Abstract
Objective:
This study aims to investigate the mRNA expression levels of Toll-like receptor 9 and microRNA-155 in Iraqi patients diagnosed with acute myeloid leukemia (AML) within a case-control study framework. Additionally, the study will assess relevant hematological parameters.
Methods:
This study enrolled 40 Iraqi patients diagnosed with AML who were undergoing chemotherapy and experiencing relapse, and 40 healthy individuals as a control group. Hematological parameters were measured using a complete blood count (CBC) device. RNA was extracted from samples, quantified, and assessed for purity. Subsequently, RNA was reverse-transcribed into complementary DNA (cDNA). The relative expression levels of TLR-9 and miR-155 genes were quantified using quantitative real-time polymerase chain reaction (qRT-PCR).
Result:
Hemoglobin, erythrocyte, hematocrit, and platelet levels exhibited significant differences between AML patients and healthy controls. In contrast, white blood cell and lymphocyte counts were not significantly different between the two groups. TLR-9 gene expression was comparable between healthy controls and AML patients, with fold change values of 1.000 and 1.49, respectively. However, miR-155 expression was significantly lower in AML patients compared to healthy controls, with fold change values of 0.608 and 1.000, respectively.
Conclusion:
To evade host immune surveillance, cancer cells may downregulate the expression of TLR-9 and miR-155. This dysregulation may contribute to the progression and development of AML. Furthermore, the downregulation of miR-155 and dysregulation of TLR-9 during oncogenesis may serve as potential prognostic markers for AML patients.
Key Words: Acute Myeloid Leukemia, Pattern Recognition Receptors, Toll-Like Receptor-9 gene, miR-155
Introduction
Leukemia is a type of blood cancer that arises from the bone marrow’s dysfunction. It is characterized by the abnormal proliferation of white or red blood cells and can manifest as either an acute or chronic condition [1, 2]. Between 2005 and 2015, the global incidence of leukemia increased by 26% [3, 4]. According to the 2018 annual publication of the Iraqi Cancer Registry, leukemia was the third most common cancer among Iraqi males, with 1061 cases and an incidence rate of 7.79 per 100,000 population. Among females, leukemia ranked fourth, with 838 cases and an incidence rate of 4.68 per 100,000 population [5]. Acute Myelocytic Leukemia (AML) is a hematological malignancy characterized by the uncontrolled proliferation of immature myeloid cells, known as blast cells. Age and the specific biological characteristics of the disease are significant prognostic factors for AML. Left untreated, AML can be fatal [6]. Acute Myeloid Leukemia pathogenesis involves the abnormal growth and differentiation of myeloid stem cells. This can arise from underlying hematological disorders or as a consequence of prior treatments. Various genetic abnormalities, such as chromosomal translocations, deletions, or additions, play a crucial role in driving AML development. [7, 8].
Toll-like receptors (TLRs) are key components of the innate immune system, functioning as Pattern Recognition Receptors (PRRs). They play a crucial role in recognizing both non-pathogenic and pathogenic microorganisms, as well as in immune surveillance. TLRs can detect pathogen-associated molecular patterns (PAMPs) and damage-associated molecular patterns (DAMPs), enabling them to initiate immune responses in response to external or internal threats [9]. The TLRs induce an immune response against tumors by stimulating antigen-presenting cells to produce pro-inflammatory cytokines and co-stimulatory molecules. This process can disrupt tumor tolerance, leading to the activation of anti-tumor immune responses [10]. While TLRs are known to be expressed or upregulated in various tumor cell lines and malignancies, their specific expression levels and functional significance in the genetics and progression of acute leukemia remain relatively unexplored [11]. Overexpression of TLRs has been linked to increased cell survival, tumor proliferation, and metastasis in several malignancies, including lung, colon, and breast cancers [12]. Toll-like receptor 9 (TLR-9) is a human protein encoded by the TLR9 gene located on chromosome 3p21.2. Previously identified as CD289, TLR-9 belongs to the Toll-like receptor family. As an intracellular receptor expressed in immune cells such as dendritic cells, natural killer cells, macrophages, and other antigen-presenting cells, TLR-9 recognizes viral and bacterial DNA. Upon activation, TLR-9 triggers a signaling cascade that leads to the production of pro-inflammatory cytokines, ultimately contributing to tissue damage and cancer. Various factors, including tissue damage and cancer, can modulate the expression and activation of TLR-9 [13, 14].
