TLR4/NF-κB-mediated M1 macrophage polarization contributes to the promotive effects of ETS2 on ulcerative colitis

Abstract

Objective

ETS2 is a core modulator of macrophages. This study aims to investigate the effects of ETS2 on macrophage polarization in ulcerative colitis (UC) and the involvement of TLR4/NF-κB pathway.

Methods

A dextran sulfate sodium (DSS)-induced acute UC mice model was established, along with a lipopolysaccharide (LPS)/IFN-γ-stimulated RAW264.7 cell model to mimic inflammation. Immunofluorescence was employed to examine the co-localization of ETS2 with M1 macrophage markers (F4/80 and iNOS). Flow cytometry quantified the iNOS⁺/F4/80⁺ M1 macrophage subgroups. Inflammatory cytokine (TNF-α and IL-1β) levels in cell supernatants were detected using enzyme-linked immunosorbent assay. Western blot analyzed the expressions of M1 markers (CD86 and iNOS) and TLR4/NF-κB pathway components (TLR4, p-p65/p65, and p-IκBα/IκBα). An sh-ETS2 lentiviral vector was constructed for ETS2 knockdown in vitro and in vivo. The TLR4 agonist RS 09 was used to rescue macrophage polarization and inflammatory responses.

Results

In DSS-induced UC mice, ETS2 was significantly upregulated in colon tissues and co-localized with F4/80. LPS/IFN-γ-treated RAW264.7 cells also exhibited elevated ETS2 expression, accompanied by increased inflammatory cytokine secretion, expansion of iNOS⁺/F4/80⁺ macrophage subgroups, and activated TLR4/NF-κB pathway. Furthermore, ETS2 deficiency in RAW264.7 cells significantly inhibited the macrophage polarization towards M1 pro-inflammatory phenotype and blocked the TLR4/NF-κB pathway. However, RS 09 counteracted the anti-inflammatory effects of ETS2 knockdown. In vivo silencing of ETS2 attenuated M1 macrophage polarization and inflammatory cytokine production, while ameliorating pathology in UC mice.

Conclusion

ETS2 enhanced the inflammatory response in UC by activating TLR4/NF-κB-mediated M1 macrophage polarization.

Background

Ulcerative colitis (UC) is an inflammatory intestinal disease that extends from the rectum proximally to colonic mucosa, manifesting clinically with abdominal pain, diarrhea, bleeding, weight loss, and dehydration [1, 2]. Globally, over five million individuals suffer from UC, with this number increasing annually [3, 4]. Alarmingly, patients with UC have a 4.5% risk of developing colorectal cancer 20 years after diagnosis, which is 1.7-fold higher than the general population [5]. Although pharmacological treatment is the first choice for patients with UC, 10–20% of refractory cases still face colectomy [6, 7]. Therefore, research into the pathophysiology, biomarkers, and genetic mechanisms of UC is essential to enhance our understanding of this disease, thereby improving clinical outcomes and the long-term quality of life for patients [8].

Monocyte-derived macrophages are innate immune cells that reside in the gut and participate in inflammatory responses [9–11]. The pathogenesis of UC is closely related to imbalance in the M1/M2 macrophage, particularly the over-activated M1 macrophage leading to heightened pro-inflammatory cytokine secretion [12]. It is known that pro-inflammatory macrophages exacerbate dextran sulfate sodium (DSS)-induced intestinal inflammation in mice [13, 14]. Moreover, the macrophage-related gene HMGCS2 is involved in the transformation of UC to colorectal cancer [15]. As gatekeepers of intestinal immune homeostasis [16], macrophages represent promising therapeutic targets for overcoming current diagnostic and treatment limitations in UC.

ETS2 is a core regulator of human inflammatory macrophages and is involved in various transcriptional regulatory mechanisms [17, 18]. It can modulate inflammatory functional gene TLR4 in bowel diseases [19]. Notably, inhibition of TLR4/MyD88/NF-κB signaling prevents macrophage polarization toward M1 pro-inflammatory phenotypes [20]. TLR4-mediated NF-κB and MAPK signaling pathways can also alleviate sepsis-induced myocardial disease by regulating macrophage polarization [21]. Furthermore, xylan acetate ester improves intestinal inflammation by inhibiting the LPS-TLR4 pathway, downregulating M1 macrophage polarization, and reducing pro-inflammatory cytokine release [22]. However, the potential role of ETS2-mediated macrophage polarization in UC, particularly through the TLR4/NF-κB signaling pathway, remains unclear.

