Determination of relative bioavailability from copper carbonate (Emerald-C) and tribasic copper chloride in growing beef steers

Abstract

Two experiments were conducted to determine the bioavailability of Cu carbonate (CuCO₃) and tribasic Cu chloride (TBCC) relative to Cu sulfate (CuSO₄). Experiment 1 utilized 84 steers (282 ± 19 kg) in a 96-d study stratified by weight into pens (six steers per pen) equipped with GrowSafe feed bunks (GrowSafe Systems Ltd, Airdire, AB, Canada). Two pens (n = 12 steers per treatment) were randomly assigned to one of seven treatments: no supplemental Cu (CON), 5 or 10 mg Cu/kg diet dry matter (DM) from CuCO₃ (CO5 and CO10, respectively), 5 or 10 mg Cu/kg diet DM from CuSO₄ (SUL5 and SUL10, respectively), and 5 or 10 mg Cu/kg diet DM from TBCC (TBCC5 and TBCC10, respectively). All animals were supplemented with 2 mg Mo/kg diet DM and 0.1% S. Blood and liver samples were collected on days 5 and 4 and on days 95 and 96 with treatments stratified across sampling days. Weight was measured on days −1, 0, 26, 56, 93, and 94. Liver samples were used to determine liver Cu concentration and expression of genes relating to Cu trafficking. Blood samples were used to determine plasma Cu and ceruloplasmin concentrations. Markers of Cu status were used to determine the relative bioavailability (RBV) of each test source against CuSO₄. Based on liver Cu, CuCO₃, and TBCC were not as bioavailable as CuSO₄ (89% and 88%, respectively, P < 0.01). There were no differences in RBV between sources based on plasma Cu; however, based on ceruloplasmin, CuCO₃ tended to be more bioavailable than CuSO₄ (186%; P = 0.08). Experiment 2 compared rates of repletion of Cu-depleted steers fed each source at 5 mg Cu/kg DM (plus 5 mg Mo/kg DM) for 21 d. Controls had the lowest liver Cu following depletion (P ≤ 0.01), while Cu-supplemented treatments were not different (P ≥ 0.40). Plasma Cu was affected by day (P < 0.01), where days 7 and 14 of repletion were similar (P = 0.23) and greater than day 21 (P ≤ 0.01). There was a tendency for a treatment × day interaction where ceruloplasmin tended to be greater on day 14 than on day 7 (P ≤ 0.09), while CON remained consistent on days 7 and 14 (P = 0.51), and decreased from day 14 to day 21 (P = 0.03). Environmental factors and initial Cu status may have impacted the outcome of Exp. 2. In conclusion, Cu from CuCO₃ tended to result in more Cu in circulation as ceruloplasmin than CuSO₄ and TBCC.

This study determined the bioavailability of copper carbonate and tribasic copper chloride relative to copper sulfate in growing feedlot cattle. Based on liver copper concentrations, both copper carbonate and tribasic copper chloride were less bioavailable relative to copper sulfate; however, copper carbonate tended to have a greater bioavailability than copper sulfate based on the ceruloplasmin concentrations.

Introduction

Copper is a critical component in several metalloenzymes that play vital roles in many bodily functions, such as connective tissue development, reproduction, and oxidative balance. However, feeding Cu in excess can cause oxidative damage to tissues and can even lead to death (NASEM, 2016). Feeding Cu to ruminants presents a unique challenge to producers, due in part to the presence of dietary antagonists S, Mo, and Fe. These may be present in feedstuffs in amounts that vary depending on several factors. For example, dried distiller’s grains with solubles (DDGS) have S content that may differ widely from plant to plant due to the use of sulfuric acid to control pH during the ethanol production process and variation in S content of water used during production (Uwituze et al., 2011). Molybdenum concentrations in forages depend heavily upon soil Mo, which can be extremely variable from region to region (Suttle, 2010). Sulfur and Mo readily bind in the reducing environment of the rumen to form thiomolybdates (Suttle, 1974). Clarke and Laurie (1980) showed that tri- and tetrathiomolybdate are the most common forms found in the rumen, and tetrathiomolybdates become increasingly common as rumen pH decreases. These two forms of thiomolybdate have the highest affinity for Cu (Price and Chesters, 1985). Once Cu is bound by thiomolybdate in the rumen, it is unavailable for absorption throughout the remainder of the digestive tract. If there is no Cu available for thiomolybdate binding in the rumen, thiomolybdates are absorbed into the bloodstream and further deplete Cu stores (Gooneratne et al. 1981).

Copper sulfate (CuSO₄) is an inorganic source of Cu and highly soluble in the rumen; thus, Cu from CuSO₄ is susceptible to antagonist binding (Spears, 2003). There are several Cu sources available to producers that may be more available under antagonistic pressure, such as tribasic Cu chloride (TBCC) and Cu carbonate (CuCO₃). These sources are generally less soluble than CuSO₄ at neutral pH and therefore should be more bioavailable relative to CuSO₄ in the presence of dietary antagonists S and Mo (Spears, 2003). In practice, however, research examining the bioavailability of alternative Cu sources has been widely variable. For example, Spears et al. (2004) found TBCC was nearly twice as bioavailable as CuSO₄ when supplemented to steers fed 5 mg Mo/kg DM and 0.15% S. Arthington and Spears (2007), on the other hand, found that TBCC and CuSO₄ were similarly available to heifers that received approximately 1.5 mg Mo/kg and 1% S.

Copper carbonate has been less extensively studied (Ward et al., 1996), and Emerald-C (Old Bridge Minerals Inc., NJ) is a newer source of CuCO₃ (full chemical formula Cu₂ CO₃(OH)₂). In contrast to highly soluble Cu sulfate, many alternative sources of Cu are designed to have lower solubilities at neutral pH, like that observed in the rumen. For example, Ward et al. (1996) determined CuCO₃ was 0.7% soluble after a 24 h incubation in deionized water compared to 69% soluble after a 1 h incubation in HCl (pH 2.3). This is similar to TBCC, which was found to be 0.6% soluble in water for 24 h and 77% soluble in HCl (pH 2.2) after incubating for 1 h (Spears et al., 2004). However, no studies have directly compared these two sources of Cu, and the solubility of these sources may influence their performance in the face of dietary antagonists in vivo. Thus, the objective of this experiment was to determine the bioavailability of CuCO₃ and TBCC relative to CuSO₄ in feedlot steers fed a total of 0.4% S and 3 mg Mo/kg DM, as well as determine the efficacy of these Cu sources as a Cu repletion strategy when supplemented with 5 mg Mo/kg diet DM and no supplemental S. We hypothesize CuCO₃ will behave more similarly to TBCC than to CuSO₄ and will be more bioavailable than CuSO₄ when moderate concentrations of S and Mo are present in the diet.

