Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2026 Mar 12.
Published in final edited form as: Dev Cell. 2025 Mar 12;60(14):1936–1946.e4. doi: 10.1016/j.devcel.2025.02.011

Piezo-dependent surveillance of matrix stiffness generates transient cells that repair the basement membrane

Aubrie M Stricker 1, M Shane Hutson 2, Andrea Page-McCaw 1,3
PMCID: PMC12286749  NIHMSID: NIHMS2060524  PMID: 40081371

Summary

Basement membranes are extracellular matrix sheets separating tissue layers and providing mechanical support, and Collagen IV (Col4) is their most abundant structural protein. Although basement membranes are repaired after damage, little is known about repair, including whether and how damage is detected, what cells repair the damage, and how repair is controlled to avoid fibrosis. Using the intestinal basement membrane of adult Drosophila as a model, we show that after basement membrane damage, there is a sharp increase in enteroblasts transiently expressing Col4, termed “matrix mender” cells. Enteroblast-derived Col4 is specifically required for matrix repair. The increase in matrix mender cells requires the mechanosensitive ion channel Piezo, expressed in intestinal stem cells. Matrix menders are induced by the loss of matrix stiffness, as specifically inhibiting Col4 crosslinking is sufficient for Piezo-dependent induction of matrix mender cells. Our data suggest that epithelial stem cells control basement membrane integrity by monitoring stiffness.

Keywords: Basement membrane, Drosophila, Collagen IV, midgut, Piezo, matrix, tensional stiffness, intestinal stem cells, enteroblasts, repair

Graphical Abstract

graphic file with name nihms-2060524-f0001.jpg

eTOC Blurb:

Basement membranes are a conserved extracellular matrix that provide support to tissues, yet little is known about their repair. Stricker et al find that in the Drosophila midgut, basement membrane damage is detected by Piezo as a loss of stiffness, prompting local epithelial cells to express collagen IV for repair.

Introduction

Extracellular matrix (ECM) is an essential conserved component of all animal tissues. In addition to providing structural support, ECM influences cell adhesion, shape, signaling, and behaviors. When tissues are damaged, ECM needs to be repaired, and pathological ECM damage is a feature of many human diseases1,2. Despite the critical importance of ECM repair, little is known about the cellular processes and molecular signals that orchestrate repair. At the most fundamental level, it is unknown whether and how cells detect ECM damage. Moreover, ECM proteins, including collagens, are among the most stable proteins in the body, with the longest-lived exhibiting half-lives on the order of an animal’s lifetime3–6. ECM longevity presents a challenge, as repairing with excess ECM causes fibrosis. In this study, we identify a mechanism that cells use to sense damaged matrix, and they respond by transiently producing matrix until repair is completed.

ECM can be subdivided into two types, stromal matrix and basement membrane, the focus of this study. Basement membranes are thin sheets that underlie epithelia and wrap around muscles and organs. Their most abundant structural protein is Collagen IV (Col4)7,8, a heterotrimer that self-assembles in vitro into networks and provides structural support9. Self-assembly raises questions about the nature of basement membrane repair. Is there a continuing self-assembly process for maintenance that also functions passively to repair damage? Or is repair an active process, with cells sensing damage and directing repair?

Basement membranes are ancient, arising along with multicellularity itself10. Given the evolutionary conservation, Drosophila offers an excellent model to address questions of basement membrane homeostasis and repair. Flies have the same basement membrane structure and composition as mammals, with all the main components but fewer family members. There is only one type IV collagen (Col4) heterotrimer composed of the two collagen subunits Col4a1 and Col4a2 (aka Viking, Vkg); there are two laminin heterotrimers, one nidogen gene, and one perlecan gene11. Functional GFP-tagged alleles of Vkg offer tremendously powerful reagents for imaging and genetics12. We use the Drosophila posterior midgut as a model to analyze basement membrane repair. The fly gut is a monolayer epithelium derived from stem cells that generate two lineages, enterocytes and enteroendocrine cells, with intermediates in between13–15. Between the epithelium and the surrounding peristalsis muscles there is basement membrane, and it is continuous with the basement membrane enveloping the muscles (Fig. 1A). We damage the basement membrane by feeding the flies dextran sodium sulfate (DSS), which gets visibly lodged in the gut basement membrane, fractures its structure, and reduces its stiffness16. After stopping DSS feeding, basement membrane repair occurs within two days, providing a temporal window for analyzing repair16.

Figure 1. “Matrix mender” gut cells upregulate Col4 after basement membrane damage. (A) Left: Drosophila midgut.

Figure 1.

(A) Left: Drosophila midgut. The gut tube is covered with peristalsis muscles (magenta) wrapped in basement membrane (green). Underneath the muscle layer, the gut monolayer epithelium (blue nuclei/DAPI) comprises absorptive enterocytes (blue), stem cells (brown), enteroblasts (gray), and enteroendocrine cells (red), all sitting on basement membrane continuous with that of the muscles (green). Scale bars, 10 μm.

Right: DSS damage. DSS (orange dots) is ingested, transported through the enterocytes, and deposited in the underlying basement membrane where it fractures the basement membrane making it less stiff, resulting in visibly dysmorphic muscles (described in Howard et al16). Basement membranes and muscle shapes are fully repaired 2 days after DSS is removed. Both repair and maintenance of the basement membrane require basement membrane components and regulators (see Fig. S1 and Howard et al16 for data). Scale bars, 10 μm.

(B-G) Collagen IV (Vkg) in the gut basement membrane comes from the fat body in undamaged conditions. B depicts the experiment knocking down GFP of Vkg-GFP specifically in the fat body with c564-Gal4, data in C (en face view). After DSS damage, some gut Vkg-GFP came from another source (D,E). Each dot in E represents a gut. Mean +/− SEM, significance by t-test. Cross-sections (F,G) show the new Vkg source deposits Vkg-GFP between the epithelium and the muscles. Full data set for fat-body knockdown and the specificity of the c564-Gal4 driver shown in Fig. S2. Scale bars, 10 μm.

(H-K) Col4 reporter Cg>GFP identified unknown cells that respond to DSS in the gut. Anterior (left), posterior (right). Posterior R4 midgut is the focus of this study. Scale bar, 100 μm in H,J, scale bar, 20 μm in I,K.

(L-M) Collagen-expressing cells (“matrix menders”) increased in number during basement membrane damage, then decreased during repair (L). Shaded regions represent SEM. 5–21 guts analyzed per timepoint and treatment, see Fig. S3A for dataset. Significance by t-test. In addition to number, expression level increased after DSS (M), see arrowheads in I,K. Each dot represents a gut. Mean +/− SEM, significance by t-test.

(N-Q) Feeding bleomycin did not damage the basement membrane, as indicated by muscle shape (N-P), even though it did cause DNA damage and stem cell proliferation (see Fig. S3B,C). Bleomycin did not induce Cg>GFP+ matrix menders (Q). Mean +/− SEM, significance by t-test. Scale bar, 10 μm.

(R-U) Feeding paraquat damaged the basement membrane, indicated by changes in muscle shape aspect ratio (R-T). Paraquat induced Cg>GFP+ matrix menders (U). Mean +/− SEM, significance by t-test. Scale bar, 10 μm.

In this study, we find that genes encoding all major basement membrane components are required for both repair and maintenance. However, after damage, the source of Col4 for the midgut changes: without damage, Col4 originates from the fat body, but after damage, Col4 is transiently expressed locally by gut epithelial cells we call “matrix menders,” which are specialized short-lived enteroblasts. Knocking down Col4 in enteroblasts specifically inhibits gut basement membrane repair. Damage induces matrix menders via the mechanosensitive channel Piezo, expressed in neighboring intestinal stem cells (ISCs). Indeed, specifically reducing basement membrane stiffness by reducing Col4 crosslinking is sufficient to induce matrix-mender cells in a Piezo-dependent manner. Our results suggest that epithelial stem cells surveil basement membrane integrity by monitoring its stiffness, responding to defects by generating short-lived repair cells.