Based on existing evidences, we speculated that ETS2 may be involved in UC progression by affecting macrophage polarization through the TLR4/NF-κB signaling pathway. To verify the above hypothesis, we established a DSS-induced acute UC mice model and a lipopolysaccharide (LPS)/IFN-γ-induced inflammatory cell model. Subsequently, a series of in vivo and in vitro experiments were conducted to investigate the effects of ETS2 on macrophage polarization and UC progression, as well as the involvement of TLR4/NF-κB pathway. Therefore, ETS2 may serve as a promising candidate biomarker that could improve current clinical approaches for UC diagnosis and treatment. These findings are also expected to enhance our understanding on underlying genetic mechanisms of UC and provide new guidance for optimizing clinical management strategies.

Methods

Animal experiments

Thirty-six C57BL6/J mice (6–8 weeks, 20–25 g) were provided by the Experimental Animal Center of Yangzhou University and acclimatized for one week under a 12-h light/dark cycle. Twelve mice were randomly divided into two groups (n = 6): Control and Model groups. The acute UC model was established by administering 40 mg/kg DSS (HY-116282C, MCE, NJ, USA) in drinking water for six consecutive days, followed by normal drinking water until the end of the experiment on day 8 [23, 24]. During this period, the body weight, stool consistency, and physical posture were recorded daily. The body weight change was calculated as (final weight–initial weight)/initial weight × 100%. The disease activity index (DAI) was blindly assessed as (body weight loss score + stool consistency score + posture score)/3. The scoring criteria of body weight loss were as follows: 0 (no weight loss or weight gain), 1 (5–10% weight loss), 2 (10–15% weight loss), 3 (> 15% weight loss). The scoring criteria of stool consistency were as follows: 0 (normal and well-formed), 1 (soft but formed), 2 (diarrhea), 3 (bloody stool). The scoring criteria of posture were as follows: 0 (smooth fur, no hunching), 1 (mild fur and hunching), 2 (moderate fur and hunching), 3 (severe fur and heavy hunching). On day 8, mice were humanely euthanized by Zoletil (0.5g/100g), and colon tissues were collected for length measurement, macrophage marker detection, and histological analysis.

To investigate the effect of ETS2 deficiency in vivo, another 24 mice were randomly divided into four groups (n = 6): Control, Model, Model + sh-NC, and Model + sh-ETS2 groups. One week before DSS induction, the mice of Model + sh-NC and Model + sh-ETS2 groups received tail vein injections of 5 μL lentiviral vectors (5 × 10⁸ TU/mL) carrying sh-NC or sh-ETS2, respectively. The sequence of sh-ETS2 (GAGCAAGGCAAACCAGTTATT) was designed on the online tool of VectorBuilder and packaged into lentivirus with a plasmid carrier composed in the ratio of pMDLg/pRRE:pVSV-G:pRSV-Rev = 5:3:2. Procedures of all animal experiments were permitted by the Experimental Animal Ethics Committee of Yangzhou University (No. 202505021).

Cell culture and treatment

Mouse macrophage RAW264.7 (CL-0190, Procell, Wuhan, China) were maintained in DMEM/F12 (11320033, Thermo, MA, USA) containing 10% FBS (S9030, Solarbio, Beijing, China) and 1% Penicillin–Streptomycin (SV30010, Hyclone, UT, USA) under general conditions (37 °C with 5% CO₂). The sh-NC/sh-ETS2 lentivirus were transfected into cells for 48 h to achieve stable silencing of ETS2. To induce M1 macrophage polarization and establish an inflammatory cell model, the cells were stimulated with LPS (100 ng/mL, L8880, Solarbio) and IFN-γ (50 ng/mL, P00028, Solarbio, Beijing, China) for 12 h [25]. The TLR4 agonist RS 09 (10 μM, HY-P1439, MCE, NJ, USA) was then added to cells for 30 min to activate the TLR4/NF-κB pathway.

Quantitative real-time polymerase chain reaction (qPCR)

Total RNA was extracted from colon tissues and RAW264.7 cells for reverse transcription and cDNA library construction. The cDNA template was further mixed with primers (ETS2: forward-GCCAACAGTTTTCGTGGGAC, reverse-TTACACAGCATCTGGCCGTT; GAPDH: forward-TGTGGGCATCAATGGATTTGG, reverse-ACACCATGTATTCCGGGTCAAT) and amplified for 40 cycles on a PCR instrument (CFX96 Touch, Bio-Rad, CA, USA). The PCR reaction conditions were set at 95 °C for 10 min, 95 °C for 12 s, and 60 °C for 40 s. The data were processed using 2^−ΔΔCt method. Relative to GAPDH, the mRNA level of ETS2 was estimated.