Materials and Methods

All experimental procedures were approved by the Iowa State University Institutional Animal Care and Use Committee (log number 23-065).

Experiment 1

Animals and experimental design

The objective of Exp. 1 was to determine the bioavailability of TBCC and CuCO₃ relative to CuSO₄ in growing steers under moderate antagonistic pressure. Eighty-four Angus crossbred steers from a single Missouri ranch (282 ± 19.3 kg) were stratified by initial body weight (BW) collected on day 1, prior to initiation of treatments, into fourteen six-head pens equipped with individual GrowSafe (GrowSafe Systems, Calgary, AB, Canada) feed bunks. Fourteen days prior to initiation of treatments, steers were vaccinated (Bovilis Vista 5 SQ, Merck Animal Health, Madison, NJ; Bovilis Vision 7, Merck Animal Health), dewormed (Synanthic oral suspension, Boehringer Ingelheim Animal Health, Duluth, GA), and received individual visual and electronic identification tags. On day 0, BW was collected again, and steers were assigned to one of seven dietary treatments: no supplemental Cu (CON), 5 mg supplemental Cu/kg DM from CuSO₄ (SUL5), 10 mg supplemental Cu/kg DM from CuSO₄ (SUL10), 5 mg supplemental Cu/kg DM from TBCC (TBCC5), 10 mg supplemental Cu/kg DM from TBCC (TBCC10), 5 mg supplemental Cu/kg DM from CuCO₃ (CO5), or 10 mg supplemental Cu/kg DM from CuCO₃ (CO10). All steers were fed a corn silage-based diet supplemented with 0.1% S from calcium sulfate and 2 mg Mo/kg DM from sodium molybdate. As shown in Table 1, diets were identical for each treatment, with the exception of the dried distiller’s grains-based premix used as the carrier for each Cu treatment, and treatment premixes replaced dried distiller’s grains in the total mixed ration (TMR). All other minerals were supplemented to meet NASEM (2016) recommendations. GrowSafe feedbunks measured individual-animal feed disappearance, which was used to determine dry matter intake (DMI). Consecutive-day BW were also collected on days 93 and 94. Interim BW was collected on days 26 and 56. A 4% pencil shrink was applied to all BW measurements, and shrunk BW was used in all performance calculations and analysis. Average daily gain (ADG) as well as gain:feed (G:F) was calculated using the average initial and average final BW. Steers were administered a Revalor-IS implant (Merck Animal Health; 80 mg trenbolone acetate, 60 mg estradiol) on day 26.

Table 1.

Experiment 1 common diet

Ingredient	% of diet (dry matter basis)
Corn silage	40
Sweet bran1	40
DDGS2	10
Cu premix3	5
Trace mineral premix4	2.7965
Limestone	1.18
Calcium sulfate	0.6
Salt	0.31
Vitamin A & E premix5	0.1
Rumensin 90	0.0135
Analyzed composition
Crude protein, %6	18.7
Neutral detergent fiber, %6	32.9
Ether extract, %6	5.92
Sulfur, %7	0.4
Mo, mg/kg DM7	3
Fe, mg/kg DM8	103
Zn, mg/kg DM8	74
Cu, mg/kg DM8	6

¹Branded wet corn gluten feed (Cargill Corn Milling, Blair, NE).

²Dried distillers grains with solubles.

³Copper premix utilized DDGS as a carrier and provided no supplemental Cu, or 5 or 10 mg Cu/kg DM from copper sulfate, 5 or 10 mg Cu/kg DM copper carbonate, or 5 or 10 mg Cu/kg DM tribasic copper chloride.

⁴Trace mineral premix utilized DDGS as a carrier and was formulated to supplement 2 mg Mo/kg DM and 0.1% S. Apart from Cu, Mo, and S, all other trace minerals were supplemented to meet NASEM (2016) recommendations.

⁵Vitamin A & E premix provided 2,200 IU vitamin A and 25 IU vitamin E/kg diet DM.

⁶Analysis of composited CON TMR (one composite including weekly samples for the duration of the study) by Dairyland Laboratories (Arcadia, WI).

⁷Analysis of composited CON TMR (one composite including weekly samples for the duration of the study) by the Iowa State University Veterinary Diagnostic Laboratory (Ames, IA).

⁸Analyzed Fe, Zn, and Cu represents CON dietary treatment with no supplemental Cu and were analyzed via inductively coupled plasma optical emission spectrometry (ICP Optima 7000 DV, Perkin Elmer, Waltham, MA). Samples were composited by month and monthly composites were analyzed in duplicate. All treatments were supplemented Zn and Fe to meet NASEM (2016) recommendations. Copper treatments were supplemented in addition to Cu in the basal diet.

Sample collection and analytical procedures

Blood and liver samples were collected approximately 2 h post-feeding on either day 5 or day 4, prior to initiation of dietary treatments, and at the end of the trial on days 95 and 96 (with treatments stratified across sampling days) via jugular venipuncture into one serum tube (no anti-coagulant) and one plasma K₂EDTA blood collection tube (Becton Dickenson, Rutherford, NJ). Interim blood samples were collected on day 56. Tubes were centrifuged at 1000 × g for 20 min at 4 °C. Plasma and serum were harvested and aliquoted for storage at −20 °C and −80 °C, respectively, until further analysis. Plasma samples were prepared and analyzed via inductively coupled plasma-optical emission spectrometry (ICP-OES; Optima 7000 DV; Perkin Elmer; Waltham, MA) to determine plasma Cu concentrations as previously described (Pogge and Hansen, 2013). Plasma samples were also analyzed for ceruloplasmin concentration as described by Dimitriou et al. (1974). Serum samples were analyzed for serum amine oxidase (AOC3) activity via commercial fluorometric assay (Invitrogen, Carlsbad, CA), where emission was read after a 30-min incubation to determine enzymatic activity.