MicroRNAs (miRNAs) are short non-coding RNA molecules that regulate gene expression post-transcriptionally [15]. These 19-25 nucleotide RNAs play crucial roles in various cellular processes, including the maintenance of hematopoietic stem cells, apoptosis, gene methylation, cell cycle regulation, progenitor cell self-renewal, and myeloid differentiation [16, 17]. Recent research has elucidated the diverse physiological roles of miRNAs, ranging from cell cycle regulation to metabolism and aging. Dysregulation of miRNAs has been implicated in various human diseases, including cancer, diabetes, and neurodegenerative disorders, growing research has revealed the critical role of the miRNome, the entire set of miRNAs in a genome, in normal hematopoiesis. Specifically, miRNAs undergo specific alterations during the activation and differentiation of hematopoietic stem cells into various lineages [18].
The B cell integration cluster (BIC) long non-coding RNA transcript harbors the MIR155HG gene within its exon region. Located on chromosome 21q21.3, MIR155HG encodes miR-155, a miRNA with a crucial role in hematopoiesis, immunology, inflammation, and cancer. While miR-155 has been implicated in the development of hematopoietic malignancies, its expression is essential for the maturation, differentiation, and normal growth of immune and hematopoietic cells. Moreover, miR-155 plays a well-defined role in the homeostatic regulation of the immune system [19, 20]. Given the crucial role of TLRs in immune responses and their involvement in the pathogenesis of various cancers, this study aimed to investigate the expression levels of TLR-9 in Iraqi patients diagnosed with AML. Additionally, the study sought to explore the role of miR-155 expression levels in these patients.
Materials and Methods
Subjects
Approximately 3 mL of whole blood was collected from forty Iraqi patients diagnosed with acute myeloid leukemia, encompassing both male and female individuals. Additionally, forty healthy individuals served as controls. The age range of the participants spanned from 15 to 83 years, including those undergoing chemotherapy (M2, M3, M4, and M5) and individuals experiencing relapse. Blood samples were collected between October 2021 and December 2021 from Al-Imamain Al-Kadhimin City Teaching Hospital and Baghdad Hospital in the Medical City, Baghdad. The study proposal is outlined in Figure 1.
Haematological parameters
A complete blood count (CBC) was performed to measure hematological parameters, including total red blood cell (RBC), white blood cell (WBC), lymphocyte, hemoglobin (HGB), hematocrit (HCT), and platelet counts. These measurements were obtained using an automated hematology analyzer manufactured by Mindray, Germany [21].
Molecular Study
RNA Extraction, Concentration, and Purity Measurement
Total RNA was extracted directly from whole blood samples using the Easy Pure® Blood RNA Kit (TransGen Biotech Company, China) with cat no.ER401, following the manufacturer’s protocol. RNA concentration and purity were assessed using a NanoDrop spectrophotometer (Thermo Fisher Scientific, USA) to ensure the quality of the RNA samples for subsequent RT-qPCR analysis. The RNA extracted from the blood samples exhibited a concentration range of 60-140 ng/μl. Purity assessments, conducted at two wavelengths and expressed as an A260/A280 ratio, yielded values around 2.0, indicating high-quality RNA suitable for subsequent RT-qPCR analysis.
Synthesis of cDNA
The cDNA synthesis was performed using the One-Step gDNA Removal and cDNA Synthesis SuperMix (EasyScript®), following the manufacturer’s protocol. The reaction mixture consisted of a reaction mix (10μl), random primers (1μl), anchored oligo dT (1μl), a genomic DNA remover (1μl), RNase-free water (3μl), E-mix reverse transcriptase (1μl), and a specified amount of total RNA (5μl),. Thermal cycling involves three stages: an initial denaturation step at 25°C for 10 minutes, a reverse transcription step at 42°C for 15 minutes, and a final enzyme inactivation step at 85°C for 5 seconds.