Western blot

Total proteins were extracted from colon tissues and RAW264.7 cells and quantified to a uniform concentration. Equal volumes of samples were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis and then transferred onto polyvinylidene fluoride membranes (FFP24, Beyotime, Shanghai, China). After membrane blocking, diluted primary antibodies (anti-ETS2: 1:500, PA5-120275, Thermo, MA, USA; anti-TLR4, 1:200, 48–2300, Thermo, MA, USA; anti-p65: 3 μg/mL, 51–0500, Thermo, MA, USA; anti-p-p65: 1:1000, MA5-15160, Thermo, MA, USA; anti-IκBα: 1:1000, AF5002, Affinity, CA, USA; anti-p-IκBα: 1:1000, AF2002, Affinity, CA, USA; anti-CD86: 1:500, DF6332, Affinity, CA, USA; anti-iNOS: 1:200, PA1-036, Thermo, MA, USA) were applied to cover the membranes completely and incubated overnight. On the second day, the free primary antibodies on the membrane surface were washed off and replaced with secondary antibody working solution (Goat Anti-Rabbit IgG H&L: 1:200, ab6721, Abcam, Cambridge, UK) for another one-hour incubation. Finally, the membrane was rinsed with enhanced chemiluminescence (P1000, APPLYGEN, Beijing, China) for development. The protein bands on exposed films were scanned and quantified for gray-scale values using ImageJ software. The relative protein expression of candidates was represented by the ratio of gray-scale values of target bands to the internal reference.

Immunofluorescence

In this study, immunofluorescence was adopted to detect the fluorescence intensity of F4/80, iNOS, and ETS2 in colon tissues and RAW264.7 cells. Specifically, the tissues were prepared into paraffin sections according to routine methods. After antigen repair for 10–15 min at 92–96 °C, the sections were blocked with bovine serum albumin (37 °C, 60 min). Subsequently, primary antibodies (anti-ETS2: 1:200, ab219948, Abcam, Cambridge, UK; anti-F4/80, 1:200, HY-P80665, MCE, NJ, USA; anti-iNOS: 1:200, ab49999, Abcam, Cambridge, UK) were added to the sections for overnight incubation. The next day, corresponding secondary antibodies (Goat Anti-Rabbit IgG H&L[Alexa Fluor^® 488]: 1:200, ab150077, Abcam, Cambridge, UK; Goat Anti-Rat IgG H&L[Alexa Fluor^® 594]: 1:200, ab150156, Abcam, Cambridge, UK; Goat Anti-Mouse IgG H&L[Alexa Fluor^® 647]: 1:200, ab150115, Abcam, Cambridge, UK) were incubated for 60 min, followed by the addition of 4',6-diamidino-2-phenylindole (C1005, Beyotime, Shanghai, China) for nuclear staining in the dark (10 min). Finally, the sections were sealed with anti-fade mounting medium (p0126, Beyotime, Shanghai, China) and observed under a laser confocal microscope (TCS SP8, Leica, Wetzlar, Germany). The fluorescence intensity was quantified using the ImageJ software.

Enzyme-linked immunosorbent assays (ELISA)

Cell supernatants were collected to detect the levels of TNF-α (ml002095, Mlbio, Shanghai, China) and IL-1β (ml301814, Mlbio, Shanghai, China) using corresponding ELISA kits. Briefly, standards and samples were added to the enzyme-coated plate and incubated for 30 min. Afterward, 50 μL of enzyme-labeling working solution was added to each well, except for the blank control. After incubation for 30 min, the color-developing solution was added for incubation of 15 min in the dark at 37 °C. Finally, the reaction was terminated for 15 min. The absorbance at 450 nm was measured for each group using a microplate reader (DR-3518G, Hiwell Diatek, Wuxi, China).