Results

Basement membrane repair and maintenance require many of the same components.

DSS directly damages the posterior midgut basement membrane of Drosophila16. After ingestion, DSS is transported through enterocytes to accumulate in the adjacent basement membrane (Fig. 1A). This mechanism is different from mice, where DSS is excluded by the intact epithelium16,17. In flies, DSS damages basement membranes, making them visibly fractured by TEM, less dense as measured with fluorescence and super-resolution microscopy, and less stiff as measured in a tensile strain assay16. The basement membrane mechanical damage changes the shape of the gut peristalsis muscles, which are outlined by Col4 (Fig. 1A, right side). A similar muscle shape is observed in fly guts lacking the Col4 crosslinking enzyme Peroxidasin (Pxn)16,18,19, and these basement membranes also have reduced tensile stiffness16,19,20. In both instances, gut muscles become dysmorphic when enveloped by weakened basement membrane, and thus we can infer basement membrane stiffness from gut muscle shape, measured as aspect ratio. Importantly, two days after removing DSS and feeding flies regular food, there is full restoration of basement membrane structure and the muscle shape16.

Previously, we determined that repair after DSS damage requires synthesis of new basement membrane proteins, including vkg, LamininB1, and Pxn16. We asked whether other conserved basement membrane components were required for repair, targeting Perlecan (trol), Nidogen (Ndg), and the Col4 extracellular chaperone, SPARC. We used two different RNAi lines to knock them down everywhere with TubP-Gal4, initiating knockdown in 6-day old adult females. After two days, flies were fed DSS for two days, then repair was allowed for two days (6 days total knockdown). By analyzing muscle shape, we found trol, Ndg, and SPARC were all required for basement membrane repair (Fig. S1A–F). The requirement for new basement membrane proteins indicates that damaged basement membranes are replaced with new matrix. These same proteins are required for basement membrane maintenance without externally applied damage, as knocking down trol, Ndg, or SPARC for 10 days in adults caused dysmorphic gut muscles (Fig. S1K–P), whereas knocking down non-matrix extracellular proteins Gbp1 or Gbp221 had no effect (Fig. S1G–J, Q–T). From this, we conclude that although basement membrane is replaced during normal homeostatic maintenance, it is replaced faster during repair.

Collagen IV is upregulated in matrix mender cells following damage.

Although basement membranes are maintained throughout the body, we expect damage-triggered repair to be a localized process. The Col4 in many Drosophila tissues originates from a distant organ, the fat body22,23, and we found that was true for the undamaged gut by expressing tissue-specific dsRNA against GFP in vkg-GFP/vkg+ heterozygotes. vkg-GFP/vkg+ gut basement membranes fluoresce green, but when dsRNA against GFP was expressed ubiquitously with TubP-Gal4, there was virtually no gut fluorescence, demonstrating the effectiveness of GFP knockdown (Fig S2 A–D). Importantly, the GFP-knockdown animal is functionally equivalent to a vkg heterozygote, viable and healthy, so we do not expect to trigger any compensatory mechanisms23. When GFP was knocked down specifically in the fat body with c564-Gal4, gut GFP fluorescence was also extremely low, similar to ubiquitous GFP knockdown (Fig. 1B,C and Fig. S2A–D; specificity of c564-Gal4 shown in Fig. S2I,J), indicating most of the midgut Col4 originates from the fat body, a distant source. However, when these animals were fed DSS to damage the gut basement membrane, the gut GFP fluorescence increased significantly, indicating that during repair Col4 was coming from another source besides the fat body (Fig. 1C–G; see also Fig. S2E–H). In cross-section, the DSS-induced Vkg-GFP was deposited between the gut epithelium and peristalsis muscles, suggesting a repair-specific local source of Col4 in the gut epithelium (Fig. 1F,G).

To identify a local source of Col4, we used Cg-Gal4, a reporter of Collagen IV gene expression in which Gal4 is under control of a cloned collagen enhancer whose genomic location is between the head-to-head promoters of the two collagen genes Col4a1 and vkg24. In control guts, Cg>GFP was very faintly expressed in only a few cells, but after 2 d of DSS damage the number and intensity of Cg>GFP cells in the gut increased substantially, from 1.8% to 5.7% of epithelial cells in the posterior midgut (R4) (Fig. 1H–M, Fig. S3A). Analyzing their numbers over time, we found that Cg>GFP cells increased after only one day of DSS feeding, peaked after the second day of DSS, and then subsided after DSS is removed. Interestingly, Cg>GFP expression was no longer observed 2 days after DSS removal, when the gut basement membrane was repaired (Fig. 1L). We dubbed these Cg>GFP cells “matrix menders” because they express Col4 strongly in response to basement membrane damage but not after repair is complete. Analyzing other genes required for basement membrane repair, we found that reporters for Pxn and Laminin expression (Pxn>GFP and LanB1>GFP) were active in the gut without basement membrane damage; the number of Pxn-expressing cells doubled after damage, but the number of LanB1-expressing cells did not increase (Fig. S4).

Matrix menders arise in response to basement membrane damage rather than epithelial damage.

In addition to damaging basement membranes, DSS also damages cells25. To assess the damage profile that induces matrix menders, we tested two additional drugs known to damage the fly gut. Bleomycin is a DNA-damaging agent that targets enterocytes, causing tissue disorganization, cell loss, and a resulting increase in stem cell divisions25. After feeding bleomycin for 2 days, DNA damage was evident by anti-H2AvD staining, and increased stem cell divisions were evident by anti-pH3 staining (Fig. S3B,C), yet the basement membranes remained undamaged as determined by muscle shape, and matrix mender cells were not evident (Fig. 1N–Q). Next we tested paraquat, which damages the fly gut by inducing reactive oxygen species and increasing stem cell divisions26,27. Feeding flies paraquat for 16 h, reported to maximize damage without causing lethality26, caused unexpected basement membrane damage, evident by altered muscle shape, and it significantly induced matrix menders (Fig. 1R–U), similar to the levels seen in response to DSS. These results indicate that matrix mender cells arise specifically to basement membrane damage, rather than epithelial damage.

Matrix menders are a subset of enteroblasts.

The cell types of the fly posterior midgut are well known (Fig. 2A) and can be identified with established cell markers. In DSS-fed guts, the Cg>GFP matrix menders did not express the intestinal stem cell marker Dl, but interestingly, about 75% of matrix menders were adjacent to Dl+ stem cells (174/236), suggesting that matrix menders are either enteroblasts or pre-enteroendocrine cells. Nearly all Cg>GFP matrix menders were positive for the enteroblast marker Su(H)GBE-lacZ, indicating that matrix menders are enteroblasts (Fig. 2B,C). Not all enteroblasts are matrix menders, however, as only 43% of the Su(H)GBE-positive enteroblasts were also positive for Cg>GFP (Fig. 2C). In guts that were not damaged by DSS, Cg-expressing cells were still enteroblasts (81%) but fewer enteroblasts expressed Cg (21%) (Fig. 2C). Thus, some but not all enteroblasts are matrix menders. The number of enteroblasts is known to increase in response to DSS25, and we found that after 2 d of DSS, the number of enteroblasts increased from an average of ~7/100 cells to ~11/100 cells (Fig. 2D and Fig. S6A). Nearly all this increase in enteroblasts can be accounted for by the increase in collagen-expressing matrix mender cells (Fig. 1L).

Figure 2. Matrix menders are a subset of enteroblasts that provide Col4 necessary for repair and are short-lived.

Figure 2.

(A)Lineage of gut epithelial cell types.

(B)Matrix menders (Cg>GFP, green) expressed an enteroblast marker (Su(H)GBE-lacZ, magenta). Scale bar, 10 μm.

(C)In both damaged and undamaged conditions, nearly all matrix menders were enteroblasts expressing Su(H)GBE-lacZ, but not all enteroblasts were matrix menders expressing Cg>GFP. After damage, more enteroblasts expressed Cg>GFP, evaluated by Fisher’s exact test. Number of cells scored is indicated.