Primers
Primers specific to the TLR-9, GAPDH, miR-155, and U6 genes were obtained from previous studies and synthesized by Alpha DNA Company (Canada). The primers were received in lyophilized form and reconstituted with nuclease-free water to a concentration of 1 pmol. The primer sequences and their respective references are provided in Table 1.
Table 1.
Primers Used in the Current Study
| Primer | Sequence (5ʹ→3ʹ direction) | Product size(bp) | Tm (℃) | Ref. |
|---|---|---|---|---|
| TLR-9 | ||||
| Forward | CAAAGGGCTGGCTGTTGTAG | 77 | 62 | -8 |
| Reverse | CCTCTACCACGAGCACTCAT | 62 | ||
| GAPDH (Glyceraldehyde 3-phosphate dehydrogenase( | ||||
| Forward | CGGGTTCCTATAAATACGGACTG | 150 | 62 | -22 |
| Reverse | CCAATACGGGCCAAATCCGTTC | 60 | ||
| miR-155 | ||||
| Forward | GCGGTTAATGCTAATCGTGATA | -- | 59 | -23 |
| Reverse | CGAGGAAGAAGACGGAAGAAT | 59 | ||
| U6 | ||||
| Forward | AGAGAAGATTAGCATGGCCCCT | -- | 62 | -24 |
| Reverse | GCGAGCACAGAATTAATACGAC | 58 | ||
Gene Expression
Following the manufacturer’s instructions, the reaction was carried out in a final volume of 20 μl. The reaction mixture consisted of 10 μl of SYBR Green Master Mix, 3 μl of cDNA, 1 μl of forward primer, 1 μl of reverse primer, and 5 μl of nuclease-free water. The thermal cycling conditions for gene expression are outlined in Table 2.
Table 2.
Stages and Temperature of Teal-time qPCR for GAPDH and TLR-9 Genes
| Stages | Temperature ℃ | Time /Sec. | Cycle | |
|---|---|---|---|---|
| First stage | Denaturation | 94 | 60 | 1 |
| Second stage | Denaturation | 94 | 5 | |
| Annealing * | 58 | 15 | 40 | |
| Extension | 72 | 20 | ||
| Third stage | Dissociation | 65-95 | 1 |
*Annealing temperature for TLR-9, GAPDH, miR-155 an U6 were 58℃
Statistical analysis
Mean and standard deviation values for both TLR-9, GAPDH, miR-155, and U6 genes were calculated using Excel 2010. The relative expression levels of the TLR-9 and miR-155 genes were determined using the 2-ΔΔCt method [25]. Hematological parameters were analyzed using Statistical Package for the Social Sciences (SPSS) version 26 [26].
Results
Demographic Characteristics
Table 3 presents the gender distribution of the study participants. The control group comprised approximately equal numbers of males and females, with 40% being male and 60% female. In contrast, the patient group exhibited a higher proportion of males (67.5%) compared to females (32.5%). A statistically significant difference in gender distribution was observed between the two groups (p-value = 0.0084).
Table 3.
Distribution of Sample Study According to Gender in Different Groups
| Gender | Group | P-value | |
|---|---|---|---|
| Patients No. (%) |
Control No. (%) |
||
| Male | 27 (67.50%) | 16 (40.00%) | 0.0084 ** |
| Female | 13 (32.50%) | 24 (60.00%) | 0.0084 ** |
| P-value | 0.0063 ** | 0.0097 ** | --- |
Haematological Parameters
Table 4 presents a comparison of white blood cell (WBC), lymphocyte, platelet (PLT), hemoglobin (HGB), red blood cell (RBC), and hematocrit (HCT) levels between patients and healthy controls. The results indicate no significant difference in WBC and lymphocyte counts between the two groups. However, significant differences were observed in hemoglobin, platelet, RBC, and hematocrit levels, with p-values of 0.0001 for each comparison.
Table 4.