Flow cytometry

In this study, flow cytometry was employed to detect the proportion of M1 phenotype (iNOS⁺/F4/80⁺) among RAW264.7 cells. For this purpose, LPS/IFN-γ-induced RAW264.7 cells were first washed and resuspended with PBS. Then, 3 μL of PE anti-iNOS (123107, BioLegend, Beijing, China) and FITC anti-F4/80 (696805, BioLegend, Beijing, China) antibodies were added incubate in the dark for 20–30 min. After another wash, the cells were resuspended in 200 μL PBS and the proportion of iNOS⁺/F4/80⁺ subgroups was monitored on a flow cytometer (CytoFLEX S, Beckman, CA, USA).

Hematoxylin–eosin (HE) staining

Colon tissues from mice in each group were collected and prepared into paraffin sections. Following the kit instructions (C0105S, Beyotime, Shanghai, China), hematoxylin (5 min) and eosin (1–2 min) were added to the tissue sections in sequence for staining. Then, the sections were dehydrated with ethanol (10009218, SINOPHARM, Beijing, China) and cleared in xylene (10023418, SINOPHARM, Beijing, China) for 3 min. Finally, the sections were sealed and dried, and imaged under a microscope.

Statistical analysis

All experiments were repeated at least thrice. The mean ± standard deviation of these data was used as statistics for analysis. Comparisons between two groups and among multiple groups were performed using unpaired t test and one-way analysis of variance (ANOVA) (with Tukey's Honest Significant Difference), respectively. Two-way Repeated-Measures ANOVA was used for comparisons among groups at different time points. A P < 0.05 in GraphPad 7.0 was considered significant.

Results

ETS2 is upregulated in UC mice and co-localizes with macrophages

To mimic the pathological features of UC in vivo, a mice model was established in this study. The results showed that during the DSS administration, mice in the Model group exhibited significantly reduced body weight and increased DAI (Fig. 1A). After modeling, the colon length in the Model group was markedly shorter than in controls (Fig. 1B). Moreover, ETS2 mRNA and protein expression were significantly upregulated in the colon tissues of UC mice (Fig. 1C, D). More importantly, ETS2 signaling was distributed in F4/80⁺ macrophages that were abundantly present in colon tissues of Model group (Fig. 1E). Therefore, ETS2 may promote the progression of UC by mediating macrophages.

Fig. 1.

ETS2 is upregulated in colon tissues of UC mice and co-localizes with macrophages. A Changes in body weight and DAI of mice during UC modeling (n = 6). B Differences in the colon length between model and control groups after modeling (n = 6). C, D ETS2 mRNA (C, n = 3) and protein (D, n = 6) expression levels in colon tissues of Control and Model groups. (E) Co-localization of ETS2 with F4/80 in UC mice (n = 3). Scale bar = 50 μm. **P < 0.01 versus Control

ETS2 is highly expressed in M1 macrophages along with the activation of TLR4/NF-κB pathway

Mechanistic exploration was performed in RAW264.7 cells induced by LPS and IFN-γ. These treated cells showed significantly upregulated ETS2 mRNA and protein expression levels (Fig. 2A, B), as well as increased secretion of inflammatory cytokines TNF-α and IL-1β in the supernatant (Fig. 2C). In addition, the proportion of iNOS⁺F4/80⁺ subgroups was significantly higher in the Model group than in controls (Fig. 2D), indicating the polarization of macrophages towards the M1 pro-inflammatory phenotype. Furthermore, induction with LPS and IFN-γ led to significant increases in the protein levels of TLR4, p-p65/p65, and p-IκBα/IκBα in RAW264.7 cells (Fig. 2E). These results illustrated that ETS2 may be associated with M1 macrophage polarization and the activation of TLR4/NF-κB pathway.

Fig. 2.

ETS2 is associated with M1 macrophage polarization and TLR4/NF-κB pathway activation in vitro. A, B ETS2 mRNA (A) and protein (B) expressions in RAW264.7 cells induced by LPS/IFN-γ. C Levels of inflammatory cytokines (TNF-α and IL-1β) in supernatants of LPS/IFN-γ-treated RAW264.7 cells. D Proportion of iNOS⁺F4/80⁺ subgroups in the inflammatory cell model. E Levels of TLR4/NF-κB pathway proteins (TLR4, p-p65/p65, and p-IκBα/IκBα) after LPS/IFN-γ induction for macrophage differentiation. All experimental data were derived from three independent replicates for statistical analysis. **P < 0.01 versus Control

ETS2 knockdown suppresses M1 macrophage polarization and TLR4/NF-κB activation in vitro