Liver biopsies were collected following methods described in Engle and Spears (2000) and either flash frozen in liquid nitrogen or placed on ice. Non-flash frozen liver samples were transported to the laboratory on ice, after which they were stored at −20 °C until drying at 70 °C for approximately 7 days in a forced-air oven. Once dry, liver samples were digested (CMES MARSXpress, Matthews, NC) with trace mineral grade nitric acid prior to ICP-OES analysis for Cu as previously described (Pogge and Hansen, 2013). Flash frozen liver samples were stored at −80 °C until pulverization in liquid nitrogen and RNA isolation via TRIzol reagent (Invitrogen) and cDNA synthesis following methods described by Rients et al. (2023). Quantity and quality of isolated RNA were measured using a Take3Trio nucleic acid quantification plate (Agilent Technologies, Winooski, VT), and 500 ng of RNA were used for cDNA synthesis. The cDNA product was stored at −20 °C until analysis via quantitative real-time polymerase chain reaction (qPCR) as described by McGill et al. (2016), using Power SYBR Green Master Mix (Applied Biosystems, Carlsbad, CA). Reactions were performed in a ThermoFisher Scientific QuantStudio 5 Real-Time PCR Machine (ThermoFisher, Waltham, MA). Amplification conditions for all genes were the same: (Hold stage) 2 min at 50 °C, 10 min at 95 °C, 40 cycles of 15 s at 95 °C, and 1 min at 60 °C (measure fluorescence step) and a dissociation step of 15 s at 95 °C, 1 min at 60 °C, 15 s at 95 °C, and 15 s at 60 °C. Primer information for target genes is displayed in Table 2. Ribosomal protein subunit 9 was utilized as the reference gene, and relative gene expression was determined using the 2^-ΔΔCT method (Livak and Schmittgen, 2001), with calculations made relative to expression of the non-Cu-supplemented controls.

Table 2.

(Experiment 1). Forward and reverse primers for quantitative real-time polymerase chain reaction in hepatic tissue

Gene	Function	Primer sequence (5′-3′)	Accession no.	Product length, bp
ATP7B 1	Incorporation of Cu into ceruloplasmin as well as biliary excretion	F: AAGTCTTGCGTCCAGTCC	XM596258.3	109
		R: GAGATGGATCGTAGAGAACC
CTR1 2	Primary route of Cu import	F: AAGAGTCCTGGAGGTGTG	NM001100381.1	200
		R: GGTCAGATGAAGTGGTTGG
COMMD1 3	Upstream of ATP7B—may affect ATP7B function	F: CTGGAGGCATTTTTGACTGCTC	NM001046384.1	112
		R: GACTCTCTCGGATTTTTGTCTTATG
CP 4	Cu-dependent ferroxidase; synthesized in liver and primary Cu-transporting protein in blood	F: GGTATGGGTAATGAAATTGATGTG	XM592003.4	275
		R: TCAGCAGCGATGTAGTAGTG
MT1A 5	Cu storage	F: ATGGACCCGAACTGCTCCTGC	NM001040492.1	182
		R: GCGCAGCAGCTGCACTTGTCCG
MT2A 6	Cu storage	F: GACCCCAGCCTCCAGTTCAGCTC	NM001075140.1	61
		R: CTTTGCATTTGCAGGAGCCGGC
ATOX1 7	Delivers Cu to ATP7B in the liver	F: CCGAAGCACGAGTTCTCC	XM877831.2	109
		R: TGTTGGGCAGGTCAATGTC
RPS9 8	Housekeeping gene	F: CCTCGACCAAGAGCTGAAG	DT860044	64
		R:CCTCCAGACCTCACGTTTGTTC

¹Copper transporting beta-polypeptide ATPase.

²Copper transporter 1.

³Copper metabolism MURR domain 1.

⁴Ceruloplasmin.

⁵Metallothionein 1a.

⁶Metallothionein 2a.

⁷Antioxidant 1.

⁸Ribosomal protein subunit 9.

Experiment 2

Animals and experimental design

The objective of Exp. 2 was to compare the repletion rates of steers fed Cu from CuCO₃, TBCC, and CuSO₄ in Cu-deficient steers. Forty-eight single-source Angus crossbred steers (293 ± 20.7 kg) were stratified by BW collected on day 86 prior to initiation of the depletion period into eight six-head pens equipped with individual GrowSafe bunks (GrowSafe Systems). Steers were vaccinated (Bovilis Vista 5 SQ, Merck Animal Health; Bovilis Vision 7, Merck Animal Health), dewormed (Synanthic oral suspension, Boehringer Ingelheim Animal Health), and received individual visual and electronic identification tags on day 99. Revalor-IS (Merck Animal Health) was administered to all steers on day 71. Steers were fed the depletion diet (Table 3) from day 85 to day 1. This was a corn silage-based diet (identical in ingredient composition to Exp. 1) supplemented with 0.1% S from calcium sulfate and 5 mg Mo/kg DM from sodium molybdate; no supplemental Cu was fed during the depletion period. After 85 days of depletion (day 0 of the study), BW was collected, and pens were assigned to one of four Cu treatments to be fed through the repletion period (days 0–21 of the study): CON, SUL5, TBCC5, or CO5. Repletion period diet composition is shown in Table 4; treatments were included in the TMR as in Exp. 1. In addition to Cu supplement, all treatments were supplemented with 5 mg Mo/kg diet DM, but no supplemental S. All other minerals were supplemented to meet NASEM (2016) recommendations.

Table 3.

Experiment 2 depletion diet, fed to all steers from day 85 to day 1

Ingredient	% of diet (dry matter basis)
Corn silage	40
Sweet bran1	40
DDGS2	15
Trace mineral premix3	2.7965
Limestone	1.18
Calcium sulfate	0.6
Salt	0.31
Vitamin A & E premix4	0.1
Rumensin 90	0.0135
Analyzed composition
Crude protein, %5	19.3
Neutral detergent fiber, %5	31.7
Ether extract, %5	5.67
Sulfur, %6	0.4
Mo, mg/kg DM6	5
Fe, mg/kg DM7	96
Zn, mg/kg DM7	80
Cu, mg/kg DM7	5

¹Branded wet corn gluten feed (Cargill Corn Milling, Blair, NE).

²Dried distillers grains with solubles.

³Trace mineral premix utilized DDGS as a carrier and was formulated to supplement 5 mg Mo/kg DM, 0.1% S, and no supplemental Cu. Apart from Cu, Mo, and S, all other trace minerals were supplemented to meet NASEM (2016) recommendations.

⁴Vitamin A & E premix provided 2,200 IU vitamin A and 25 IU vitamin E/kg diet DM.

⁵Analysis of composited depletion TMR (one composite including weekly samples for the duration of the depletion period) by Dairyland Laboratories (Arcadia, WI).

⁶Analysis of composited depletion TMR (one composite including weekly samples for the duration of the depletion period) by the Iowa State University Veterinary Diagnostic Laboratory (Ames, IA).

