetracyclines: tetA, tetB and tetG; and beta‐lactams resistance: blaCTX‐M and blaTEM. Table 2 provides a list of the primer sequences used in the study along with the corresponding annealing temperatures. The PCR products were resolved on a 1% agarose gel and visualized using a UV‐trans illuminator.

TABLE 2.

Primer sequences applied for resistance gene identification.

Antibiotic group Target gene Primer sequence (5′–3′) Annealing (°C) Reference
Fluoroquinolone qnrA F: ATTTCTCACGCCAGGATTTG 53 Dallal et al. (2023)
R: GATCGGCAAAGGTTAGGTCA
qnrB F:GATCGTGAAAGCCAGAAAGG 53 Dallal et al. (2023)
R: ACGATGCCTGGTAGTTGTCC
qnrB4 F: AGTTGTGATCTCTCCATGGC 53 Rezazadeh et al. (2016)
R: CGGATATCTAAATCGCCCAG
qnrC F: GGGTTGTACATTTATTGAATC 57 Abdel‐Rhman et al. (2021)
R: TCCACTTTACGAGGTTCT
qnrD F: CGGGGAATAGAGTTAAAAAT 47 Veldman et al. (2011)
R: TATCGGTGAACAATAACACC
qnrS F: GCAAGTTCATTGAACAGGGT 53 Abdel‐Rhman et al. (2021)
R: TCTAAACCGTCGAGTTCGGCG
gyrA F: TGCCAGATGTCCGAGAT 60 Oram and Fisher (1991)
R: GTATAACGCATTGCC
gyrB F: GGCACTGAATTTATCGGC 60 Ahmed et al. (2005)
R: TCCGAATTGGTCAGATCG
Sulfonamide Sul1 F:ATGGTGACGGTGTTCGGCATTCTG 64 Dallal et al. (2023)
R: GCTAGGCATGATCTAACCCTCGG
Sul2 F: AGGGGGCAGATGTGATCGAC 59 Dallal et al. (2023)
R: GCAGATGATTTCGCCAATTG
Sul3 F: TCAAAGCAAAATGATATGAGC 59 Dallal et al. (2023)
R: TTTCAAGGCATCTGATAAAGAC
Tetracycline tetA F: GTAATTCTGAGCACTGTCGC 58 Dallal et al. (2023)
R: CTGCCTGGACAACATTGCTT
tetB F: TTGGTTAGGGGCAAGTTTTG 60 Dallal et al. (2023)
R: GTAATGGGCCAATAACACCG 65
tetG F: AGCAGCCTCAACCATTGCCGAT Dallal et al. (2023)
R: GGTGTTCCACTGAAAACGGTCCT
β‐Lactam bla CTX‐M F: AGGAAGTGTGCCGCTGTATG 53 Dallal et al. (2023)
R: CTGTCGCCCAATGCTTTACC
Bla TEM F: TCGCCGCATACACTATTCTC 57 Dallal et al. (2023)
R: AACTTTATCCGCCTCCATCC
Open in a new tab

2.5. Biofilm Formation Assay

The formation of biofilms was studied using a 96‐well microtiter plate technique. Bacterial cultures were grown in a TSB medium containing 5% sucrose and then adjusted to a standard concentration (0.5 MFU [McFarland]) before being added to each microplate well. The plate was then incubated at 37°C for 18–24 h. Pseudomonas aeruginosa and TSB medium were the positive and negative controls, respectively (Wu et al. 2011). Following three quick washes with phosphate‐buffered saline (PBS), and cell fixation with methanol 95% solution, the plate was stained with 200 µL of 1% crystal violet (CV) for 15 min. The dye was taken out, and the wells were rinsed three times with PBS. Subsequently, the biofilms formed were dissolved with 200 µL of 33% acetic acid for 30 min. A microtiter plate reader (BioTek, Epoch, USA) was used to measure the optical absorbance at 570 nm (OD570, ODC570). Biofilms were categorized into four groups on the basis of the ODc value: OD ≤ ODc (non‐biofilm formation), ODc < OD ≤ 2 ODc (weak‐biofilm formation), 2 ODc < OD ≤ 4 ODc (medium‐biofilm formation) and OD > 4 ODc (strong‐biofilm formation).

2.6. Statistical Analysis

SPSS software version 16 was used for conducting statistical analysis. The Kruskal–Wallis test was applied for comparisons of biofilm formation capacity. A result was considered to have statistical significance if the p value was less than 0.05 (p < 0.05).

3. Results

3.1. Molecular Confirmation of E. coli Isolates

Out of the 42 E. coli strains, three clinical isolates, including one EPEC, one ETEC and one EAEC, were identified on the basis of the presence of the target genes. The remaining isolates did not exhibit virulence genes characteristic of the tested pathotypes.