To probe into the function of ETS2, sh-ETS2 was transfected into RAW264.7 cells, achieving the significant inhibition of ETS2 mRNA and protein levels (Fig. 3A, B). Subsequently, sh-NC/sh-ETS2-transfected RAW264.7 cells were treated with LPS and IFN-γ. Upon LPS/IFN-γ treatment, the upregulated protein expressions of ETS2 and M1 macrophage markers (CD86 and iNOS) in the Model group were markedly inhibited with sh-ETS2 transfection (Fig. 3C). Moreover, the absence of ETS2 in RAW264.7 cells significantly reversed the LPS/IFN-γ-induced promotion of inflammatory cytokine levels and iNOS⁺F4/80⁺ macrophage subpopulation (Fig. 3D, E). The enhanced co-expression of ETS2 and iNOS in the Model group was significantly suppressed in sh-ETS2-transfected cells (Fig. 3F). Similarly, the knockdown of ETS2 significantly inhibited the activation of TLR4/NF-κB pathway, as evidenced by decreased protein levels of TLR4, p-p65/p65, and p-IκBα/IκBα in the Model + sh-ETS2 group compared with the Model + sh-NC group (Fig. 3G). These results suggested that the knockdown of ETS2 inhibits the polarization of macrophages towards M1 phenotype and the activation of TLR4/NF-κB pathway in vitro.

Fig. 3.

ETS2 knockdown inhibited M1 macrophage polarization and the TLR4/NF-κB pathway in vitro. A, B ETS2 mRNA (A) and protein (B) expression in sh-NC/sh-ETS2-transfected RAW264.7 cells with LPS/IFN-γ induction. **P < 0.01 versus sh-NC. C Impact of ETS2 deficiency on protein levels of ETS2 and M1 markers (CD86 and iNOS) in inflammatory model cells. D–G Effects of ETS2 knockdown on inflammatory cytokine levels (D), iNOS⁺F4/80⁺ subpopulation (E), ETS2/iNOS co-expression (F), and TLR4/NF-κB pathway (G). Scale bar = 50 μm. All experimental data were derived from three independent replicates for statistical analysis. **P < 0.01 versus Control; #P < 0.05 and ##P < 0.01 versus Model + sh-NC

ETS2 promotes M1 macrophage polarization by activating the TLR4/NF-κB pathway

In this study, the TLR4 agonist RS 09 was further added to the sh-NC/sh-ETS2-transfected inflammatory cell model to activate the TLR4/NF-κB pathway. The results showed that RS 09 rescued the suppressed protein levels of TLR4, p-p65/p65, and p-IκBα/IκBα caused by ETS2 deficiency in the inflammatory cell model (Fig. 4A). Furthermore, the inhibitory effects of ETS2 deficiency on the expression of M1 macrophage markers (CD86 and iNOS) and the release of inflammatory cytokines (TNF-α and IL-1β) in LPS/IFN-γ-induced RAW264.7 cells were significantly reversed by the addition of RS 09 (Fig. 4B, C). Similar results were observed in flow cytometry, where the addition of RS 09 counteracted the effect of sh-ETS2, restoring the proportion of iNOS⁺F4/80⁺ subpopulation to a level close to that of the Model group (Fig. 4D). Immunofluorescence revealed that the treatment with RS 09 significantly increased the fluorescence intensity of iNOS in the Model + sh-ETS2 group cells (Fig. 4E), indicating the restoration of M1 macrophage polarization. Therefore, ETS2 may promote the polarization of M1 macrophages by activating the TLR4/NF-κB pathway.

Fig. 4.

ETS2 promotes M1 macrophage polarization by activating the TLR4/NF-κB pathway. A–E The addition of the TLR4 agonist reversed inhibitory effects of ETS2 deficiency on TLR4/NF-κB pathway markers expression (A), M1 macrophage markers expression (B), inflammatory cytokine levels (C), the proportion of iNOS⁺ F4/80⁺ macrophages (D), and iNOS fluorescence intensity (E) in LPS/IFN-γ-induced RAW264.7 cells. Scale bar = 50 μm. All experimental data were derived from three independent replicates for statistical analysis. **P < 0.01 versus Control; #P < 0.05 and ##P < 0.01 versus Model + sh-NC; &P < 0.05 and &&P < 0.01 versus Model + sh-ETS2

ETS2 deficiency ameliorates the histopathology and M1 macrophage-mediated inflammatory in UC mice