⁷Analyzed Fe, Zn, and Cu represents depletion TMR and were analyzed via inductively coupled plasma optical emission spectrometry (ICP Optima 7000 DV, Perkin Elmer, Waltham, MA). Samples were composited by month and monthly composites were analyzed in duplicate. All treatments were supplemented Zn and Fe to meet NASEM (2016) recommendations.

Table 4.

Experiment 2 repletion common diet, fed from day 0 to day 21

Ingredient	% of diet (dry matter basis)
Corn silage	40
Sweet bran1	40
DDGS2	10
Cu premix3	5
Trace mineral premix4	3.0765
Limestone	1.5
Salt	0.31
Vitamin A & E premix5	0.1
Rumensin 90	0.0135
Analyzed composition
Crude protein, %6	18.9
Neutral detergent fiber, %6	32.5
Ether extract, %6	5.35
Sulfur, %7	0.3
Mo, mg/kg DM7	5
Fe, mg/kg DM8	96
Zn, mg/kg DM8	86
Cu, mg/kg DM8	6

¹Branded wet corn gluten feed (Cargill Corn Milling, Blair, NE).

²Dried distillers grains with solubles.

³Copper premix utilized DDGS as a carrier and provided no supplemental Cu, or 5 mg Cu/kg DM from copper sulfate, 5 mg Cu/kg DM from copper carbonate, or 5 mg Cu/kg DM from tribasic copper chloride.

⁴Trace mineral premix utilized DDGS as a carrier and was formulated to supplement 5 mg Mo/kg DM. Apart from Cu and Mo, all other trace minerals were supplemented to meet NASEM (2016) recommendations.

⁵Vitamin A & E premix provided 2,200 IU vitamin A and 25 IU vitamin E/kg diet DM.

⁶Analysis of composited CON TMR (one composite including weekly samples for the duration of the repletion period) by Dairyland Laboratories (Arcadia, WI).

⁷Analysis of composited CON TMR (one composite including weekly samples for the duration of the repletion period) by the Iowa State University Veterinary Diagnostic Laboratory (Ames, IA).

⁸Analyzed Fe, Zn, and Cu represents CON dietary treatment with no supplemental Cu and were analyzed via inductively coupled plasma optical emission spectrometry (ICP Optima 7000 DV, Perkin Elmer, Waltham, MA). Samples were composited by month and monthly composites were analyzed in duplicate. All treatments were supplemented Zn and Fe to meet NASEM (2016) recommendations. Copper treatments were supplemented in addition to Cu in the basal diet.

Sample collection and analytical procedures

On day 0 (following 85 d of depletion) and day 21, blood samples and liver biopsies were collected 2 h post-feeding as described in Exp. 1. Blood samples were also collected prior to feeding on days 7 and 14. All blood and liver samples were processed and analyzed for Cu as described in Exp. 1.

Dietary management

All cattle were fed daily at approximately 0800 h and were allowed ad libitum access to feed and water. Weekly diet ingredient and TMR samples were collected to determine DM content by drying feed samples in a forced air oven at 70 °C for 48 h. GrowSafe bunks recorded individual animal feed disappearance using the electronic identification tags that were given to each steer prior to initiation of the study. Dry matter intake was then calculated by applying DM content of the TMR to as-fed intakes measured by GrowSafe. After drying, feed samples were ground through a 2 mm screen (Retsch Zm100 grinder; Retsch GmbH, Haan, Germany) and composited by month within treatment. Monthly composites were then acid-digested using trace mineral grade nitric acid as described by Genther-Schroeder et al. (2016) and analyzed for Cu, Fe, and Zn via ICP-OES. Ground CON samples from each experiment were also composited and sent to Iowa State University Diagnostic Laboratory (Ames, IA) for analysis of S and Mo and to a commercial laboratory (Dairyland Laboratories, Inc., Arcadia, WI) for analysis of neutral detergent fiber and crude protein. Separate CON composites were analyzed for the depletion and repletion periods of Exp. 2.

Statistical analysis

Experiment 1

Performance, liver Cu, plasma Cu, ceruloplasmin, AOC3, and gene expression data were analyzed as a completely randomized design using the MIXED procedure of SAS 9.4 (SAS Inst. Inc., Cary, NC), with the fixed effect of treatment and pen as a random variable. Shrunk day 0 BW was used as a covariate in all performance data analysis, and initial liver Cu, plasma Cu, and ceruloplasmin concentrations were used as a covariate in analysis of their respective measurements on day 96. The experimental unit was individual steer (n = 12 per treatment). Liver and plasma Cu data were transformed using natural logarithm to meet assumptions for normality, and data presented are back-transformed LSMEANS and SEM. Single-degree-of-freedom orthogonal contrasts were used to compare treatment means. These contrasts included: CON vs. 5 mg Cu/kg DM, 5 mg Cu/kg DM vs. 10 mg Cu/kg DM, CuCO₃ vs. CuSO₄, TBCC vs. CuSO₄, and CuCO₃ vs. TBCC. Cook’s D statistic was used to identify outliers with a cutoff value of 0.5; one outlier (SUL10) was detected and removed from analysis of AOC3. Two steers were removed from the experiment due to unrelated illness (1 TBCC10 and 1 CO10) and were excluded from all analyses. Natural log transformed liver Cu, natural log transformed plasma Cu, and ceruloplasmin concentrations were regressed against average daily Cu intake (calculated by dividing total Cu intake by the 95 days between initiation of dietary treatments and final liver sample day) using the GLM procedure of SAS to determine slope coefficients as previously described by Littell et al. (1996). While a true balance study is necessary to measure mineral retention, the slope-ratio assay based on changes in physiological indicators is a well-established method for determining the relative bioavailability (RBV) of different Cu sources. Therefore, RBV was calculated by dividing the slope of the test Cu source (either CuCO₃ or TBCC) by the standard source (CuSO₄). Initial values for each Cu index were used as a covariate in the analysis of RBV. Significance was defined as P ≤ 0.05 and tendencies were defined as 0.05 < P ≤ 0.10.