(D)Total enteroblasts increased in response to DSS, SEM indicated. Each dot represents 5–19 guts. Complete dataset in Fig. S6A.

(E)Repair required Col4 expressed from enteroblasts. Col4a1 was knocked down in different tissues, and adult gut muscle shape was compared in damaged-and-repaired guts to unchallenged guts. When Col4a1 was fully expressed (first two columns), nearly all guts had undamaged healthy basement membranes, both unchallenged and after repair. Col4 from the fat body was required for development and/or homeostasis, as guts appeared damaged even without challenge. Enteroblast Col4 was required specifically for repair. Col4 was not required from enterocytes. Numbers of guts evaluated is shown at column base. Guts were scored blinded to sample identity. Knock-down in other gut cell types and knockdown of vkg confirmed that Col4 is specifically required from enteroblasts for repair, see Fig. S5A–C. Significance evaluated by Fisher’s exact test.

(F-H) Dynamics of matrix mender cells during and after collagen expression determined by G-TRACE. Overview (F) adapted from Evans et al.29 DSS increased the number of real-time Cg-expressing cells (RFP+, magenta); after repair, Cg-expressing RFP+ cells declined quickly, but most did not transition into lineage traced GFP+ cells (green). Cells expressing both RFP+ and GFP+ were counted only as RFP+ (magenta) to count each cell only once. Complete dataset in Fig. S6C,D.

I,J) Cg>GTRACE real-time expressing cells (RFP+, magenta) underwent cell death, expressing Cleaved Caspase 3. Scale bar, 20 μm. Cell death of Cg-expressing cells was also observed without DSS, see Fig. S6G. Shading represents SEM in G,H,J.

Collagen IV from enteroblasts is required for repair.

We wanted to determine if the Col4 from matrix-mender enteroblasts was important for repair, but unfortunately knocking down Col4 with Cg-Gal4 would target collagen in other tissues, such as the fat body. Instead, we knocked down Col4a1 in specific cell types with different Gal4 drivers, including the enteroblast driver Su(H)GBE-Gal4 (Fig. 2E). With collagen removed from each potential source, we compared gut morphology in undamaged guts to those that were DSS-damaged and allowed to repair, scoring samples blinded to identity or treatment. When Col4a1 was knocked down in the fat body with c564-Gal4, many guts had dysmorphic muscles even without damage, and morphology was similar when treated with DSS and allowed to repair; these results indicate that Col4 from the fat body is important for gut basement membrane development or homeostasis as expected, but it is not specific for repair. We next knocked down Col4a1 in enteroblasts with Su(H)GBE-Gal4, which includes matrix menders; although Su(H)GBE is expressed in some larval tissues including wing and tracheae28, it is not expressed in known collagen source tissues (adult fat body, Malpighian tubules, or ovary, Fig. S5D–G). Gut muscle morphology was normal without DSS treatment, but repair was severely compromised, with 70% remaining damaged two days after removing DSS. To confirm the specificity of RNAi-mediated knockdown, we knocked down vkg (Col4a2) with Su(H)GBE-Gal4, and this also interfered specifically with repair and not development (Fig. S5A,B). These results indicate that Col4 from the matrix mender cells is required specifically for midgut basement membrane repair. When Col4a1 was knocked down with Myo1a-Gal4 in enterocytes, the terminally differentiated cell type arising from enteroblasts, guts appeared like no-knockdown controls, normal both without damage and after repair; these results indicate that after differentiation, enterocytes do not supply Col4 for development, homeostasis, or repair. We also knocked down Col4a1 in the intestinal stem cells and enteroendocrine cells (Fig. S5C), and morphology appeared similar without damage and after repair. Only the collagen from enteroblasts is specific for gut basement membrane repair.

Most matrix menders are removed from the gut epithelium after repair.

We were interested in what happened to the matrix mender cells after repair, when they were no longer detectable. Did they turn off collagen expression, did they differentiate, or did they die? To address this question, we performed lineage tracing of the Cg-Gal4 expressing matrix menders using the G-TRACE system29, in which cells actively expressing Col4 were labeled with nlsRFP and cells that previously expressed Col4 were permanently labeled with nlsGFP (Fig. 2F). We analyzed the number and fate of collagen-expressing cells in the gut, and as expected, the RFP+ cells behaved like the Cg>GFP matrix mender cells, except that their numbers peaked slightly higher and two days later (compare Fig. 2H to Fig. 1L). Although the difference is explained by nuclear RFP persisting longer than cytoplasmic GFP, it also indicates that matrix mender cells persist after they turn off collagen expression. After the peak, the number of RFP+ cells decreased rapidly. We expected that the RFP+ cells would transition into GFP+ lineage cells, because enteroblasts can remain dormant for weeks before differentiating into enterocytes in a healthy gut epithelium30. Contrary to our expectations, however, as RFP+ cells disappeared, the corresponding pulse of GFP+ cells was much smaller (Fig. 2H). These results indicate that most matrix menders are removed from the gut epithelium after repair is complete. Matrix menders are capable of differentiating into enterocytes, however, as the enterocyte-specific antibody Pdm1 stained about 15% (50/340) of GFP+ lineage-expressing cells after 2 days recovery but did not stain RFP+ collagen-expressing cells (Fig. S6F,G). Matrix menders never became enteroendocrine cells, as no G-TRACE labeled cells were labeled with anti-Prospero (Fig. S6E). To determine if some matrix menders were dying, we stained Cg>G-TRACE flies with anti-Cleaved Caspase 3 (CC3). In vehicle-treated guts, we found ~9%of RFP+ matrix mender cells were positive for the cell death marker (Fig. S6H). In guts recovering from DSS damage, the percentage of dying matrix menders increased over time: at 0 d post DSS, 5% were labeled as dying, but by 4 d post DSS feeding (2 d recovery) 15% RFP+ cells were labeled as dying (Fig. 2I,J and Fig S6H). Although kinetic analysis is limited in fixed samples, it appears that most matrix menders do not differentiate into enterocytes and are short-lived, a property of enteroblasts generally after DSS treatment (Fig. S6B). Taken together, these results indicate that as repair is completed, matrix menders first turn off collagen, then a few differentiate while most die.

Piezo is required for matrix menders to arise in response to damage.

How does the gut sense damage to turn on Col4? We previously demonstrated that DSS damage makes basement membranes less stiff, with a reduced elastic modulus measured in a quantitative tensile strain assay16, and we envision that most types of matrix damage would result in reduced stiffness (increased flexibility). Thus, we reasoned that basement membrane damage might be detected by a mechanosensitive mechanism such as the ion channel Piezo, known to be active in the fly gut13,31,32. To test Piezo’s role in basement membrane repair, we analyzed PiezoKO null flies, which are homozygous viable. After damaging with DSS, PiezoKO flies were unable to repair basement membranes (Fig. 3A–C), but unlike other matrix repair genes (Fig. S1), Piezo was not required for basement membrane maintenance (Fig. 3D–F). Analysis of a second independent mutation, PiezoMI04294, confirmed its unusual repair-specific function (Fig. S7A–F). To determine if Piezo is required for detection of basement membrane damage, we quantified Cg>GFP matrix mender cells in PiezoKO versus control midguts after DSS damage. Piezo was required for matrix mender induction: in controls, 5.8% of epithelial cells were matrix menders, but in PiezoKO only 1.9% were and their Cg expression level was reduced (Fig. 3G–J). Thus, Piezo is required for matrix menders to arise in response to damage.

Figure 3. Piezo is required for basement membrane repair and for matrix menders to arise and is expressed in the intestinal stem cells.

Figure 3.

(A-F) Piezo was required for basement membrane repair but not maintenance in adult guts. See Fig. S7A–F for confirmation with another allele. Mean +/−SEM. Significance by t-test. Scale bar in B for A-E, 10 μm.