3.2. Characteristics of Isolates

The highest rates of resistance were recorded against tylosin (N = 42, 100%), neomycin (N = 39, 92.85%), tetracycline (N = 36, 85.7%), ampicillin (N = 31, 73.8%), doxycycline (N = 30, 71.4%), ciprofloxacin (N = 27, 64.28%) and trimethoprim/sulfamethoxazole (27, 64.28%). The resistance rates to other antibiotics were as follows: enrofloxacin (N = 24, 57.1%), danofloxacin (N = 20, 47.6%), levofloxacin (N = 19, 45.2%), florfenicol (N = 18, 42.8%), cefotaxime (N = 15, 35.7%), imipenem (N = 8, 19%), lincospectin (N = 7, 16.6%), ceftazidime (N = 5, 11.9%), cefoxitin (N = 5, 11.9%) and cefepime (N = 2, 4.7%). Additionally, all 42 E. coli isolates in the study exhibited MIC ≤ 2 to colistin. The CLSI no longer categorizes E. coli as colistin‐susceptible, only recognizing intermediate (MIC ≤ 2) and resistant (MIC ≥ 4) categories. However, the EUCAST 2023 still considers isolates with a colistin MIC ≤ 2 to be colistin‐susceptible (Zafer et al. 2023). Moreover, 11 strains (26.1%) were identified as ESBL positive on the basis of the phenotypic method.

Regarding antibiotic resistance genes, qnrA, qnrC, qnrD, sul3 and tetG were not found in any isolates. Among fluoroquinolone‐resistance isolates, the highest resistance was attributed to gyrA and gyrB genes among both clinical and poultry isolates (overall 76.1%, 85.7% of poultry and 57.1% of clinical isolates). The qnrB, qnrB4 and qnrS genes were found in 17.8%, 14.2% and 10.7% of poultry isolates, respectively, but not in clinical isolates.

Among sulphonamides resistance isolates, 42.8% and 46.4% of clinical and poultry isolates were positive with sul1 gene. The sul2 gene was found in 10.7% and 14.2% of poultry and clinical isolates, respectively.

In terms of beta‐lactam resistance, the most prevalent resistance gene identified was blaTEM, present in 96.4% of poultry and 100% of clinical isolates. The blaCTX gene was also detected in 17.8% of poultry isolates and 28.5% of clinical isolates.

Tetracycline resistance was linked to the tetA gene in 32.1% of poultry isolates and 14.2% of clinical isolates. The tetB gene was found in 7.1% of both poultry and clinical isolates, whereas the tetG gene was not identified in any isolates. The detailed information is presented in Table 3.

TABLE 3.

Phenotypic and genotypic characterization of Escherichia coli isolates from clinical and poultry samples.