Experiment 2

Liver Cu and plasma Cu data were analyzed as a completely randomized design using the MIXED procedure of SAS, and steer was the experimental unit for all analysis. Day 88 BW was used as a covariate in all performance analysis. Final liver Cu was analyzed using day 0 liver Cu as a covariate. Liver tissue was failed to be recovered on day 21 from one steer (CO5), and thus is missing from analysis of day 21 liver Cu concentrations. A delta was analyzed to assess treatment differences in the change in liver Cu from day 0 and day 21 without the use of a covariate. Day 0 plasma Cu and serum ceruloplasmin concentrations were used as a covariate in the analysis of subsequent sampling timepoints for each measure. Plasma Cu data were transformed using natural logarithm to achieve a normal distribution and analyzed as repeated measures with the fixed effect of treatment, day, and treatment × day. Data presented are back-transformed LSMEANS and SEM. Cook’s D statistic was used to identify and remove outliers with a cutoff value of 0.5, but none were detected. Significance was defined as P ≤ 0.05 and tendencies were defined as 0.05 < P ≤ 0.10.

Results

Experiment 1

Live animal performance

Live animal performance data are summarized in Table 5. Steers supplemented with 5 mg Cu/kg DM tended to have greater day 94 BW and ADG (P = 0.10) than CON steers, but no other differences in BW or overall ADG were detected on any other day for any contrast (P ≥ 0.18). Dry matter intake was similar between all treatments (P ≥ 0.14). Steers supplemented with CuSO₄ had poorer overall G:F than those supplemented with TBCC (P = 0.04), but all other contrasts were similar (P ≥ 0.19).

Table 5.

(Experiment 1). Effect of copper supplementation from copper carbonate, tribasic copper chloride, or copper sulfate for 96 days on growing beef steer performance¹

	Treatment2								Contrast P-values
	CON	SUL5	SUL10	CO5	CO10	TBCC5	TBCC10	SEM	Control vs. 5 mg/kg	Control vs. 10 mg/kg	5 mg/kg vs.10 mg/kg	Sulfate vs. carbonate	Sulfate vs. TBCC	Carbonate vs. TBCC
day 0 BW, lb	282	283	282	282	279	281	281	6.05	0.99	0.85	0.80	0.80	0.79	0.99
day 26 BW, lb3	317	318	320	324	323	323	323	2.89	0.17	0.18	0.94	0.17	0.25	0.79
day 56 BW, lb3	372	377	374	378	375	382	380	5.39	0.27	0.54	0.47	0.82	0.33	0.44
day 94 BW, lb3	432	433	430	439	432	436	438	6.52	0.10	0.17	0.61	0.57	0.41	0.80
days 0–94 ADG, kg/d	1.49	1.61	1.57	1.67	1.60	1.64	1.66	0.07	0.10	0.18	0.58	0.61	0.45	0.80
days 0–94 DMI, kg/d3	8.21	9.07	8.76	8.78	9.04	8.56	8.78	0.34	0.17	0.14	0.85	0.98	0.49	0.51
days 0–94 G:F	0.183	0.179	0.180	0.190	0.178	0.192	0.191	0.006	0.60	0.96	0.42	0.59	0.04	0.17

¹A 4% pencil shrink was applied to all live body weight measures, including those used in ADG and G:F calculations.

²Treatments included: CON (no supplemental copper), SUL5 or SUL10 (5 or 10 mg Cu/kg diet DM from copper sulfate, respectively), CO5 or CO10 (5 or 10 mg Cu/kg diet DM from copper carbonate, respectively), and TBCC5 or TBCC10 (5 or 10 mg Cu/kg diet DM from tribasic copper chloride, respectively). All treatments were supplemented with 0.1% S from calcium sulfate and 2 mg Mo/kg DM from sodium molybdate. All other trace minerals were supplemented to meet NASEM (2016) recommendations.

³Day 0 BW used as a covariate in analysis.

Markers of copper status

Concentrations of Cu status indicators are summarized in Table 6. Initial values served as a covariate in analysis of final liver Cu, final ceruloplasmin, and day 56 and final plasma Cu. From day 4 to day 96, liver Cu decreased by 66% in CON steers. Copper-supplemented steers had greater day 96 liver Cu than CON (P < 0.01), and steers supplemented with 10 mg Cu/kg DM had greater day 96 liver Cu than those supplemented with 5 mg Cu/kg DM (P < 0.01). In Cu-supplemented treatments, day 96 liver Cu did not differ by source (P ≥ 0.39).

Table 6.

(Experiment 1). Effect of copper supplementation from copper carbonate, tribasic copper chloride, or copper sulfate for 96 days on growing beef steer liver copper, plasma copper, plasma ceruloplasmin, and serum amine oxidase concentrations

	Treatment1								Contrast P-values
	CON	SUL5	SUL10	CO5	CO10	TBCC5	TBCC10	SEM	Control vs. 5 mg/kg	Control vs. 10 mg/kg	5 mg/kg vs.10 mg/kg	Sulfate vs. carbonate	Sulfate vs. TBCC	Carbonate vs. TBCC
Liver Cu, mg/kg DM
day 0	74	66	88	65	76	73	82	13.1	0.65	0.55	0.14	0.62	0.92	0.55
day 962	21	88	165	77	152	83	144	19.4	<0.01	<0.01	<0.01	0.39	0.45	0.91
Plasma Cu, mg/L
day 0	1.00	1.05	1.05	1.10	1.01	1.05	1.05	0.03	0.04	0.25	0.17	0.93	0.96	0.97
day 562	0.74	0.80	0.94	1.01	0.89	0.87	0.82	0.05	0.01	0.01	0.94	0.13	0.66	0.05
day 962	0.70	0.79	0.85	0.81	0.88	0.85	0.77	0.04	<0.01	<0.01	0.67	0.47	0.88	0.39
Ceruloplasmin, mg/dL
day 02	22.3	22.8	24.4	24.9	22.9	23.1	24.6	1.2	0.30	0.19	0.69	0.77	0.81	0.97
day 962	13.2	14.0	15.8	16.1	16.7	14.9	14.4	1.2	0.15	0.06	0.48	0.17	0.85	0.12
Serum amine oxidase activity in 30 min, µM
day 96	858	1,009	1,026	1,094	1,097	1,070	1,145	145	0.14	0.10	0.78	0.55	0.47	0.93

¹Treatments included: CON (no supplemental copper), SUL5 or SUL10 (5 or 10 mg Cu/kg diet DM from copper sulfate, respectively), CO5 or CO10 (5 or 10 mg Cu/kg diet DM from copper carbonate, respectively), and TBCC5 or TBCC10 (5 or 10 mg Cu/kg diet DM from tribasic copper chloride, respectively). All treatments were supplemented with 0.1% S from calcium sulfate and 2 mg Mo/kg DM from sodium molybdate. All other trace minerals were supplemented to meet NASEM (2016) recommendations.