To validate these findings in vivo, sh-NC or sh-ETS2 lentivirus was injected through the tail vein before modeling. The injection of sh-ETS2 lentivirus significantly reversed the decreased body weight and increased DAI in the Model group (Fig. 5A). ETS2 deficiency also significantly increased the colon length of mice in the Model group (Fig. 5B). Examination of colon tissues confirmed that injection of sh-ETS2 lentivirus observably reduced ETS2 mRNA and protein expressions in the Model group (Fig. 5C, D). HE staining revealed that colon tissues in the Model and Model + sh-NC groups exhibited crypt destruction, goblet cell loss, and inflammatory infiltration, but these histopathological features were markedly improved in the Model + sh-ETS2 group (Fig. 5E). In addition, ETS2 deficiency reduced inflammatory cytokines and diminished co-localization of M1 macrophage markers (F4/80 and iNOS) with ETS2 in colon tissues of Model group (Fig. 5F, G). These results demonstrated that ETS2 deficiency ameliorates the histopathological features and M1 macrophage polarization-mediated inflammatory response in UC mice.

Fig. 5.

Effects of ETS2 knockdown on histopathology, inflammatory levels, and M1 macrophage polarization in vivo. A ETS2 knockdown reversed the decreased body weight and increased DAI in mice during UC modeling (n = 6). B Injection of sh-ETS2 lentivirus improved the decreased colon length in the Model group (n = 6). C, D Injection of sh-ETS2 lentivirus reduced ETS2 mRNA (C) and protein (D) expressions in the colon tissues of Model group (n = 3). E HE staining revealing the histopathological features of colonic tissues in each group of mice (n = 3). Scale bar = 100 μm. F, G Effects of ETS2 knockdown on inflammatory cytokine levels (F, n = 6) and the co-expression fluorescence intensity of M1 macrophage markers (F4/80 and iNOS) and ETS2 (G, n = 3) in the colon tissues of UC mice. Scale bar = 50 μm. **P < 0.01 versus Control; ##P < 0.01 versus Model + sh-NC

Discussion

Based on evidence from in vivo and in vitro experiments, this study elucidated the promotive effect of ETS2 on M1 macrophage polarization and UC progression. More importantly, the TLR4/NF-κB pathway is involved in this process and positively mediates the pro-inflammatory mechanisms of ETS2 in the intestine. Therefore, ETS2 holds promise as a potential therapeutic target for UC.

ETS2 is an oncogene that is transcriptionally activated by super-enhancers and is overexpressed in both colorectal cancer and inflammatory bowel diseases [26]. The ETS2/AURKA/NF-κB-mediated apoptosis of T cells is key to mesenchymal stem cell therapy for UC [27]. Pro-inflammatory genes shared between acute colitis and chronic inflammatory diseases contain enriched ETS2 binding sites [28]. Additionally, overexpression of ETS2 is associated with significant upregulation of innate immune responses (monocytes/neutrophils/inflammation-related pathways) [29]. These studies revealed the pro-inflammatory potential of ETS2, aligning with our observation of significant ETS2 upregulation in DSS-induced acute UC mice models and LPS/IFN-γ-stimulated inflammatory cell models.

Notably, the role of ETS2 in intestinal pathology appears to be related to its regulation of macrophage-driven inflammation. As the modulator of macrophage-driven inflammation, ETS2 can upregulate multiple pro-inflammatory cytokines, including TNF-α, IL-23, and IL-1β [30]. Recent studies have shown that ETS2 can regulate inflammatory macrophages in inflammatory bowel diseases [31, 32]. This study further confirmed that ETS2 promotes the expression of M1 macrophage markers, secretion of inflammatory cytokines, and the proportion of the iNOS⁺/F4/80⁺ macrophage subgroup. Conversely, the knockdown of ETS2 in vivo and in vitro significantly inhibited these inflammatory phenotypes. Moreover, Wei et al. proposed that ETS2 mediates macrophage survival and inflammatory gene expression through phosphorylation modifications, thereby playing a role in severe inflammatory diseases [33]. However, the epigenetic mechanisms underlying ETS2-mediated M1 polarization and inflammatory response warrant further investigation.