Isolates Source Phenotypic resistance Genotypic resistance Biofilm formation
SE1 Poultry N, TY, T, CP, D, AMP gyrA, gyrB, bla TEM Strong
SE2 Poultry N, TY, T, D, AMP bla TEM Strong
SE3 Poultry N, FF, TY, DFX, T, CP, NFX, D, LEV, AMP gyrA, gyrB, bla TEM, qnrB Strong
SE4 Poultry N, TY, T, CP, ENR, D, AMP gyrA, gyrB, bla TEM , tetA Strong
SE5 Poultry N, TY, AMP bla TEM Strong
SE6 Poultry N, TY, AMP qnrB, qnrB4, bla TEM Strong
SE7 Poultry N, FF, TY, DFX, CP, ENR, SXT, LEV gyrA, gyrB, bla TEM, qnrB, qnrB4 Strong
SE8 Poultry N, TY, DFX, T, CP, ENR, D, SXT, LEV gyrA, gyrB, bla TEM , tetA, sul1 Strong
SE9 Poultry CTX, CAZ, FOX, N, FF, TY, DFX, T, CP, ENR, D, SXT, LED, AMP gyrA, gyrB, bla TEM , tetA, sul1, qnrB, qnrB4 Strong
SE10 Poultry N, FF, TY, DFX, CP, ENR, SXT, LEV, AMP gyrA, gyrB, bla TEM , tetA, sul1, qnrB, qnrB4 Strong
SE11 Poultry CTX, N, LS, FF, TY, T, CP, ENR, SXT, AMP gyrA, gyrB, bla TEM , bla CTX‐M, tetA, sul1 Strong
SE12 Poultry CTX, N, LS, FF, TY, T, CP, ENR, SXT, AMP gyrA, gyrB, bla TEM, bla CTX‐M, sul2 Strong
SE13 Poultry CTX, N, LS, FF, TY, DFX, T, CP, ENR, D, SXT, LEV, AMP gyrA, gyrB, bla TEM, bla CTX‐M, tetA, sul1 Strong
SE14 Poultry N, TY, T, CP, D, SXT gyrA, gyrB, bla TEM , tetA, sul2, qnrS Strong
SE15 Poultry CTX, N, TY, DFX, T, CP, ENR, D, SXT, LEV, AMP gyrA, gyrB, bla TEM , sul1, qnrS Strong
SE16 Poultry CTX, N, FF, TY, DFX, T, CP, ENR, D, SXT, LEV, AMP, IMP gyrA, gyrB, bla TEM , bla CTX‐M, sul1 Strong
SE17 Poultry CTX, TY, DFX, T, CP, ENR, D, SXT, LEV gyrA, gyrB, bla CTX‐M, tetA, sul1 Strong
SE18 Poultry FOX, N, FF, TY, DFX, T, CP, ENR, D, SXT, LEV, AMP gyrA, gyrB, bla TEM , sul1 Strong
SE19 Poultry N, FF, TY, DFX, T, CP, ENR, D, LEV, AMP gyrA, gyrB, bla TEM Strong
SE20 Poultry N, FF, TY, DFX, T, CP, ENR, D, LEV, AMP gyrA, gyrB, bla TEM Strong
SE21 Poultry N, FF, TY, DFX, T, CP, ENR, D, LEV, AMP gyrA, gyrB, bla TEM , tetB Strong
SE22 Poultry N, FF, TY, DFX, T, CP, NFX, D, SXT, AMP gyrA, gyrB, bla TEM , tetB, sul1 Strong
SE23 Poultry FF, TY, DFX, T, CP, ENR, D, SXT, LEV, AMP gyrA, gyrB, bla TEM , tetA, suL2 Strong
SE24 Poultry N, TY, T, CP, D, SXT, LEV, AMP gyrA, gyrB, bla TEM , sul1 Strong
SE25 Poultry FOX, N, FF, TY, DFX, T, CP, ENR, D gyrA, gyrB, bla TEM , tetA, sul1 Strong
SE26 Poultry N, FF, TY, DFX, T, CP, ENR, D, SXT, LEV bla TEM , sul1 Strong
SE27 Poultry N, TY, DFX, T, CP, ENR, D, SXT, LEV, AMP gyrA, gyrB, bla TEM Moderate
SE28 Poultry N, TY, T, ENR, D, SXT gyrA, gyrB, bla TEM, qnrS Strong
SE29 Clinical CTX, N, FF, TY, T, D, SXT, AMP bla TEM , sul1 Moderate
SE30 Clinical CTX, N, TY, T, D, SXT, AMP bla TEM , sul2 Strong
SE31 Clinical N, TY, T, D bla TEM Strong
SE32 Clinical TY, T bla TEM Weak
SE33 Clinical N, TY, CP, SXT, AMP, IMP gyrA, gyrB, bla TEM , sul1 Strong
SE34 Clinical CTX, CAZ, N, LS, TY, T, D, SXT, AMP gyrA, gyrB, bla TEM , bla CTX‐M, tetB, sul2 Moderate
SE35 Clinical CTX, CAZ, N, LS, FF, TY, T, SXT, AMP, IMP bla TEM , bla CTX‐M Strong
SE36 Clinical FOX, N, TY gyrA, gyrB, bla TEM Weak
SE37 Clinical FEP, CTX, CAZ, FOX, N, LS, TY, DFX, T, CP, ENR, D, SXT, LEV, AMP, IMP gyrA, gyrB, bla TEM , bla CTX‐M , tetA, sul1 Moderate
SE38 Clinical N, TY, T, D, SXT, AMP, IMP gyrA, gyrB, bla TEM , tetA, sul1 Strong
SE39 Clinical FEP, N, TY, T, AMP gyrA, gyrB, bla TEM Strong
SE40 Clinical CTX, CAZ, N, LS, TY, T, CP, D, SXT, AMP, IMP gyrA, gyrB, bla TEM , bla CTX‐M, sul1 Moderate
SE41 Clinical CTX, N, TY, T, IMP bla TEM Moderate
SE42 Clinical CTX, N, TY, DFX, T, CP, ENR, D, SXT, LEV, AMP, IMP gyrA, gyrB, bla TEM , sul1 Weak
Open in a new tab

Abbreviations: Amp, ampicillin; CAZ, ceftazidime; CP, ciprofloxacin; CTX, cefotaxime; D, doxycycline; DFX, danofloxacin; ENR, enrofloxacin; FEP, cefepime; FF, florfenicol; IMP, imipenem; LEV, levofloxacin; LS, lincospectin; N, neomycin; SXT, trimethoprim/sulfamethoxazole; T, tetracycline; TY, tylosin.