(G-J) Piezo was required for Cg>GFP matrix mender cells to arise in response to DSS damage. Both the number and expression level of Cg>GFP cells were significantly reduced in PiezoKO flies. Each dot represents a gut (I,J). Mean +/−SEM. Significance by ANOVA (I) and t-test (J). Scale bar, 20 μm.

(K-O) Piezo-transcriptional reporter (PiezoKI-Gal4, green) was expressed in Dl+ intestinal stem cells (magenta), flies fed normal food. Almost all Piezo+ cells were Delta+ intestinal stem cells, yet only 36% of Dl+ intestinal stem cells express Piezo. For Venn diagram, the circle size and amount of overlap are representative. Scale bars, 10 μm in K, 5 μm in L.

(P-Q) Cg>GFP matrix mender cells (green) were adjacent to intestinal stem cells (anti-Delta, magenta). Scale bar, 10 μm. The number of cells analyzed is reported at column base for M,N,Q.

Piezo is expressed in a subset of intestinal stem cells.

For Piezo to monitor basement membrane damage, it must be present prior to damage. To localize Piezo, first we tried a functional genomic GFP-Piezo fusion protein reported to be extremely dim in neurons33, but we were unable to detect GFP in the gut. Next, we turned to a Gal4-based Piezo>GFP transcriptional reporter, expressed outside the gut epithelium in tracheal cells that penetrate the gut muscles (Fig. S7G,H) and in small cells within the gut epithelium. On regular food, 93% of Piezo>GFP cells were positive for the intestinal stem cell marker Dl but only 36% of Dl+ stem cells expressed Piezo (Fig. 3K–O). Our results are similar to a previous report that Piezo is expressed in 40% of intestinal stem cells13. We found that stem cells are often adjacent to matrix menders (Fig. 3P–Q), suggesting that stem cell divisions give rise to matrix menders in a Piezo-dependent manner.

Piezo detects decreased basement membrane stiffness to activate matrix menders.

What aspect of basement membrane damage does Piezo detect? Piezo is a transmembrane ion channel activated by mechanical stretch to the plasma membrane34, and the plasma membranes of intestinal stem cells are in direct contact with the underlying basement membrane35. A damage-induced loss of tensile stiffness in the basement membrane is expected to transfer more tension to neighboring plasma membranes, resulting in membrane stretching and Piezo activation. Thus, we hypothesized that Piezo detects basement membrane damage via its loss of stiffness. As a test, we specifically reduced basement membrane stiffness in otherwise healthy and undamaged animals, by inhibiting the Col4 crosslinking enzyme Peroxidasin (Fig. 4A). Peroxidasin mouse mutant tissue has reduced basement membrane stiffness (elastic modulus), measured as increased deformation (stretch) in response to tension20. Using the same quantitative tensile strain assay, we recently reported that inhibiting Peroxidasin in wild-type adult Drosophila by feeding 100 μM of the suicide substrate phloroglucinol (PHG) for 5 days decreases basement membrane stiffness by about half19. The PHG-induced decrease in basement membrane stiffness was evident in the muscle aspect ratio, both at 100 μM and even more strongly at 5 mM, indicating a dose response (Fig. 4B–D). Excitingly, 100 μM PHG alone without other damage induced matrix menders (3.5% of gut epithelial cells), and 5 mM PHG induced even more matrix menders (5.3%), at a level similar to DSS induction (Fig. 4E,F,H, compare to Fig. 1L and S3A). Thus, the loss of stiffness specifically activated matrix mender cells. Further, the mechanical induction of matrix menders required Piezo, as PHG-induced matrix menders were completely suppressed in the PiezoKO background (Fig. 4G,H). These results indicate that Piezo responds to the reduction in basement membrane stiffness to give rise to collagen-expressing matrix mender cells, positioned adjacent to the basement membrane (Fig. 4I,J) where they can effect repair.

Figure 4. Piezo detects decreases in basement membrane stiffness to activate matrix menders.

Figure 4.

(A) PHG inhibits collagen IV crosslinking enzyme Pxn.

(B-D) Feeding PHG reduced basement membrane stiffness in a dose-dependent manner, evidenced by muscle aspect ratio. Quantitative tensile stiffness measurements were reported previously by Peebles et al.19 Significance evaluated by ANOVA. Mean +/−SEM. Scale bar, 10 μm.

(E-F) Reducing collagen crosslinking induced matrix mender cells. Scale bar, 20 μm.

(G-H) Piezo was required for matrix mender cells to arise in response to reduced collagen crosslinking. Each data point represents an individual gut. Mean +/−SEM. Significance by ANOVA.

(I-J) Matrix mender cells have extensive contact with basement membrane, both with and without DSS (no recovery), positioning them well to repair it. Collagen is labeled with the triple-helix binding protein, CNA35 (green). Scale bar, 10 μm.

Discussion

Using the basement membrane around the Drosophila posterior midgut as an experimental model, we found that basement membrane damage gives rise to and is repaired by a distinct set of local epithelial cells, matrix mender cells, defined by their expression of the Collagen IV reporter Cg-Gal4. Matrix mender cells are a subset of enteroblasts that supply Col4 specifically required for basement membrane repair. After repair is completed, matrix menders turn off collagen expression, and most of them die. In contrast, Col4 is a long-lived molecule, and too much leads to fibrosis. Perhaps the fly gut avoids fibrosis by making a long-lived molecule from a short-lived cell.

In addition to the data shown here, supporting data for enteroblasts expressing Col4 come from mining published RNA sequencing data from single gut nuclei: transcripts for both Col4 subunits, Cg25C and Vkg, were identified almost exclusively in cells called progenitors of enterocytes (proECs), defined as a subset of enteroblasts; further, after DSS treatment, the number of proECs expressing the collagen transcripts doubled, results similar to our findings but using very different methods to identify collagen expression and cell identity36,37.

We expect that even in undamaged control guts there may be intrinsic low levels of basement membrane damage, given the proximity of the gut to an unpredictable external environment and the mechanical wear and tear of peristalsis, and this low level of damage would induce a weak matrix-mender response. Indeed, in undamaged guts, about 20% of enteroblasts or 1.8% of epithelial cells express Cg>GFP, at generally low levels; our various control data show this to be a somewhat variable number, consistent with stochastic low levels of matrix damage. After experimentally induced basement membrane damage, the numbers of matrix mender cells increase dramatically: intestinal stem cell divisions generate more total enteroblasts, and a greater percentage of them express collagen (43%), with the result that about 6% of total epithelial cells express collagen, generally at high levels.

How is matrix damage detected to give rise to cells that repair it? Matrix menders arise in response to three independent challenges that damage the basement membrane – DSS, paraquat, and PHG – but not in response to the DNA damaging agent bleomycin. Although DSS and paraquat may cause non-specific damage, PHG is highly specific, reducing Col4 covalent crosslinking18,38 and decreasing basement membrane stiffness in response to tensile strain, meaning that the basement membrane will stretch more in response to a given pulling force or tension16,19. The gut is a mechanically active environment, and increased basement membrane stretching would stretch neighboring plasma membranes in the gut epithelium, activating Piezo, a stretch-activated transmembrane ion channel required specifically for matrix menders to arise and for basement membrane repair. Unlike other genes we identified that are required for repair – Nidogen, Perlecan, Laminin, Collagen IV, Peroxidasin, and SPARC – Piezo is not required for basement membrane maintenance but repair only. Our data indicate that Piezo detects reductions in basement membrane stiffness and signals for the generation of matrix menders.