Comparison between Patients and Control According to Study Parameters
| Mean ± SE | ||||||
|---|---|---|---|---|---|---|
| Group | WBC (x 109 L) | Lympho. (x 109 mL) | Hb (g/dl) | PLT (x 109) | RBC (x 106 mL) | HCT (%) |
| Patients | 10.55 ±2.41 | 4.34 ±1.88 | 8.34 ±0.33 | 69.78 ±12.20 | 2.89 ±0.12 | 25.07 ±1.00 |
| Control | 7.49 ±0.27 | 4.04 ±1.03 | 14.57 ±0.36 | 257.97 ±11.28 | 4.92 ±0.10 | 42.47 ±0.98 |
| T-test | 4.825 N.S | 4.097 N.S | 0.973 ** | 33.077 ** | 0.316 ** | 2.799 ** |
| P-value | 0.211 | 0.885 | 0.0001 | 0.0001 | 0.0001 | 0.0001 |
TLR-9 Gene Expression
Table 5 presents the mean CT values for all groups in the study. The mean CT value for AML patients was 19.612, while the mean CT value for the control group was 19.695. The housekeeping gene, GAPDH, exhibited mean CT values of 19.895 and 19.402 for AML patients and healthy controls, respectively. The ΔCt values for the patient and control groups were -0.283 and 0.293, respectively. The calculated fold change for TLR-9 gene expression was 1.49, indicating no significant upregulation of gene expression in AML patients compared to the control group in the Iraqi population. Table 6 presents the fold change in TLR-9 gene expression, calculated using the ΔΔCt method. Both the patient and control groups exhibited the ∆∆ct calibrator of 0.051. Figure 2 visually depicts the results of TLR-9 gene expression.
Table 5.
Fold of TLR-9 Gene Expression Depending on 2-ΔCtMethod
| Study groups | Means Ct of | Means Ct of | ΔCt | 2-ΔCt | Experimental group/ Control group | Gene expression fold |
|---|---|---|---|---|---|---|
| TRL-9 gene | GAPDH | |||||
| Patient | 19.612 | 19.895 | -0.283 | 1.217 | 1.217/0.816 | 1.49 |
| Control | 19.695 | 19.402 | 0.293 | 0.816 | 0.816/0.816 | 1 |
Table 6.
Fold Expression of TLR-9 Gene According to ∆∆ct Calibrator Method
| Group | Means Ct of | Means Ct of | ∆ct | ∆ct calibrator | ∆∆ct | 2-∆∆ct | fold |
|---|---|---|---|---|---|---|---|
| TRL-9 gene | GAPDH | ||||||
| Patients | 19.612 | 19.895 | -0.283 | 0.051 | -0.334 | 1.26 | 1.49 |
| control | 19.695 | 19.402 | 0.293 | 0.051 | 0.242 | 0.846 | 1 |
miR-155 Gene Expression
Table 7 presents the mean CT values for miR-155 in different groups. The mean CT value for AML patients was 24.503, while the mean CT value for the control group was 23.842. The housekeeping gene, U6, exhibited mean CT values of 17.323 and 17.38 for AML patients and healthy controls, respectively. The ΔCt values for the patient and control groups were 7.180 and 6.462, respectively. The calculated fold change for miR-155 gene expression was 0.608, indicating a significant downregulation of gene expression in AML patients compared to the control group in the Iraqi population.
Table 7.
Fold of miR-155 Gene Expression Depending on 2-ΔCtMethod
| Groups | Means Ct of | Means Ct of | ΔCt | 2-ΔCt | experimental group/ Control group | The fold of gene expression | |
|---|---|---|---|---|---|---|---|
| miR-155 gene | U6 | ||||||
| Patient | 24.503 | 17.323 | 7.18 | 0.007 | 0.007/0.011 | 0.608 | |
| Control | 23.842 | 17.38 | 6.462 | 0.011 | 0.011/0.011 | 1 | |
Table 8 presents the fold change in miR-155 gene expression, calculated using the ΔΔCt method. Both the patient and control groups exhibited a ∆∆ct calibrator value of 6.949. Figure 3 visually depicts the results of miR-155 gene expression.
Table 8.