3.3. Biofilm Formation Assay

The findings showed that every isolated tested could form biofilm. Among clinical isolates, 21.42% were categorized as weak biofilm producers, 35.71% as moderate biofilm producers, and the majority, accounting for 42.85%, were identified as strong biofilm producers. Compared to isolates taken from clinical samples, a significant majority (96.4%) of isolates from poultry samples demonstrated the ability to form robust biofilm, and only 3.57% of isolates formed medium biofilm. None of the poultry isolates formed a weak biofilm. The distribution of biofilm formation according to sample sources is visually represented in Figure 1 and Table 3. There was no association between biofilm formation or antibiotic resistance patterns and resistance genes.

FIGURE 1.

FIGURE 1

Open in a new tab

Comparison of biofilm producer's strains in clinical and poultry of Escherichia coli.

4. Discussion

Pathogenic strains of E. coli can be transmitted to a host through various pathways, particularly the faecal‐oral route. These virulent strains can readily contaminate the human food chain, leading to the development of severe gastrointestinal illnesses (Alia et al. 2022; Sharifi Yazd et al. 2011). This study identified three clinical E. coli isolates as EPEC, ETEC and EAEC, highlighting the presence of these virulent pathotypes in Iran. In a study conducted by Eybpoosh et al. (2021), it was found that ETEC and EPEC were the second and third most commonly found pathotypes in Iran, whereas EAEC did not show significant prevalence.

The AST conducted in this study revealed that many identified isolates had significant levels of resistance to multiple antibiotics. The highest resistance rate was identified for tylosin (100%) and neomycin (92.8%). The widespread use of tylosin and neomycin in animal feed for promoting growth and preventing illness could be a contributing factor to the high levels of resistance to these antibiotics (Driver et al. 2009; Schmidt et al. 2020).

Quinolones are frequently applied to treat various infections caused by E. coli and other bacteria in the Enterobacteriaceae family. However, the emergence of resistance to these antibiotics has made treatment more challenging and could result in ineffective therapy (Bush et al. 2020). In the present study, 64.2%, 57.1%, 47.6% and 45.2% of isolates were fully resistant to ciprofloxacin, enrofloxacin, danofloxacin and levofloxacin, respectively. These results were higher than those found in past studies conducted in China (Cheng et al. 2020) and Iran (Hamed et al. 2021). Furthermore, in the molecular investigations, among the PMQR (plasmid‐mediated quinolones resistance) determinants, qnrB, qnrB4 and qnrS genes were identified only in poultry isolates. This finding suggested the spread of quinolone‐resistant E. coli from food‐producing animals to humans cannot be ignored, as qnr can be transferred to pathogenic bacteria through commensal E. coli. Our finding is consistent with Tamang et al. (2012) from Korea and Yue et al. (2008) from China.

In our study, resistance to ampicillin was prevalent (overall 73.8%), whereas resistance rates to other beta‐lactams, including ceftazidime, cefoxitin and cefepime, were uncommon among isolates. These findings align with previous research (Adenipekun et al. 2016; Dallal et al. 2023). Consideringly, 19% of all E. coli isolates determinate resistance to imipenem. Resistance to imipenem can pose a serious threat, as this antibiotic may be the last resort for the treatment of severe infections caused by pathogenic bacteria (Sharma et al.). The molecular results showed that blaTEM was the most common ESBL gene found in isolates (100% for clinical isolates and 96.4% for poultry isolates), which aligns with what other studies have found (Dallal et al. 2023; Reshadi et al. 2021). Some studies found chickens exhibited a higher frequency of the blaTEM gene, possibly due to the increased application of beta‐lactam antibiotics in poultry farms (Ogunrinu et al. 2020; Saliu et al. 2017). Furthermore, the blaCTX‐M gene was found in 17.9% of the poultry isolates and 28.6% of clinical samples. The prevalence of this gene has shown an increase compared to a recent study conducted in Iran (Pourhossein et al. 2020) but decreased compared to the study in China (Li et al. 2016).

Tetracyclines and sulphonamides are essential types of antibiotics commonly used on their own or in combination with other antibiotics to treat infections caused by Enterobacteriaceae (Gao et al. 2012). The high levels of tetracycline (overall 85.7%), doxycycline (overall 71.4%) and Trimethoprim/sulfamethoxazole (overall 64.28%) among isolates are concerning. Interestingly, this study found that tetracycline and doxycycline resistance in poultry sources was more common than in clinical sources. This suggests the significance of closely monitoring and regulating the use of antibiotics in poultry farms to control the transmission of antibiotic‐resistant bacteria to humans via food supplies. Consistent with previous research, our findings indicate that tetA was the most common determinant (Jahantigh et al. 2020; Soltan Dallal et al. 2023). However, Skocková et al. (2012) found tetB as the most prevalent tetracycline resistance gene.