ETS2 is regulated by the upstream CSF1/CSF1R signaling pathway, which may drive adaptive dysfunction of monocytes and macrophage incompetence to accelerate intestinal inflammation [34]. However, the understanding of molecular regulatory mechanisms involved in ETS2-mediated macrophage polarization and pro-inflammatory effects is still incomplete. This study proposed a novel mechanistic layer that ETS2 promotes M1 macrophage polarization and UC pathology by activating the TLR4/NF-κB pathway. Quinn et al. reported that ETS2 serves as a key downstream modulator of TLR4 responses [35]. The major inflammatory mediators ETS2 and NF-κB were also found to be significantly upregulated under the action of LPS [36]. Furthermore, the binding of ETS to the mutant TERT promoter requires NF-κB signaling to drive transcription, thereby maintaining telomerase activity and cancer progression [37]. These findings were consistent with our results, as the upregulation of ETS2 in acute UC mice models and in vitroinflammatory cell models is often accompanied by the activation of TLR4/NF-κB pathway. The addition of TLR4 agonist can counteract the inhibitory effects of ETS2 deficiency on M1 macrophage polarization and inflammatory responses.

The involvement of TLR4/NF-κB pathway in macrophage polarization and inflammatory responses has been extensively reported. For instance, blocking the TLR4/NF-κB pathway can promote the polarization of macrophages from M1 to M2 phenotype, thereby alleviating myocardial inflammation [38]. The reduction of M1 macrophage polarization and alleviation of silica-induced inflammation may be achieved by inhibiting the HMGB1/TLR4/NF-κB signaling axis [39]. Baicalin inhibits the activation of LPS-induced TLR4/NF-κB p65 pathway and murine inflammatory diseases in a CD14-dependent manner [40]. Blockade of the TLR4/NF-κB pathway is likewise critical for UC treatment. For example, Anemoside B4 can inhibit the expression of key proteins in the DSS-induced TLR4/NF-κB/MAPK signaling pathway, thereby alleviating UC inflammatory progression [41]. MaR1 exerts a protective effect in DSS-induced UC by inactivating the TLR4/NF-κB signaling pathway mediated by Nrf2 [42]. Yang et al. reported that the natural active compound Chichoric acid exerts anti-UC efficacy by inhibiting M1 macrophage polarization and blocking the TLR4/NF-κB signaling pathway [43]. Therefore, the knockdown of ETS2 may be an effective therapeutic approach, alleviating UC pathology by inhibiting the TLR4/NF-κB-mediated M1 macrophage polarization.

However, this study also has certain limitations. First, this study lacks clinical data to investigate the relationship between ETS2 levels and inflammatory indexes in the blood or urine samples from patients with UC. Second, the direct targeting relationship between ETS2 and TLR4/NF-κB pathway has not been confirmed. Third, the potential applicability of ETS2/TLR4/NF-κB-driven M1 macrophage polarization mechanisms in chronic UC pathogenesis remains undetermined. Subsequent mechanistic studies can focus more on the interactions between ETS2 and TLR4 using molecular biological approaches, as well as the involvement of transcriptional regulation and epigenetic mechanisms of ETS2 in the pro-inflammatory processes of both acute and chronic UC.

Conclusion

ETS2 is significantly upregulated in DSS-induced acute UC mice models and LPS/IFN-γ-stimulated inflammatory cell models, concomitant with enhanced macrophage polarization toward the pro-inflammatory M1 phenotype. Comprehensive experiments confirmed that ETS2 silencing inhibits M1 macrophage polarization and inflammatory responses by blocking the TLR4/NF-κB pathway, thereby alleviating the UC pathology. These results highlight ETS2 as a promising therapeutic target for anti-inflammatory intervention in UC.

Abbreviations

ANOVA

One-way analysis of variance

DAI

Disease activity index

DSS

Dextran sulfate sodium

ELISA

Enzyme-linked immunosorbent assays

HE

Hematoxylin–eosin

LPS

Lipopolysaccharide

qPCR

Quantitative real-time polymerase chain reaction

UC

Ulcerative colitis

Author contributions

B.L.: Conception and design of the research, acquisition of data, analysis and interpretation of data, statistical analysis, obtaining funding and drafting the manuscript. J.Y.: Acquisition of data and statistical analysis. J.Z.: Acquisition of data and Analysis and interpretation of data. W.Y.: Conception and design of the research. J.Y.: Conception and design of the research, analysis and interpretation of data, statistical analysis and revision of manuscript for important intellectual content. All authors read and approved the final manuscript.

Funding

This study was supported by Zhejiang science and technology research fund of traditional Chinese medicine (No. 2023ZL521).

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethics approval and consent to participate

Procedures of all animal experiments were permitted by the Experimental Animal Ethics Committee of Yangzhou University (No. 202505021).

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.