Simple and general model of basement membrane repair

Our data are consistent with a simple stem-cell based model of basement membrane repair: intestinal stem cells directly monitor tissue stiffness, with matrix damage allowing greater cell stretching, activating Piezo. As a cation channel, Piezo activation increases intracellular calcium levels, and sustained cytoplasmic calcium is sufficient to induce intestinal stem cell proliferation39,40. Thus, we propose that mechanically activated stem cells give rise to matrix menders that express and secrete Col4 locally, restoring the structure of the basement membrane. Their job complete, these cells turn off collagen expression and most of them die. Very recently it was shown that stiffness regulates mouse intestinal stem cells via Piezo41, and this may represent part of the mechanism we show here, as Piezo and basement membrane components are all highly conserved. In addition to being generalizable to other animals, our basement membrane repair model may apply to other epithelial tissues, as most epithelial stem cells contact basement membranes.

Limitations of the Study

It remains unclear where Piezo detects basement membrane stiffness. Piezo is expressed in Dl+ intestinal stem cells, but its function there has not been demonstrated as we have not had success with Piezo conditional knockdown (i.e. ubiquitous knockdown does not reproduce the mutant phenotype). Further, although it is likely that Piezo+ stem cells divide to give rise to daughter cells that are matrix menders expressing Col4, this has not yet been demonstrated and other mechanisms of activating Col4 expression have not been ruled out. Nevertheless, our data demonstrate a two-part repair detection and repair mechanism in the Drosophila gut: (1) mechanical surveillance of basement membrane stiffness by Piezo, which activates (2) Col4-based repair mediated by local epithelial cells.

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Andrea Page-McCaw (andrea.page-mccaw@vanderbilt.edu)

Materials availability

Any requests for resources and reagents should be directed to the lead contact.

Data and code availability

  • Microscopy data reported in this paper will be shared by the lead contact upon request.

  • All original code has been archived at Zenodo (https://doi.org/10.5281/zenodo.14659622) and is publicly available as of the date of publication.

  • Any additional information required to reanalyze the data reported in this paper is available from the Lead Contact upon request.

Star Methods

EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS

Fly husbandry

Flies were maintained on cornmeal-molasses food at 25 °C unless otherwise specified. Adult-onset RNAi-based gene knockdown was done under Gal80ts control, with flies maintained at 18 °C until they eclosed. Female flies were then aged at 18 °C until they were 6-day adults (mated) before moving them to 29 °C to activate Gal4. Each experiment contains data from at least two independent crosses. For the list of fly stocks, please refer to Key Resource Table.

Key resources table

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
Mouse anti-β gal Developmental
Studies Hybridoma
Bank
Cat# 40–1a;
RRID:AB_528100
Rabbit anti-Cleaved Caspase 3 Cell Signaling
Technology
Cat# 9661;
RRID:AB_2341188
Mouse anti-Delta Developmental
Studies Hybridoma
Bank
Cat# SA4;
RRID:AB_2056641
Rabbit anti-H2AvD Rockland Cat# 600-401-914;
RRID:AB_828383
Rabbit anti-pH3 Millipore Cat# 06-570;
RRID:AB_310177
Mouse anti-Prospero Developmental
Studies Hybridoma
Bank
Cat# MR1A;
RRID:AB_528440
Rabbit anti-Pdm1 Yang Xiaohang n/a
Cy3 goat anti-mouse IgG1 Jackson
ImmunoResearch
Labs
Cat# 115-165-205;
RRID:AB_2338694
Cy3 donkey anti-rabbit IgG Jackson
ImmunoResearch
Labs
Cat# 711-165-152;
RRID:AB_2307443
Cy5 goat anti-mouse IgG Jackson
ImmunoResearch
Labs
Cat# 115-175-205;
RRID:AB_2338715
Cy5 donkey anti-rabbit Jackson
ImmunoResearch
Labs
Cat# 711-175-152;
RRID:AB_2340607
Experimental models: Organisms/strains
D. melanogaster: VkgGFP791:
y w; vkgP{GFP791, w+}
Carnegie Protein trap
library via Sally Horne-Badovinac
CC00791
UAS-GFPRNAi:
w[1118]; P{w[+mC]=UAS-GFP.RNAi.R}142
Bloomington
Drosophila Stock
Center
9330
VkgGFP, UAS-GFP RNAi /CyO, mCh this study n/a
Cg-Gal4:
w[1118]; P{w[+mC]=Cg-GAL4.A}2
Bloomington
Drosophila Stock
Center
7011
UAS-GFP:
w[*]; P{w[+mC]=UAS-GFP.S65T}eg[T10]
Bloomington
Drosophila Stock
Center
1522
Su(H)GBE-lacZ:
w[*]; l(2)*[*]/CyO, P{ry[+t7.2]=en1}wg[en11];
P{ry[+t7.2]=Ddc.E(spl)m8-HLH-lacZ.Gbe}3
Bloomington
Drosophila Stock
Center
83352
Su(H)GBE-Gal4, UAS-mCD8GFP:
w[*]; P{w[+mC]=Su(H)GBE-GAL4}2, P{w[+mC]=UAS-mCD8::GFP.L}LL5, P{UAS-mCD8::GFP.L}2/CyO
Bloomington
Drosophila Stock
Center
83377
UAS-Cg25cRNAi:
w1118; P{GD12784}v28369
Vienna Drosophila
Resource Center
28369
VkgRNAi (RNAi #1):
P{KK111668}VIE-260B
Vienna Drosophila
Resource Center
106812
VkgRNAi (RNAi #2):
y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.HMC02400}attP2
Bloomington
Drosophila Stock
Center
50895
c564-Gal4:
w[1118]; P{w[+mW.hs]=GawB}c564
Bloomington
Drosophila Stock
Center
6982
Myo1a-Gal4:
w*; P{w+mW.hs=GawB}NP0001 / CyO, P{w-=UAS-lacZ.UW14}UW14
Drosophila Genomics
Resource Center
112001
UAS-GTRACE:
w[*]; P{w[+mC]=UAS-RedStinger}6, P{w[+mC]=UAS-FLP.Exel}3, P{w[+mC]=Ubi-p63E(FRT.STOP)Stinger}15F2
Bloomington
Drosophila Stock
Center
28281
PiezoKO:
w[*]; PBac{w[+mC]=RB5.WH5}Piezo[KO]
Bloomington
Drosophila Stock
Center
58770
Piezo KO , VkgGFP 791 this study n/a
Piezo KO , Cg-Gal4/CyO this study n/a
Piezo KO ; UAS-GFP/TM3 this study n/a
PiezoKI-Gal4:
w[*]; TI{GAL4}Piezo[KI]
Bloomington
Drosophila Stock
Center
78335
UAS-myr-RFP:
w[*]; P{w[+mC]=Cg-GAL4.A}2, P{w+mC]=UAS-myr-mRFP}1/CyO; P{w[+mC]=UAS-GFP.RNAi.R}142
Bloomington
Drosophila Stock
Center
63147
VkgGFP 791 ; tubGal4, tubGal80 ts /S-T this study n/a
UAS-PerlecanRNAi (RNAi #1):
P{KK110494}VIE-260B
Vienna Drosophila
Resource Center
108157
UAS-PerlecanRNAi (RNAi #2):
y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.GL01153}attP2
Bloomington
Drosophila Stock
Center
42783
UAS-NidogenRNAi (RNAi #1):
y[1] v[1]; P{y[+t7.7]
v[+t1.8]=TRiP.HMJ24142}attP40/CyO
Bloomington
Drosophila Stock
Center
62902
UAS-NidogenRNAi (RNAi #2):
P{KK109625}VIE-260B
Vienna Drosophila
Resource Center
102310
UAS-SPARCRNAi (RNAi #1):
P{KK100566}VIE-260B
Vienna Drosophila
Resource Center
103707
UAS-SPARCRNAi (RNAi #2):
y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.HMS02133}attP40
Bloomington
Drosophila Stock
Center
40885
UAS-Gbp1RNAi:
P{KK110262}VIE-260B
Vienna Drosophila
Resource Center
108755
UAS-Gbp2RNAi:
w[1118]; P{GD4931}v16696
Vienna Drosophila
Resource Center
16696
Pxn-Gal4/TM3:
y[1] w[67c23]; Mi{GFP[E.3xP3]=ET1}Pxn[MB00459]
Bloomington
Drosophila Stock
Center
22805
LanB1-Gal4/CyO:
w[1118]; PBac{w[+mC]=IT. GAL4}LanB1[0987-G4]/CyO
Bloomington
Drosophila Stock
Center
63941
Tubulin-Gal4:
y[1] w[*]; P{w[+mC]=tubP-GAL4}LL7/TM3, Sb[1] Ser[1]
Bloomington
Drosophila Stock
Center
5138
Prospero-Gal4:
w[*]; P{w[+mC]=GAL4-pros.MG}3
Bloomington
Drosophila Stock
Center
80572
Btl-Gal4 Greg Beitel
(Northwestern University)
FBti0148919
TubGal80ts/CyO; DlGal4/TM6B Bruce Edgar
(University of Utah)
FBal0256627
PiezoMI0429:
y[1] w[*]; Mi{y[+mDint2]=MIC}Piezo[MI04294]
Bloomington
Drosophila Stock
Center
37433
Oligonucleotides
PCR PiezoKO F: GAGTGAGCTGATACCGCTCGC this study n/a
PCR PiezoKO R: CAGCGACGGATTCGCGC this study n/a
Software and algorithms
ImageJ 1.53v National Institutes of Health https://imagej.net/sof tware/fiji/
Graphpad Prism 9.5 https://www.graphpad.com/
Seedwater Segmenter Mashburn et al. 201242 n/a
Mathematica Wolfram Inc. https://www.wolfra m.com/mathematic aL
Original code for muscle cell shape analysis This study https://doi.org/10.5 281/zenodo.l46596 22