Biofilm formation characteristics among E. coli isolates are another crucial aspect highlighted in this study. The high proportion of isolates capable of forming strong biofilms indicates the adaptability and persistence of these bacteria in diverse environments. On the basis of the results, biofilm formation was detected in all tested isolates using the microtiter plate method and was more prevalent than previously reported (Pavlickova et al. 2017; Rodrigues et al. 2019). Our results indicate a significant presence of biofilm‐forming strains in poultry, demonstrating strong genotypic and phenotypic resistance profiles to various antibiotics. The dominance of strong biofilm producers in poultry isolates of this study (nearly 97%) warrants further investigation into the role of agricultural practices in biofilm development and transmission dynamics (Hussain et al. 2017; Siddique et al. 2021). Future research endeavours should concentrate on understanding the mechanisms underlying these resistance patterns and developing novel strategies to combat biofilm‐associated antibiotic resistance.

5. Conclusion

This research offers a deeper understanding of the frequency and features of E. coli strains found in human and poultry samples in Qazvin, Iran. The co‐occurrence of high antimicrobial resistance and strong biofilm‐forming capabilities in strains highlights the urgent need for coordinated efforts to combat antibiotic resistance and ensure the effectiveness of antimicrobial therapies.

Author Contributions

Arina Sasoon: methodology, investigation, visualization. Farhad Nikkhahi: supervision, visualization. Amir Javadi: formal analysis, software. Samira Sabzi: writing – original draft. Mohadeseh Ostovari Deilamani: methodology. Niloofar Kiaheyrati: writing – review and editing. Amin Karampour: project administration. Amir Peymani: writing – review and editing. Fatemeh Fardsanei: supervision, writing – review and editing, data curation, writing – original draft, validation, funding acquisition, resources, conceptualization.

Ethics Statement

The current study was performed by approval of the Ethics Committee of Qazvin Medical University with approval number IR.QUMS.REC.1400.439.

Peer Review

The peer review history for this article is available at https://www.webofscience.com/api/gateway/wos/peer‐review/10.1002/vms3.70510.

Acknowledgements

Medical Microbiology Research Center, Qazvin university of Medical Sciences, Qazvin, Iran (contract no. IR.QUMS.REC.1400.439).

Funding: This study was supported by Medical Microbiology Research Center, Qazvin university of Medical Sciences, Qazvin, Iran (contract no. IR.QUMS.REC.1400.439).