²Day 0 values were used as a covariate in analysis of subsequent sampling timepoints.

Copper-supplemented treatments had greater plasma Cu than CON on days 56 and 96 (P ≤ 0.01). On day 56, steers supplemented with CuCO₃ had greater plasma Cu than those supplemented with TBCC (P = 0.05) but were similar by day 96 (P = 0.39). No other differences in plasma Cu were detected for other contrasts on any day (P ≥ 0.13). Final ceruloplasmin concentrations tended to be greater in 10 mg/kg treatments than CON (P = 0.06), but no other contrasts for ceruloplasmin differed (P ≥ 0.12).

Serum AOC3 activity tended to be greater in steers receiving 10 mg supplemental Cu/kg diet DM than controls (P = 0.10) but did not differ between CON vs. 5 mg supplement Cu/kg or source. (P = 0.14).

Relative gene expression

Gene expression data are summarized in Table 7. No differences were noted in hepatic gene expression relative to controls (P ≥ 0.35).

Table 7.

(Experiment 1). Hepatic relative expression of Cu transporting genes¹

	Treatment2								Contrast P-values
	CON	SUL5	SUL10	CO5	CO10	TBCC5	TBCC10	SEM	Control vs. 5 mg/kg	Control vs. 10 mg/kg	5 mg/kg vs. 10 mg/kg	Sulfate vs. carbonate	Sulfate vs. TBCC	Carbonate vs. TBCC
ATP7B 3	1.08	1.14	1.05	1.01	1.13	1.35	1.04	0.17	0.92	0.67	0.47	0.84	0.85	0.70
CTR1 4	1.06	1.08	1.14	1.18	0.88	0.96	1.04	0.17	0.77	0.43	0.48	0.80	0.64	0.83
COMMD1 5	1.17	1.76	1.37	1.33	1.28	2.04	1.41	0.29	0.36	0.66	0.53	0.63	0.81	0.82
CP 6	1.07	1.27	1.16	1.52	1.18	1.53	1.69	0.32	0.39	0.87	0.35	0.93	0.45	0.52
MT1A 7	5.83	2.20	2.04	11.48	4.93	9.48	2.49	3.73	0.93	0.57	0.49	0.43	0.85	0.56
MT2A 8	1.90	1.59	2.26	2.26	4.55	2.15	1.06	0.85	0.53	0.43	0.82	0.65	0.29	0.14
ATOX1 9	1.07	1.02	0.89	0.92	0.97	1.20	1.04	0.13	0.69	0.40	0.53	0.85	0.46	0.37

¹Reported treatment averages are the average 2^-ΔΔCT values, which were calculated based on the average ΔCT of the non-Cu-supplemented controls.

²Treatments included: CON (no supplemental copper), SUL5 or SUL10 (5 or 10 mg Cu/kg diet DM from copper sulfate, respectively), CO5 or CO10 (5 or 10 mg Cu/kg diet DM from copper carbonate, respectively), and TBCC5 or TBCC10 (5 or 10 mg Cu/kg diet DM from tribasic copper chloride, respectively). All treatments were supplemented with 0.1% S from calcium sulfate and 2 mg Mo/kg DM from sodium molybdate. All other trace minerals were supplemented to meet NASEM (2016) recommendations.

³Copper transporting beta-polypeptide ATPase.

⁴Copper transporter 1.

⁵Copper metabolism MURR domain 1.

⁶Ceruloplasmin.

⁷Metallothionein 1a.

⁸Metallothionein 2a.

⁹Antioxidant 1.

Relative bioavailability

Relative bioavailability slopes and calculations for CuCO₃ and TBCC are presented in Tables 8 and 9, respectively. The RBV for both test sources was estimated based on liver Cu, plasma Cu, and ceruloplasmin concentrations at the end of the 96-day supplementation period using multiple linear regression and the slope-ratio assay. Based on liver Cu, the RBV of CuCO₃ and TBCC compared to CuSO₄ was 89.3% (P < 0.01) and 88.2% (P < 0.01), respectively. Based on plasma Cu, the RBV of CuCO₃ was numerically greater at 132.5% (P = 0.21), while the RBV of TBCC was 100% (P = 0.82). Based on ceruloplasmin, the bioavailability of CuCO₃ tended to be greater at 186.1% of CuSO₄ (P = 0.09), and TBCC was numerically lower at 73.15% relative to CuSO₄ (P = 0.18).

Table 8.

(Experiment 1). Estimated relative bioavailability of copper carbonate compared to copper sulfate after 96 days of supplementation on growing beef steer liver copper, plasma copper, and plasma ceruloplasmin concentrations, based on multiple linear regression of copper index on total supplemental copper intake¹

Cu index2,3	Cu source	Slope ± SE	P-value4	Relative bioavailability, %
Liver Cu5	Cu sulfate	0.00016 ± 0.00003	<0.01	100
	Cu carbonate	0.00014 ± 0.00003		89.28
Plasma Cu5	Cu sulfate	0.00017 ± 0.00001	0.21	100
	Cu carbonate	0.00022 ± 0.00001		132.5
Ceruloplasmin	Cu sulfate	0.00023 ± 0.00019	0.09	100
	Cu carbonate	0.00042 ± 0.00019		186.1

¹Based on regression of Cu indices, liver in mg/kg DM, plasma in mg/L, and ceruloplasmin in mg/dL, on average daily supplemental Cu intake (g) of steers over the 96-day period.

²Regression based on final measurements following feeding a diet containing 0.1% sulfur from calcium sulfate and 2 mg/Mo/kg DM from sodium molybdate for 96 days.

³Initial values were used as a covariate in analysis for all Cu indices.

⁴ P-value for slope between copper sources.

⁵Slopes calculated using natural log-transformed values of Cu index to achieve a linear distribution.

Table 9.

(Experiment 1). Estimated relative bioavailability of tribasic copper chloride compared to copper sulfate after 96 days of supplementation on growing beef steer liver copper, plasma copper, and plasma ceruloplasmin concentrations, based on multiple linear regression of copper index on total supplemental copper intake¹

Cu index2,3	Cu source	Slope ± SE	P-value4	Relative bioavailability, %
Liver Cu5	Cu sulfate	0.00013 ± 0.00003	<0.01	100
	Tribasic Cu chloride	0.00012 ± 0.00003		88.18
Plasma Cu5	Cu sulfate	0.0000005 ± 0.00001	0.82	100
	Tribasic Cu chloride	−0.000004 ± 0.00001		100
Ceruloplasmin	Cu sulfate	0.00024 ± 0.0001	0.18	100
	Tribasic Cu chloride	0.00018 ± 0.0001		73.15

¹Based on regression of Cu indices, liver in mg/kg DM, plasma in mg/L, and ceruloplasmin in mg/dL, on average daily supplemental Cu intake (g) of steers over the 96-day period.