Fold of miR-155 Gene Expression Depending on ∆ct Calibrator Method
| Group | Means Ct of | Means Ct of | ∆ct | ∆ct calibrator | ∆∆ct | 2-∆∆ct | fold |
|---|---|---|---|---|---|---|---|
| miRNA155 gene | U6 | ||||||
| Patients | 24.503 | 17.323 | 7.18 | 6.949 | 0.231 | 0.852 | 0.608 |
| control | 23.842 | 17.38 | 6.462 | 6.949 | -0.487 | 1.402 | 1 |
Discussion
Host immunological responses, including the promotion of leukocyte proliferation within the bone marrow and lymphocyte expansion in peripheral tissues, are indispensable for effective defense against pathogens [27]. The regulation of cell proliferation and apoptosis is crucial for preventing cancer, as uncontrolled cell proliferation can lead to carcinogenesis, influenced by numerous endogenous and exogenous factors that govern cell survival and proliferation [28, 29]. The current study found that men are more susceptible to the disease than women. This disparity may be attributed to higher smoking rates among men and the potential influence of mutations in the tumor suppressor gene TP53, which are more prevalent in men. These findings align with previous research by Alwan et al. [30] and Ries et al. [31], which also demonstrated a higher susceptibility to AML among men. While previous studies have indicated a slight gender disparity in the prevalence of AML, the current study’s findings suggest a more pronounced difference, with a significantly higher proportion of male patients compared to female patients [32, 33].
Hemoglobin levels exhibited significant differences between the patient and control groups, with anemia observed across all patient subtypes without significant variations. In contrast, the control group demonstrated normal hemoglobin levels. These findings align with Al-Husseiny’s 2008 study, which reported anemia in all patients without significant differences [34]. The current study’s results further support Ahmed’s 2019 study, which reported significant differences (P < 0.001) in hemoglobin and platelet levels between AML patients and controls. However, the current study’s findings contradict Ahmed’s 2019 study regarding WBC counts, as no significant differences were observed in the current study [35]. According to the current study results, which support Haider’s finding of a mean RBC value of 2.78 ± 0.82 for patients, the mean and standard error of the RBC parameter was 2.89 ± 0.12 for patients and 4.92 ± 0.10 for healthy controls, respectively [36].
The current study evaluated TLR-9 mRNA expression in AML patients and found no upregulation, aligning with the theory that cancer cells may downregulate TLR-9 to evade immune surveillance. This downregulation could potentially serve as a target for novel therapeutic approaches. While TLRs are often upregulated in various cancers and tumor cell lines, such as TLR-4 and TLR-5 in gastric cancer and TLR-4 and TLR-9 in lung and breast cancer, the specific role of TLR-9 in AML warrants further investigation [28). A study by Morsi et al. demonstrated that TLR-9 and TLR-7 may be expressed in acute leukemia cells (lymphoblastic and myeloid). However, only TLR-7 exhibited a significant increase in expression compared to controls, suggesting that TLR-7 may play a crucial role in the immune evasion of acute leukemias (AML and ALL). In contrast, the mRNA expression of TLR-7 and TLR-9 was significantly lower in chronic myeloid leukemia (CML) patients compared to normal controls [37].
Numerous studies have focused on the relationship between the TLR signaling pathway and its downstream target genes as potential biomarkers for colon and rectal cancer. However, the underlying mechanisms remain unclear due to the differential activation of the TLR signaling pathway in cancer tissues compared to healthy cells [38, 39]. Previous studies, such as that by González-Reyes et al. [40] have demonstrated decreased TLR-9 expression levels in cancer. In a study of 133 prostate cancer patients, high TLR9 expression was associated with abnormal cytokine levels and impaired cell cycle-induced apoptosis in cancer cells [40]. Furthermore, a study by Elmaagacli et al. reported that TLR-9 may influence the outcome of AML patients who undergo hematopoietic stem cell transplantation from HLA-identical siblings [41].