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

References

  1. Abdel‐Rhman, S. H. , Elbargisy R. M., and Rizk D. E.. 2021. “Characterization of Integrons and Quinolone Resistance in Clinical Escherichia coli Isolates in Mansoura City, Egypt.” International Journal of Microbiology 2021: 6468942. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Adenipekun, E. O. , Jackson C. R., Ramadan H., et al. 2016. “Prevalence and Multidrug Resistance of Escherichia coli From Community‐Acquired Infections in Lagos, Nigeria.” Journal of Infection in Developing Countries 10, no. 09: 920–931. [DOI] [PubMed] [Google Scholar]
  3. Ahmed, A. M. , Miyoshi S.‐I., Shinoda S., and Shimamoto T.. 2005. “Molecular Characterization of a Multidrug‐Resistant Strain of Enteroinvasive Escherichia coli O164 Isolated in Japan.” Journal of Medical Microbiology 54, no. 3: 273–278. [DOI] [PubMed] [Google Scholar]
  4. Alia, R. A. , Sadia N., Shammy N. P., Tithy F. A., Shelim R., and Parvin R.. 2022. “Diarrhoeal Disease in Relation to Childhood Malnutrition and Its Impact on Socio‐Economic Condition in Emerging Countries Like Bangladesh.” Journal of Pediatrics, Perinatology and Child Health 6, no. 3: 370–379. [Google Scholar]
  5. Anjum, M. F. , Schmitt H., Börjesson S., et al. 2021. “The Potential of Using E. coli as an Indicator for the Surveillance of Antimicrobial Resistance (AMR) in the Environment.” Current Opinion in Microbiology 64: 152–158. [DOI] [PubMed] [Google Scholar]
  6. Aworh, M. K. , Kwaga J. K., Hendriksen R. S., Okolocha E. C., and Thakur S.. 2021. “Genetic Relatedness of Multidrug Resistant Escherichia coli Isolated From Humans, Chickens and Poultry Environments.” Antimicrobial Resistance & Infection Control 10: 1–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bush, N. G. , Diez‐Santos I., Abbott L. R., and Maxwell A.. 2020. “Quinolones: Mechanism, Lethality and Their Contributions to Antibiotic Resistance.” Molecules (Basel, Switzerland) 25, no. 23: 5662. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cheng, P. , Yang Y., Li F., et al. 2020. “The Prevalence and Mechanism of Fluoroquinolone Resistance in Escherichia coli Isolated From Swine Farms in China.” BMC Veterinary Research 16: 1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Cunha, M. P. V. , Saidenberg A. B., Moreno A. M., et al. 2017. “Pandemic Extra‐Intestinal Pathogenic Escherichia coli (ExPEC) Clonal Group O6‐B2‐ST73 as a Cause of Avian colibacillosis in Brazil.” PLoS ONE 12, no. 6: e0178970. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. da Silva, G. A. , Bernardi T. L., Schaker P. D. C., Menegotto M., and Valente P.. 2012. “Rapid Yeast DNA Extraction by Boiling and Freeze‐Thawing Without Using Chemical Reagents and DNA Purification.” Brazilian Archives of Biology and Technology 55: 319–327. [Google Scholar]
  11. Dallal, M. M. S. , Kelishomi F. Z., Nikkhahi F., Salehi T. Z., Fardsanei F., and Peymani A.. 2023. “Biofilm Formation, Antimicrobial Resistance Genes, and Genetic Diversity of Salmonella enterica Subspecies Enterica Serotype Enteritidis Isolated From Food and Animal Sources in Iran.” Journal of Global Antimicrobial Resistance 34: 240–246. [DOI] [PubMed] [Google Scholar]
  12. Driver, J. L. , Thiex N., Raynie D., Ofitserova M., and Pickering M.. 2009. “Single‐Laboratory Validation for the Quantification of Neomycin B and Neomycin C in Animal Feeds by Liquid Chromatography Fluorescence Detection With Post‐Column Derivatization.” Journal of AOAC International 92, no. 1: 34–41. [PubMed] [Google Scholar]
  13. Eybpoosh, S. , Mostaan S., Gouya M. M., et al. 2021. “Frequency of Five Escherichia coli Pathotypes in Iranian Adults and Children With Acute Diarrhea.” PLoS ONE 16, no. 2: e0245470. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Foster‐Nyarko, E. , and Pallen M. J.. 2022. “The Microbial Ecology of Escherichia coli in the Vertebrate Gut.” FEMS Microbiology Reviews 46, no. 3: fuac008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Gao, P. , Munir M., and Xagoraraki I.. 2012. “Correlation of Tetracycline and Sulfonamide Antibiotics With Corresponding Resistance Genes and Resistant Bacteria in a Conventional Municipal Wastewater Treatment Plant.” Science of the Total Environment 421: 173–183. [DOI] [PubMed] [Google Scholar]
  16. Gomes, T. A. , Elias W. P., Scaletsky I. C., et al. 2016. “Diarrheagenic Escherichia coli .” Brazilian Journal of Microbiology 47: 3–30. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Gunathilaka, G. , Dewasmika W., Sandaruwan U., et al. 2024. “Biofilm‐Forming Ability, Antibiotic Resistance and Phylogeny of Escherichia coli Isolated From Extra Intestinal Infections of Humans, Dogs, and Chickens.” Comparative Immunology, Microbiology and Infectious Diseases 105: 102123. [DOI] [PubMed] [Google Scholar]