METHOD DETAILS

Confirming PiezoKO using PCR

Because PiezoKO flies have no obvious phenotype, we verified the presence of the deletion by PCR in the starting stock and in recombinants. Primers were designed and optimized against the Piggybac insertion PBac{WH}CG8486-f02291 in PiezoKO animals to confirm the loss of Piezo using the following primers – F: GAGTGAGCTGATACCGCTCGC, R: CAGCGACGGATTCGCGC. OneTaq2x Master Mix with standard buffer was used. The following PCR conditions were used – Initial Denaturation: 94 °C, 30 sec; denaturation: 94 °C, 30 sec; annealing: 65 °C, 60 sec; extension: 68 °C, 45 sec (30x cycles); final extension: 68 °C, 5 minutes.

DSS feeding

All DSS feeding experiments used mated female flies aged 3–5 d after eclosion before feeding DSS. Flies utilizing the Gal80ts system were moved to 29 °C for 2 days to ensure the Gal4 was active prior to starting DSS feeding treatments. Flies not utilizing the Gal80ts system were aged 3–5 days at 25 °C prior to starting DSS feeding treatments. DSS was administered as described in Amcheslavsky et al.25 and Howard et al.16: a 2.5 cm × 3 cm piece of chromatography paper (Whatman 3030–861, Grade 3 MM CHR) was placed in an empty vial. 500 μl of a 5% sucrose solution with or without 3% 36–50 kDa DSS (dextran sulfate sodium salt colitis grade, MP Biomedicals, CAS number 9011-18-1, 36,000 – 50,000 MW) was added to the paper in the vial. Female flies were anesthetized and carefully placed in the vial. Flies were added to new vials with fresh media each day for 2 days. For recovery experiments, flies were transferred to a vial containing standard cornmeal-molasses food for 2 days. For imaging in 3 dimensions (Z-stacks), flies on standard cornmeal-molasses food were fed 5% sucrose for 4 hours before dissection to reduce gut autofluorescence from the food.

Phloroglucinol feeding

PHG was fed to flies by dissolving it in food prepared without any cornmeal, freshly made with or without 100 μM or 5 mM Phloroglucinol (PHG) (Sigma-Aldrich, CAS number 108-73-6) and solidified in a vial overnight. 20 aged female flies and 5 male flies were added to the vials with or without PHG. Flies were kept at 25 °C for 5 days. Prior to dissection, flies were fed 5% sucrose for 4 hours before dissection to reduce gut autofluorescence from the food.

Bleomycin feeding

Bleomycin (Sigma, 9041-93-4) was dissolved in water at a final concentration of 25 μg/mL and 5% sucrose, or 5% sucrose as a control. 500 μl of bleomycin or control solution were added to a 2.5 cm × 3 cm piece of chromatography paper at the bottom of an empty food vial. Flies were fed bleomycin for 2 days, changing the filter paper and vial daily.

Paraquat feeding

A 10 mM paraquat (Sigma, 75365-73-0) solution was made in water with 5% sucrose, or 5% sucrose alone as the control. Flies were starved in an empty vial for 4 hours before transferring them to a vial with a 2.5 cm × 3 cm piece of chromatography paper soaked with either 500 μl of paraquat or control solution. Flies were fed for 16 hours prior to dissection.

Gut dissections and preparations

Adult females were placed in cold Grace’s media and pinched between the abdomen and thorax using sharp #5 dissecting forceps (Dumont). The abdomen was separated from the thorax, and the integument surrounding the abdomen was peeled away, exposing the gut and Malpighian tubules, being careful not to pinch or stretch the gut. The Grace’s media was removed using a Pasteur pipette, followed by one quick wash with 1x PBS (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.8 mM KH2PO4). The guts were fixed with 8% paraformaldehyde (Ted Pella, Paraformaldehyde 16%, Product #18505) in PBS for 60 minutes at room temperature, followed by 3 quick washes in PBS, and 4 × 15 min washes with PBS or PBT.

QUANTIFICATIONS AND STATISTICAL ANALYSIS

Fluorescence intensity measurements

For immunofluorescence experiments, blocking buffer was added to fixed guts for 2 hours at room temperature or overnight at 4 °C then incubated in primary antibody and 0.2 μM SiRActin (Spirochrome Cat# SC001) in PBS or PBT overnight at 4 °C, followed by 4 × 30 min washes with 1x PBS. Secondary antibodies were added for 2 hours at room temperature, followed by 4 × 30 min washes. Guts were then mounted in DAPI-containing mounting media (Vectashield, Vector Laboratories, H1200). Antibodies used were mouse anti-β gal (1:50), rabbit anti-Cleaved Caspase 3 (1:200), mouse anti-Delta (1:50), rabbit anti-H2AvD (1:1000), rabbit anti-pH3 (1:1000), mouse anti-Prospero (1:50), and rabbit anti-Pdm1 (1:1000). The following secondary antibodies were used at 1:200 Cy3 goat anti-mouse IgG1, Cy3 donkey anti-rabbit IgG, Cy5 goat anti-mouse IgG, and Cy5 donkey anti-rabbit.

CNA35 staining

Immediately after gut dissections, CNA35 recombinant monomer protein labeled with Alexa488 (1 mg/ml in PBS) was diluted to 1:100 in PBS and added to guts for 2 hours, followed by 1 quick wash in PBS and fixed for 1 hour with 8% PFA.

Light Microscopy

Single optical sections of the posterior midgut (R4) were imaged using a Zeiss Apotome mounted to an Axio Image M2 with a 63x/1.4 oil Plan-Apochromat objective. Z-stacks were acquired using a 40x/1.3 oil Plan-Apochromat objective at a 0.75 μm step size taken through the top half of the gut tube (lumen through the top of the muscle layer). Images were taken using an AxioCam MRm camera (Zeiss), X-Cite 120Q light source (Excelitas Technologies), and AxioVision 4.8 software. FIJI ImageJ (version 1.53v, National Institutes of Health) 16-bit, ZVI files were used for analysis and figures for images.

For Fig 1C,D and Fig S2A–H, the fluorescence intensity of the basement membrane was determined by taking single optical slices en face through the middle of the circumferential muscles to ensure the same plane of the basement membrane was imaged, and the exposures were kept the same. The fluorescence intensity of the basement membrane was measured in ImageJ using the “box” tool to measure the average intensity of 3 representative regions of the gut basement membrane. Similarly, the background intensity was determined by subtracting the average of 3 boxes outside of the gut region. An AVOVA test was performed (GraphPad Prism 9.5).