It is now widely recognized that miRNAs can significantly impact a broad spectrum of leukemic activities, including chemotherapy resistance in various AML subtypes, as well as processes such as proliferation, survival, differentiation, self-renewal, and epigenetic control. miRNA expression profiles may provide valuable prognostic information [42]. While leukemia-associated genomic modifications are rich in miRNA sequences, only about 100 of these are expressed above background levels, suggesting that a limited subset of miRNAs plays a role in AML [43]. This study represents the first investigation in Iraq to demonstrate downregulation of miR-155 expression in AML patients compared to controls. This finding suggests that miR-155 may contribute to the pathogenesis of AML by enabling cancer cells to evade the immune system. As such, miR-155 could potentially serve as a biomarker for the diagnosis and treatment of the disease. These findings are consistent with previous research, such as that conducted by Wang et al., which also reported decreased miR-155 expression in AML patients compared to healthy controls [44]. According to a study by Abdelhalim et al., the downregulation of miR-150 in AML patients is essential for leukemogenesis [45].
According to Tang et al., overexpression of miR-29c may enhance the sensitivity of both non-resistant and resistant leukemic cells to the drug decitabine. Furthermore, the downregulation of miR-29c may serve as an independent prognostic biomarker in AML patients [46]. The miRNAs are known to be dysregulated during oncogenesis. Overexpression of miR-155 has been associated with several cancers, including hematological malignancies. This suggests that miR-155 may play an oncogenic role [20]. Malignancies are characterized by aberrant miRNA expression patterns and functional abnormalities. These expression patterns are often associated with the type, stage, and other clinical factors of the disease. Consequently, the discovery of miRNAs holds significant potential for the development of novel diagnostic biomarkers and therapeutic targets for cancer treatment [47].
In conclusion, exploring the intricate association between TLR-9 and miR-155 offers a promising avenue for elucidating the molecular mechanisms underlying AML development. This knowledge could pave the way for the development of innovative therapeutic strategies and refined diagnostic approaches. The TLR-9 gene expression is implicated in the inflammatory process, as it induces dysregulated cytokine and miRNA levels. Notably, TLR-9 expression may constitute a component of the immune evasion strategy employed by malignant cells, playing a critical role in leukemogenesis and disease progression. While miR-155 is well-recognized for its tumor-suppressive functions, it also exerts regulatory influence over a wide range of mRNA targets. This multifaceted regulation is essential for safeguarding against cellular transformation. Importantly, the downregulation of miR-155 is a key event in the pathogenesis of leukemia. The expression pattern of miR-155 is correlated with clinical disease variables and exhibits aberrant expression and functional abnormalities in AML. Consequently, miR-155 emerges as a potential therapeutic target for the eradication of leukemic progenitors in conjunction with chemotherapy.
Figure 1.
The Study Proposal of the Current Study
Figure 2.
TLR-9 Gene Expression Results (a) TLR-9 amplification plots using Real-time qPCR. (b) The TLR-9 dissociation gene curves by qPCR, The melting temperature ranged from 76°C to 77°C, and No primer dimer could be seen. The photograph was taken directly from the machine of Qiagen Rotorgene qPCR.
Figure 3.
The miR-155 Gene Expression Results. (a) miR-155 gene amplification plots by qPCR. (b) The miR-155 gene dissociation curves by qPCR, melting temperature ranged from 76°C to 77°C, No primer dimer could be seen.
Author Contribution Statement
All researchers contributed equally to all stages of the research, from study design to the final manuscript.
Acknowledgements
We would like to express our sincere thanks to the Department of Biology, College of Science, and the Iraqi Center for Cancer and Medical Genetics Research at Mustansiriyah University (www.uomustansiriyha.edu.iq).
Ethical Approval
This study was ethically approved by the Ministry of Health in Iraq (approval number 38035, issued on October 26, 2021) and by the Scientific Committee of Mustansiriyah University.
Conflicts of Interest
The authors declare no competing financial interests or personal relationships that could have influenced the research reported in this paper.