²Regression based on final measurements following feeding a diet containing 0.1% sulfur from calcium sulfate and 2 mg/Mo/kg DM from sodium molybdate for 96 days.

³Initial values were used as a covariate in analysis for all Cu indices.

⁴ P-value for slope between copper sources.

⁵Slopes calculated using natural log transformed values of Cu index to achieve a linear distribution.

Experiment 2

Liver and plasma copper

Liver Cu data are summarized in Table 10, and plasma Cu and ceruloplasmin data are summarized in Figure 1. Day 0 values for each measure were used as a covariate in analysis of day 21 values. Liver Cu on day 0 differed (P = 0.05) where SUL5 had greater liver Cu than CO5 (P < 0.01), and CON and TBCC5 were intermediate (P ≥ 0.13); at this point, all steers were receiving the same 5 mg Mo/kg diet DM, 0.4% total S, and no supplemental Cu. After 21 d of supplementation, all Cu-supplemented treatments had greater liver Cu than CON (P ≤ 0.03), with no differences between supplemented treatments (P ≥ 0.40). The change in liver Cu from the beginning to end of repletion did not differ between Cu-supplemented treatments (P ≥ 0.16). From the beginning to end of repletion, CON experienced a greater decrease in liver Cu than CO5 (P < 0.01) and tended to experience a greater decline in liver Cu than TBCC5 (P = 0.08). The decrease in liver Cu from start and end of repletion did not differ between SUL5 and CON. Plasma Cu concentrations were not affected by treatment (P = 0.38) or treatment × day (P = 0.16); however, plasma Cu was affected by day (P < 0.01) where days 7 and 14 were similar (P = 0.23), with decreased plasma Cu concentrations on day 21 (P ≤ 0.01).

Table 10.

(Experiment 2). Effect of four different repletion strategies on liver copper recovery over a 21-day supplementation period following 85 days of copper depletion¹

	Treatment2					Treatment P-value
	CON	CO5	SUL5	TBCC5	SEM
Liver Cu, mg/kg DM
day 03	66ab	46b	88a	66ab	10.1	0.05
day 21 (raw)	44	43	73	53	—	—
delta3,4	−22by	−7a	−14ab	−13ax	3.7	0.04
day 213,5	44b	55a	57a	53a	3.12	0.02

¹All treatments were fed no supplemental Cu and supplemented with 5 mg Mo/kg DM and 0.1% S/kg DM to deplete Cu status for 85 days prior to initiating repletion period.

²Repletion treatments were fed from day 0 to day 21, and included no supplemental Cu (CON), 5 mg Cu from Cu carbonate/kg DM (CO5), 5 mg Cu from copper sulfate/kg DM (SUL5), or 5 mg Cu from tribasic Cu chloride/kg DM (TBCC5). During the repletion period, all treatments received 5 mg Mo from sodium molybdate/kg DM and no supplemental S; the basal diet contained 0.3% S.

³Within day, values with differing superscripts (a, b) indicate significant differences between treatments (P ≤ 0.05) and (x, y) indicate tendencies (0.05 < P ≤ 0.1).

⁴Analysis of the change in liver Cu from day 0 to day 21.

⁵Day 0 liver Cu concentrations were used as a covariate in analysis of day 21 liver Cu concentrations.

Figure 1.

(Experiment 2). Effect of four different copper repletion strategies on plasma copper (A) and ceruloplasmin (B) concentrations following 85 days of depletion. Samples collected on days 7, 14, and 21 following initiation of repletion treatments were analyzed as repeated measures using samples collected on day 0 as a covariate. (A) Values with unlike superscripts differ by day (P ≤ 0.05). (B) Values with unlike superscripts tend to differ by treatment × day (0.05 < P ≤ 0.1).

Ceruloplasmin tended to be affected by treatment × day (P = 0.07), where CO5, SUL5, and TBCC5 tended to be higher on day 14 than on day 7 (P ≤ 0.09), while CON remained constant on days 7 and 14 (P = 0.51), and decreased from day 14 to day 21 (P = 0.03). The main effect of day was significant (P < 0.01) where day 14 was highest (P < 0.01), and days 7 and 14 were similar (P = 0.17). There was a tendency for ceruloplasmin to be affected by treatment (P = 0.07), where SUL5 had greater ceruloplasmin concentrations than the other treatments (P ≤ 0.05) with all other treatments being similar (P ≥ 0.6).

Discussion

Copper plays an essential role in various enzymes and physiological processes (Suttle, 2010). Thus, Cu deficiency can hinder growing cattle performance, but the extent of this is highly dependent on the severity of Cu deficiency. In Exp. 1 of the present study, all treatments had marginal Cu status on day 0 based on liver Cu concentration thresholds outlined by Kincaid (1999). By the end of the study, control steers on average had liver Cu concentrations of 21 mg Cu/kg liver DM, while the threshold for clinical deficiency is 20 mg Cu/kg liver DM. Treatments supplementing 5 or 10 mg Cu/kg DM were marginal and adequate, respectively. Given the borderline clinically deficient Cu status of the non-supplemented steers, it is unsurprising that differences in most performance measures are inconsistent between supplemented treatments and controls.

Even though indices of Cu status did not differ between Cu source in Exp. 1, there were differences in bioavailability. Circulating Cu concentrations are tightly regulated by the liver, the primary site of Cu storage, and there is no correlation between liver Cu and circulating Cu until liver Cu drops below 40 mg/kg DM (Claypool et al., 1975). Interestingly, both CuCO₃ and TBCC were less bioavailable than CuSO₄ based on liver Cu, the primary indicator of Cu status, but CuCO₃ tended to be more bioavailable than CuSO₄ based on ceruloplasmin. However, it should be noted that ceruloplasmin is a major acute phase protein in cattle and physiological stress can induce changes in ceruloplasmin concentrations (Gitlin, 1998). This should be remembered when interpreting ceruloplasmin as an indicator of Cu status.