Fluorescence intensity measurements of gut cells to be compared were acquired at the same exposure from at least 3 experiments done on different days. Maximum intensity projections were created using FIJI ImageJ and the line tool was used to draw through the center of the 3 brightest nuclei in the GFP channel and the fluorescence intensity was measured and averaged. Background fluorescence was subtracted by taking the average intensity of 3 lines within the gut region that did not overlap with GFP nuclei. An unpaired t-test was performed.

Measurement of muscle shape

Using single-slice cross section images of the gut basement membrane, individual muscle cells were identified and segmented using the software Seedwater Segmenter42. Custom code in Mathematica (Wolfram Inc., Champaign, IL) was then used to analyze the segmented images and determine the aspect ratio of each muscle cell (a GitHub archive of this original code has been deposited at Zenodo and is publicly available as of the date of publication at https://doi.org/10.5281/zenodo.14659622). Specifically, to quantify the aspect ratio of gut muscle cells, we first fit a 4th-order polynomial to all the segmented cells to estimate a tangent line along the gut’s long axis. We then calculated the two-dimensional moment-of-inertia tensor, J, for each cell relative to the local tangent line, and calculated each cell’s aspect ratio as Sqrt[J11/J22]. This aspect ratio is thus the cell’s height normal to the gut’s long axis divided by the cell’s length along the gut’s long axis.

Quantifying number of cells

GFP+ cells were manually quantified by creating a maximum intensity projection of the Z-stack images of the top half of the gut and confirmed by the presence of a nucleus. The total number of nuclei in the posterior midgut was quantified by creating a maximum intensity projection and setting a threshold to select the DAPI-stained nuclei. Images were “despeckled,” and a watershed was applied to the image. Using the ImageJ “analyze particle” feature, the number of particles larger than 5 μm2 was quantified. The areas where nuclei were fused together or unable to be accurately quantified by ImageJ were manually quantified. The total number of GFP+ cells captured in each image was divided by the total number of nuclei in the image and multiplied by 100 to report the #GFP cells/100.

Statistical reporting

All statistical analysis was performed using GraphPad Prism 9.5. ns indicates P > 0.05, * indicates P ≤ 0.05, ** indicates P ≤ 0.01, *** indicates P ≤ 0.001, **** indicates P ≤ 0.0001.

Supplementary Material

1

Highlights:

  • In the Drosophila midgut, basement membrane is made of collagen IV from the fat body.

  • After damage, “matrix mender” enteroblasts express collagen IV necessary for repair.

  • Matrix menders are induced by Piezo, expressed in intestinal stem cells.

  • Piezo detects loss of basement membrane stiffness to initiate its repair.

Acknowledgements

We thank K. Elkie Peebles, Kimberly LaFever, Jordyn Sanner Barr, Leah Caplan, and Junmin Hua for technical help, Sergei Boudko and Patrick Page-McCaw for discussions, and Barry Denholm, Bruce Edgar, Yuh Nung Jan, BDSC, VDRC, and Kyoto DSC for fly stocks. CNA35 recombinant monomer protein was a gift from Sergei Boudko, and anti-Pdm1 was a gift from Yang Xiaohang. Work was supported by NIGMS (R01GM137595 to A.P-M., and F31GM148021 to A.S.)

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Competing interests

The authors declare no competing interests.