  18. Hamed, E. A. , Abdelaty M. F., Sorour H. K., et al. 2021. “Monitoring of Antimicrobial Susceptibility of Bacteria Isolated From Poultry Farms From 2014 to 2018.” Veterinary Medicine International 2021: 6739220. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Havt, A. , Lima I. F., Medeiros P. H., et al. 2017. “Prevalence and Virulence Gene Profiling of Enteroaggregative Escherichia coli in Malnourished and Nourished Brazilian Children.” Diagnostic Microbiology and Infectious Disease 89, no. 2: 98–105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Hussain, H. I. , Iqbal Z., Seleem M. N., et al. 2017. “Virulence and Transcriptome Profile of Multidrug‐Resistant Escherichia coli From Chicken.” Scientific Reports 7, no. 1: 8335. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Jahantigh, M. , Samadi K., Dizaji R. E., and Salari S.. 2020. “Antimicrobial Resistance and Prevalence of Tetracycline Resistance Genes in Escherichia coli Isolated From Lesions of Colibacillosis in Broiler Chickens in Sistan, Iran.” BMC Veterinary Research 16: 1–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kumar, A. , Alam A., Rani M., Ehtesham N. Z., and Hasnain S. E.. 2017. “Biofilms: Survival and Defense Strategy for Pathogens.” International Journal of Medical Microbiology 307, no. 8: 481–489. [DOI] [PubMed] [Google Scholar]
  23. Li, P. , Yin R., Cheng J., and Lin J.. 2023. “Bacterial Biofilm Formation on Biomaterials and Approaches to Its Treatment and Prevention.” International Journal of Molecular Sciences 24, no. 14: 11680. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Li, S. , Zhao M., Liu J., Zhou Y., and Miao Z.. 2016. “Prevalence and Antibiotic Resistance Profiles of Extended‐Spectrum β‐Lactamase–Producing Escherichia coli Isolated From Healthy Broilers in Shandong Province, China.” Journal of Food Protection 79, no. 7: 1169–1173. [DOI] [PubMed] [Google Scholar]
  25. Mathers, A. J. , Peirano G., and Pitout J. D.. 2015. “ Escherichia coli ST131: The Quintessential Example of an International Multiresistant High‐Risk Clone.” Advances in Applied Microbiology 90: 109–154. [DOI] [PubMed] [Google Scholar]
  26. Ogunrinu, O. J. , Norman K. N., Vinasco J., et al. 2020. “Can the Use of Older‐Generation Beta‐Lactam Antibiotics in Livestock Production Over‐Select for Beta‐Lactamases of Greatest Consequence for Human Medicine? An In Vitro Experimental Model.” PLoS ONE 15, no. 11: e0242195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Oram, M. , and Fisher L. M.. 1991. “4‐Quinolone Resistance Mutations in the DNA Gyrase of Escherichia coli Clinical Isolates Identified by Using the Polymerase Chain Reaction.” Antimicrobial Agents and Chemotherapy 35, no. 2: 387–389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Osman, K. M. , Kappell A. D., Elhadidy M., et al. 2018. “Poultry Hatcheries as Potential Reservoirs for Antimicrobial‐Resistant Escherichia coli: A Risk to Public Health and Food Safety.” Scientific Reports 8, no. 1: 5859. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Panth, Y. 2019. “Colibacillosis in Poultry: A Review.” Journal of Agriculture and Natural Resources 2, no. 1: 301–311. [Google Scholar]
  30. Pavlickova, S. , Klancnik A., Dolezalova M., Mozina S. S., and Holko I.. 2017. “Antibiotic Resistance, Virulence Factors and Biofilm Formation Ability in Escherichia coli Strains Isolated From Chicken Meat and Wildlife in the Czech Republic.” Journal of Environmental Science and Health, Part B 52, no. 8: 570–576. [DOI] [PubMed] [Google Scholar]
  31. Pokharel, P. , Dhakal S., and Dozois C. M.. 2023. “The Diversity of Escherichia coli Pathotypes and Vaccination Strategies Against This Versatile Bacterial Pathogen.” Microorganisms 11, no. 2: 344. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Pourhossein, Z. , Asadpour L., Habibollahi H., and Shafighi S. T.. 2020. “Antimicrobial Resistance in Fecal Escherichia coli Isolated From Poultry Chicks in Northern Iran.” Gene Reports 21: 100926. [Google Scholar]
  33. Reshadi, P. , Heydari F., Ghanbarpour R., et al. 2021. “Molecular Characterization and Antimicrobial Resistance of Potentially Human‐Pathogenic Escherichia coli Strains Isolated From Riding Horses.” BMC Veterinary Research 17, no. 1: 1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Rezazadeh, M. , Baghchesaraei H., and Peymani A.. 2016. “Plasmid‐Mediated Quinolone‐Resistance (QNR) Genes in Clinical Isolates of Escherichia coli Collected From Several Hospitals of Qazvin and Zanjan Provinces, Iran.” Osong Public Health and Research Perspectives 7, no. 5: 307–312. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Rodrigues, S. V. , Laviniki V., Borges K. A., et al. 2019. “Biofilm Formation by Avian Pathogenic Escherichia coli Is Not Related to In Vivo Pathogenicity.” Current Microbiology 76: 194–199. [DOI] [PubMed] [Google Scholar]