This discrepancy between liver Cu and ceruloplasmin RBV calculations seems to be consistent with the few previous studies that have examined CuCO₃ supplementation. For example, Chapman and Bell (1963) noted that steers orally dosed with CuCO₃ had greater plasma Cu concentrations over a 96 h period than those that were dosed with other Cu sources including CuSO₄, Cu oxide, Cu nitrate, and Cu chloride. The authors also reported increased Cu excretion in urine and feces in steers dosed with CuCO₃ compared to the other sources. This may align with the greater RBV for CuCO₃ based on ceruloplasmin, which accounts for approximately 70–90% of total plasma Cu (Kincaid, 1999), but decreased RBV based on liver Cu. Further, Ward et al. (1996) reported that heifers supplemented 5 mg Cu/kg DM from CuCO₃ had a similar reduction in liver Cu to non-supplemented controls when fed with 5 mg Mo/kg DM and 0.15% S, but steers supplemented with CuCO₃ maintained greater plasma Cu concentrations than controls.

When considered with the previous body of work, results of the present study suggest that Cu from CuCO₃ is more available for absorption into the bloodstream. Because the liver tightly regulates Cu in circulation via ceruloplasmin synthesis, the difference between RBV results based on liver and ceruloplasmin may be due to impacts of CuCO₃ on Cu trafficking in the liver. However, in our study, no differences in expression of genes involved in Cu import (CTR1), ceruloplasmin synthesis, or export into blood and bile (COMMD1, ATP7B, CP) due to Cu treatment were observed. Regulation of these transporters is a complex process, and there may be other factors post-transcriptionally influencing Cu metabolism. Measuring the abundance of these Cu trafficking proteins could provide clearer insights into differences in Cu metabolism in the liver; however, the ability to detect these proteins is limited due to a lack of bovine antibodies available.

Similar to CuCO₃, TBCC was not as available as CuSO₄ based on liver Cu, and based on plasma Cu, TBCC and CuSO₄ were similar. Based on liver Cu, Spears et al. (2004) reported Cu from TBCC was nearly twice as available compared to CuSO₄ when fed to steers with initially adequate Cu status, 5 mg Mo/kg diet DM, and 0.15% S. Multiple factors may have contributed to the differing results in the present study, including cattle breed type and dietary ingredients other than Cu, S, and Mo that may influence Cu absorption. However, the primary difference between the design of Spears et al. (2004) and the present study is the antagonistic pressure the cattle were subjected to. Spears et al. (2004) supplemented diets with 5 mg Mo/kg diet DM, over twice the supplementation of the present study (2 mg Mo/kg diet DM). Further, Spears et al. (2004) supplemented S at a rate of 0.15%, while the present study supplemented at 0.1%. Both studies shared similar treatment designs, sample collection and analytical procedures, and the slope-ratio assay to determine RBV. Perhaps 2 mg Mo/kg DM and 0.1% S did not create enough antagonistic pressure to hinder CuSO₄ availability to the level where feeding TBCC would be superior in the present study. A second experiment conducted by Spears et al. (2004) determined the repletion rates of TBCC and CuSO₄ in Cu-depleted steers, but without supplemented antagonists during the repletion period (the basal diet contained 1.8 mg Mo/kg DM). Results of this study were similar to the present study, with TBCC being similarly or numerically less bioavailable than CuSO₄ depending on the measure used. If there is not enough soluble Cu present in the rumen for thiomolybdates to bind, unbound thiomolybdate will be absorbed into the blood and systemically deplete Cu. Given that TBCC is not as soluble as CuSO₄, it is possible that there was more unbound thiomolybdate in TBCC-fed cattle than those fed CuSO₄, leading to a greater degree of systemic Cu antagonism. This may explain why TBCC did not perform as well as CuSO₄ in the present study.

Results of Exp. 2 in the present study are less clear than those of Exp. 1, partially due to differences in Cu status at the start of repletion. To account for these differences in initial liver Cu, day 0 concentrations were used as a covariate in the analysis of day 21 liver Cu concentrations. To better understand the biological changes in liver Cu concentration, the decline in liver Cu from day 0 to day 21 was analyzed. The non-supplemented controls and SUL5 experienced the same decline in liver Cu, which was greater than the decline exhibited by TBCC5 and CO5. This suggests the 5 mg of supplemental Cu from SUL5, the most soluble Cu source in this study, was not enough to overcome the antagonistic pressure created by 5 mg Mo/kg DM and 0.3% total S. Further, TBCC tended to have a lesser decline in liver Cu than CON, and CO5 has a significantly less decline. This could indicate that the Cu carbonate and TBCC sources are more effective against dietary antagonists in this relatively short time period.

Though it was not affected by treatment, plasma Cu was affected by day of repletion. This may be attributable to environmental conditions, as 70% to 90% of Cu in plasma is associated with ceruloplasmin (Kincaid 1999), an acute phase protein that increases in activity during states of inflammation (Gitlin, 1988). Indeed, plasma Cu trends closely follow that of ceruloplasmin, where they both peak on day 14. Perhaps the observed changes in ceruloplasmin activity can be attributed to weather. High temperatures at the Iowa State University Beef Nutrition Farm averaged 35 °C over days 3–5 of repletion, which could have resulted in increased inflammation measured as ceruloplasmin for the following several days. Average high temperatures were 26 °C over days 14–20. Perhaps the decline in temperature contributed to the decline in ceruloplasmin concentrations throughout the remainder of this repletion period.

In conclusion, CuCO₃ appears to perform better than CuSO₄ when measuring Cu in circulation as ceruloplasmin activity, but the opposite is noted when considering liver Cu. Analyzing liver tissue collected on day 96 of the present study for gene expression did not reveal potential mechanisms for the difference in RBV of CuCO₃ between liver Cu and ceruloplasmin concentrations. Further, Exp. 2 demonstrates the significant impact that the presence of dietary antagonists and environmental factors has when comparing sources of Cu.

Glossary

Abbreviations:

ADG

average daily gain

AOC3

serum amine oxidase

BW

body weight

CuCO₃

copper carbonate

CuSO₄

copper sulfate

DDGS

dried distiller’s grains with solubles

DMI

dry matter intake

G:F

gain:feed

ICP-OES

inductively coupled plasma-optical emission spectrometry

qPCR

quantitative real-time polymerase chain reaction

TBCC

tribasic copper chloride

TMR

total mixed ration

Funding

This study was partially supported by Old Bridge Minerals Inc. (Old Bridge, NJ).

Author Contributions

Jacob Henderson (Data curation, Formal analysis, Investigation, Visualization, Writing—original draft), and Stephanie Hansen (Conceptualization, Funding acquisition, Investigation, Methodology, Project administration, Resources, Supervision, Validation, Writing—review & editing)

Conflict of interests statement. None declared.