Supplemental Information

Document S1. Figures S1–S7

References

  • 1.Iozzo RV, and Gubbiotti MA (2018). Extracellular matrix: The driving force of mammalian diseases. Matrix Biology 71–72, 1–9. 10.1016/j.matbio.2018.03.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Bonnans C, Chou J, and Werb Z (2014). Remodelling the extracellular matrix in development and disease. Nat Rev Mol Cell Biol 15, 786–801. 10.1038/nrm3904. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Liu P, Xie X, and Jin J (2020). Isotopic Nitrogen-15 Labeling of Mice Identified Long-lived Proteins of the Renal Basement Membranes. Scientific Reports 10, 1–7. 10.1038/s41598-020-62348-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Verzijl N, DeGroot J, Thorpe SR, Bank RA, Shaw JN, Lyons TJ, Bijlsma JWJ, Lafeber FPJG, Baynes JW, and TeKoppele JM (2000). Effect of Collagen Turnover on the Accumulation of Advanced Glycation End Products. Journal of Biological Chemistry 275, 39027–39031. 10.1074/jbc.M006700200. [DOI] [PubMed] [Google Scholar]
  • 5.Maroudas A, Palla G, and Gilav E (1992). Racemization of Aspartic Acid in Human Articular Cartilage. Connective Tissue Research 28, 161–169. 10.3109/03008209209015033. [DOI] [PubMed] [Google Scholar]
  • 6.Sivan S-S, Wachtel E, Tsitron E, Sakkee N, van der Ham F, DeGroot J, Roberts S, and Maroudas A (2008). Collagen Turnover in Normal and Degenerate Human Intervertebral Discs as Determined by the Racemization of Aspartic Acid. Journal of Biological Chemistry 283, 8796–8801. 10.1074/jbc.M709885200. [DOI] [PubMed] [Google Scholar]
  • 7.Keeley DP, Hastie E, Jayadev R, Kelley LC, Chi Q, Payne SG, Jeger JL, Hoffman BD, and Sherwood DR (2020). Comprehensive Endogenous Tagging of Basement Membrane Components Reveals Dynamic Movement within the Matrix Scaffolding. Developmental Cell 54, 60–74.e7. 10.1016/j.devcel.2020.05.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Jayadev R, Morais MRPT, Ellingford JM, Srinivasan S, Naylor RW, Lawless C, Li AS, Ingham JF, Hastie E, Chi Q, et al. (2022). A basement membrane discovery pipeline uncovers network complexity, regulators, and human disease associations. Science Advances 8, eabn2265. 10.1126/sciadv.abn2265. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Yurchenco PD, and Furthmayr H (1984). Self-Assembly of Basement Membrane Collagen. Biochemistry 23, 1839–1850. 10.1021/bi00303a040. [DOI] [PubMed] [Google Scholar]
  • 10.Fidler AL, Vanacore RM, Chetyrkin SV, Pedchenko VK, Bhave G, Yin VP, Stothers CL, Rose KL, McDonald WH, Clark TA, et al. (2014). A unique covalent bond in basement membrane is a primordial innovation for tissue evolution. Proceedings of the National Academy of Sciences of the United States of America 111, 331–336. 10.1073/pnas.1318499111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Ramos-Lewis W, and Page-McCaw A (2019). Basement membrane mechanics shape development: Lessons from the fly. Matrix Biology 75–76, 72–81. 10.1016/j.matbio.2018.04.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Buszczak M, Paterno S, Lighthouse D, Bachman J, Planck J, Owen S, Skora AD, Nystul TG, Ohlstein B, Allen A, et al. (2007). The Carnegie Protein Trap Library: A Versatile Tool for Drosophila Developmental Studies. Genetics 175, 1505–1531. 10.1534/genetics.106.065961. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.He L, Si G, Huang J, Samuel ADT, and Perrimon N (2018). Mechanical regulation of stem cell differentiation through stretch-activated Piezo channel. Nature 555, 103–106. 10.1038/nature25744. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Martin JL, Sanders EN, Moreno-Roman P, Koyama LAJ, Balachandra S, Du X, and O’Brien LE (2018). Long-term live imaging of the Drosophila adult midgut reveals real-time dynamics of division, differentiation and loss. eLife 7. 10.7554/ELIFE.36248. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Micchelli CA, and Perrimon N (2006). Evidence that stem cells reside in the adult Drosophila midgut epithelium. Nature 439, 475–479. 10.1038/nature04371. [DOI] [PubMed] [Google Scholar]
  • 16.Howard AM, Lafever KS, Fenix AM, Scurrah CR, Lau KS, Burnette DT, Bhave G, Ferrell N, and Page-McCaw A (2019). DSS-induced damage to basement membranes is repaired by matrix replacement and crosslinking. Journal of Cell Science 132. 10.1242/jcs.226860. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Shimshoni E, Adir I, Afik R, Solomonov I, Shenoy A, Adler M, Puricelli L, Sabino F, Savickas S, Mouhadeb O, et al. (2021). Distinct extracellular–matrix remodeling events precede symptoms of inflammation. Matrix Biology 96, 47–68. 10.1016/j.matbio.2020.11.001. [DOI] [PubMed] [Google Scholar]
  • 18.McCall AS, Cummings CF, Bhave G, Vanacore R, Page-Mccaw A, and Hudson BG (2014). Bromine is an essential trace element for assembly of collagen IV scaffolds in tissue development and architecture. Cell 157, 1380–1392. 10.1016/j.cell.2014.05.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Peebles KE, LaFever KS, Page-McCaw PS, Colon S, Wang D, Stricker AM, Ferrell N, Bhave G, and Page-McCaw A (2024). Peroxidasin is required for full viability in development and for maintenance of tissue mechanics in adults. Matrix Biology 125, 1–11. 10.1016/j.matbio.2023.11.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Bhave G, Colon S, and Ferrell N (2017). The sulfilimine cross-link of collagen IV contributes to kidney tubular basement membrane stiffness. American Journal of Physiology - Renal Physiology 313, F596–F602. 10.1152/ajprenal.00096.2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.O’Connor JT, Stevens AC, Shannon EK, Akbar FB, LaFever KS, Narayanan NP, Gailey CD, Hutson MS, and Page-McCaw A (2021). Proteolytic activation of Growth-blocking peptides triggers calcium responses through the GPCR Mthl10 during epithelial wound detection. Developmental Cell 56, 2160–2175.e5. 10.1016/j.devcel.2021.06.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Pastor-Pareja JC, and Xu T (2011). Shaping Cells and Organs in Drosophila by Opposing Roles of Fat Body-Secreted Collagen IV and Perlecan. Developmental Cell 21, 245–256. 10.1016/j.devcel.2011.06.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Ramos-Lewis W, LaFever KS, and Page-McCaw A (2018). A scar-like lesion is apparent in basement membrane after wound repair in vivo. Matrix Biology 74, 101–120. 10.1016/j.matbio.2018.07.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Asha H, Nagy I, Kovacs G, Stetson D, Ando I, and Dearolf CR (2003). Analysis of Ras-Induced Overproliferation in Drosophila Hemocytes. Genetics 163, 203–215. 10.1093/genetics/163.1.203. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Amcheslavsky A, Jiang J, and Ip YT (2009). Tissue Damage-Induced Intestinal Stem Cell Division in Drosophila. Cell Stem Cell 4, 49–61. 10.1016/j.stem.2008.10.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Choi NH, Kim JG, Yang DJ, Kim YS, and Yoo MA (2008). Age-related changes in Drosophila midgut are associated with PVF2, a PDGF/VEGF-like growth factor. Aging Cell 7, 318–334. 10.1111/j.1474-9726.2008.00380.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Buchon N, Broderick NA, Poidevin M, Pradervand S, and Lemaitre B (2009). Drosophila Intestinal Response to Bacterial Infection: Activation of Host Defense and Stem Cell Proliferation. Cell Host & Microbe 5, 200–211. 10.1016/j.chom.2009.01.003. [DOI] [PubMed] [Google Scholar]
  • 28.Furriols M, and Bray S (2001). A model Notch response element detects Suppressor of Hairless–dependent molecular switch. Current Biology 11, 60–64. 10.1016/S0960-9822(00)00044-0. [DOI] [PubMed] [Google Scholar]
  • 29.Evans CJ, Olson JM, Ngo KT, Kim E, Lee NE, Kuoy E, Patananan AN, Sitz D, Tran PT, Do MT, et al. (2009). G-TRACE: Rapid Gal4-based cell lineage analysis in Drosophila. Nature Methods 6, 603–605. 10.1038/nmeth.1356. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Antonello ZA (2015). Robust intestinal homeostasis relies on cellular plasticity in enteroblasts mediated by miR-8–Escargot switch. The EMBO Journal 34, 2025–2041. 10.15252/embj.201591517. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Min S, Oh Y, Verma P, Whitehead SC, Yapici N, Van Vactor D, Suh GSB, and Liberles SD (2021). Control of feeding by piezo-mediated gut mechanosensation in Drosophila. eLife 10, 1–30. 10.7554/eLife.63049. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Lee J, Cabrera AJH, Nguyen CMT, and Kwon YV (2020). Dissemination of Ras V12-transformed cells requires the mechanosensitive channel Piezo. Nature Communications 11, 1–13. 10.1038/s41467-020-17341-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Song Y, Li D, Farrelly O, Miles L, Li F, Kim SE, Lo TY, Wang F, Li T, Thompson-Peer KL, et al. (2019). The Mechanosensitive Ion Channel Piezo Inhibits Axon Regeneration. Neuron 102, 373–389.e6. 10.1016/j.neuron.2019.01.050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Coste B, Mathur J, Schmidt M, Earley TJ, Ranade S, Petrus MJ, Dubin AE, and Patapoutian A (2010). Piezo1 and Piezo2 Are Essential Components of Distinct Mechanically Activated Cation Channels. Science 330, 55–60. 10.1126/science.1193270. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.You J, Zhang Y, Li Z, Lou Z, Jin L, and Lin X (2014). Drosophila Perlecan Regulates Intestinal Stem Cell Activity via Cell-Matrix Attachment. Stem Cell Reports 2, 761–769. 10.1016/j.stemcr.2014.04.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Petsakou A, Liu Y, Liu Y, Comjean A, Hu Y, and Perrimon N (2023). Cholinergic neurons trigger epithelial Ca2+ currents to heal the gut. Nature, 1–3. 10.1038/s41586-023-06627-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.single-cell RNA-seq data portal. https://www.flyrnai.org/scRNA/gut_homeostasis_recovery/.
  • 38.Bhave G, Cummings CF, Vanacore RM, Kumagai-Cresse C, Ero-Tolliver IA, Rafi M, Kang JS, Pedchenko V, Fessler LI, Fessler JH, et al. (2012). Peroxidasin forms sulfilimine chemical bonds using hypohalous acids in tissue genesis. Nature Chemical Biology 8, 784–790. 10.1038/nchembio.1038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Deng H, Gerencser AA, and Jasper H (2015). Signal integration by Ca2+ regulates intestinal stem-cell activity. Nature 528, 212–217. 10.1038/nature16170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Xu C, Luo J, He L, Montell C, and Perrimon N (2017). Oxidative stress induces stem cell proliferation via TRPA1/RyR-mediated Ca2+ signaling in the Drosophila midgut. eLife 6, e22441. 10.7554/eLife.22441. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Baghdadi MB, Houtekamer RM, Perrin L, Rao-Bhatia A, Whelen M, Decker L, Bergert M, Pérez-Gonzàlez C, Bouras R, Gropplero G, et al. (2024). PIEZO-dependent mechanosensing is essential for intestinal stem cell fate decision and maintenance. Science 386, eadj7615. 10.1126/science.adj7615. [DOI] [PubMed] [Google Scholar]
  • 42.Mashburn DN, Lynch HE, Ma X, and Hutson MS (2012). Enabling user-guided segmentation and tracking of surface-labeled cells in time-lapse image sets of living tissues. Cytometry Part A 81A, 409–418. 10.1002/cyto.a.22034. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1

Data Availability Statement

  • Microscopy data reported in this paper will be shared by the lead contact upon request.

  • All original code has been archived at Zenodo (https://doi.org/10.5281/zenodo.14659622) and is publicly available as of the date of publication.

  • Any additional information required to reanalyze the data reported in this paper is available from the Lead Contact upon request.

RESOURCES