  36. Rupp, M. E. , and Fey P. D.. 2003. “Extended Spectrum β‐Lactamase (ESBL)‐Producing Enterobacteriaceae: Considerations for Diagnosis, Prevention and Drug Treatment.” Drugs 63: 353–365. [DOI] [PubMed] [Google Scholar]
  37. Saliu, E.‐M. , Vahjen W., and Zentek J.. 2017. “Types and Prevalence of Extended–Spectrum Beta–Lactamase Producing Enterobacteriaceae in Poultry.” Animal Health Research Reviews 18, no. 1: 46–57. [DOI] [PubMed] [Google Scholar]
  38. Schmidt, J. W. , Vikram A., Miller E., Jones S. A., and Arthur T. M.. 2020. “In‐Feed Tylosin Phosphate Administration to Feedlot Cattle Minimally Affects Antimicrobial Resistance.” Journal of Food Protection 83, no. 2: 350–364. [DOI] [PubMed] [Google Scholar]
  39. Schmithausen, R. M. , Schulze‐Geisthoevel S. V., Heinemann C., et al. 2018. “Reservoirs and Transmission Pathways of Resistant Indicator Bacteria in the Biotope Pig Stable and Along the Food Chain: A Review From a One Health Perspective.” Sustainability 10, no. 11: 3967. [Google Scholar]
  40. Sharifi Yazdi, M. K. , Soltan Dallal M., Agha Mirzaei H. M., et al. 2011. “Molecular Detection of TEM Broad Spectrum Beta‐Lactamase in Clinical Isolates of Escherichia coli .” African Journal of Biotechnology 10, no. 46: 9454–9458. [Google Scholar]
  41. Siddique, A. , Azim S., Ali A., et al. 2021. “Antimicrobial Resistance Profiling of Biofilm Forming Non Typhoidal Salmonella Enterica Isolates From Poultry and Its Associated Food Products From Pakistan.” Antibiotics 10, no. 7: 785. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Skocková, A. , Cupakova S., Karpísková R., and Janstová B. 2012. “Detection of Tetracycline Resistance Genes in Escherichia coli From Raw Cow's Milk.” Journal of Microbiology, Biotechnology and Food Sciences 1: 777–784. [Google Scholar]
  43. Soltan Dallal, M. M. , Zeynali Kelishomi F., Nikkhahi F., Zahraei Salehi T., Fardsanei F., and Peymani A.. 2023. “Biofilm Formation, Antimicrobial Resistance Genes, and Genetic Diversity of Salmonella enterica Subspecies Enterica Serotype Enteritidis Isolated From Food and Animal Sources in Iran.” Journal of Global Antimicrobial Resistance 34: 240–246. [DOI] [PubMed] [Google Scholar]
  44. Tamang, M. D. , Nam H.‐M., Chae M. H., et al. 2012. “Prevalence of Plasmid‐Mediated Quinolone Resistance Determinants Among Escherichia coli Isolated From Food Animals in Korea.” Foodborne Pathogens and Disease 9, no. 12: 1057–1063. [DOI] [PubMed] [Google Scholar]
  45. Veldman, K. , Cavaco L. M., Mevius D., et al. 2011. “International Collaborative Study on the Occurrence of Plasmid‐Mediated Quinolone Resistance in Salmonella enterica and Escherichia coli Isolated From Animals, Humans, Food and the Environment in 13 European Countries.” Journal of Antimicrobial Chemotherapy 66, no. 6: 1278–1286. [DOI] [PubMed] [Google Scholar]
  46. Vihta, K.‐D. , Stoesser N., Llewelyn M. J., et al. 2018. “Trends Over Time in Escherichia coli Bloodstream Infections, Urinary Tract Infections, and Antibiotic Susceptibilities in Oxfordshire, UK, 1998–2016: A Study of Electronic Health Records.” Lancet Infectious Diseases 18, no. 10: 1138–1149. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Wu, M.‐C. , Lin T.‐L., Hsieh P.‐F., Yang H.‐C., and Wang J.‐T.. 2011. “Isolation of Genes Involved in Biofilm Formation of a Klebsiella pneumoniae Strain Causing Pyogenic Liver Abscess.” PLoS ONE 6, no. 8: e23500. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Yuan, Y. , Liang B., Jiang B.‐W., et al. 2021. “Migratory Wild Birds Carrying Multidrug‐Resistant Escherichia coli as Potential Transmitters of Antimicrobial Resistance in China.” PLoS ONE 16, no. 12: e0261444. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Yue, L. , Jiang H.‐X., Liao X.‐P., et al. 2008. “Prevalence of Plasmid‐Mediated Quinolone Resistance Qnr Genes in Poultry and Swine Clinical Isolates of Escherichia coli .” Veterinary Microbiology 132, no. 3–4: 414–420. [DOI] [PubMed] [Google Scholar]
  50. Zafer, M. M. , Hussein A. F., Al‐Agamy M. H., Radwan H. H., and Hamed S. M.. 2023. “Retained Colistin Susceptibility in Clinical Acinetobacter baumannii Isolates With Multiple Mutations in pmrCAB and lpxACD Operons.” Frontiers in Cellular and Infection Microbiology 13: 1229473. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Articles from Veterinary Medicine and Science are provided here courtesy of Wiley

RESOURCES