References
- 1.Tultul FN. Identification of childhood leukemia using deep learning (Doctoral dissertation, BRAC University) 2017. [Google Scholar]
- 2.Ali S, Tanveer A, Hussain A, Rehman SU. Identification of cancer disease using image processing approahes. Int J Intell Inf Syst. 2020;9(2):6–15. [Google Scholar]
- 3.Aref S, Abd Elmaksoud ALS, Abd Elaziz S, Mabed M, Ayed M. Clinical implication of Toll-like receptors (TLR2 and TLR4) in acute myeloid leukemia patients. Asian Pac J Cancer Prev. 2020;21(11):3177. doi: 10.31557/APJCP.2020.21.11.3177. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Bispo JAB, Pinheiro PS, Kobetz EK. Epidemiology and etiology of leukemia and lymphoma. Cold Spring Harb Perspect Med. 2020;10(6):a034819. doi: 10.1101/cshperspect.a034819. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Iraqi Cancer Board. Baghdad, Iraq; 2018. [Google Scholar]
- 6.Short NJ, Rytting ME, Cortes JE. Acute myeloid leukaemia. Lancet (London, England) 2018;392(10147):593–606. doi: 10.1016/S0140-6736(18)31041-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.De Kouchkovsky I, Abdul-Hay M. Acute myeloid leukemia: a comprehensive review and 2016 update. Blood Cancer J. 2016;6(7):e441. doi: 10.1038/bcj.2016.50. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Qasim Mohammed M, Hussein Alwan A, Amer Almukhtar A, Kareem Aneed Al-Saedi M. Revealing of TLR-9 gene polymorphisms by qPCR HRM technique and their influence on TLR-9 serum level in acute myeloid leukemia patients: Case-control study. Cytokine. 2024;182:156730. doi: 10.1016/j.cyto.2024.156730. [DOI] [PubMed] [Google Scholar]
- 9.Semlali A, Alnemari R, Almalki E, Alrashed R, Alanazi M. Toll-like receptors gene polymorphism and susceptibility to cancer development. Genet Divers Dis Susceptibility. 2018;57:57 –72. [Google Scholar]
- 10.Jinushi M, Baghdadi M. Role of Innate Immunity in Cancers and Antitumor Response. InCancer Immunology: A Translational Medicine Context . Berlin, Heidelberg: Springer Berlin Heidelberg; 2014. pp. 29–46. [Google Scholar]
- 11.Fabricius D, Breckerbohm L, Vollmer A, Queudeville M, Eckhoff SM, Fulda S, et al. Acute lymphoblastic leukemia cells treated with CpG oligodeoxynucleotides, IL-4 and CD40 ligand facilitate enhanced anti-leukemic CTL responses. Leukemia. 2011;25(7):1111–21. doi: 10.1038/leu.2011.87. [DOI] [PubMed] [Google Scholar]
- 12.Monlish DA, Bhatt ST, Schuettpelz LG. The Role of Toll-Like Receptors in Hematopoietic Malignancies. Front Immunol. 2016;7:390. doi: 10.3389/fimmu.2016.00390. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Al-Kahiry WMA, Dammag EAM, Abdelsalam HST, Fadlallah HK, Owais MS. Toll-like receptor 9 negatively related to clinical outcome of AML patients. J Egypt Natl Canc Inst. 2020;32(1):15 . doi: 10.1186/s43046-020-00027-3. [DOI] [PubMed] [Google Scholar]
- 14.Noh JY, Yoon SR, Kim TD, Choi I, Jung H. Toll-Like Receptors in Natural Killer Cells and Their Application for Immunotherapy. J Immunol Res. 2020;2020:2045860. doi: 10.1155/2020/2045860. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Dickstein J, Senyuk V, Premanand K, Laricchia-Robbio L, Xu P, Cattaneo F, et al. Methylation and silencing of miRNA-124 by EVI1 and self-renewal exhaustion of hematopoietic stem cells in murine myelodysplastic syndrome. Proc Natl Acad Sci. 2010;107(21):9783 –8. doi: 10.1073/pnas.1004297107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Guo S, Lu J, Schlanger R, Zhang H, Wang JY, Fox MC, et al. MicroRNA miR-125a controls hematopoietic stem cell number. Proc Natl Acad Sci. 2010;107(32):14229 –34. doi: 10.1073/pnas.0913574107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Pulikkan JA, Dengler V, Peramangalam PS, Peer Zada AA, Müller-Tidow C, Bohlander SK, et al. Cell-cycle regulator E2F1 and microRNA-223 comprise an autoregulatory negative feedback loop in acute myeloid leukemia. Blood. 2010;115(9):1768 –78. doi: 10.1182/blood-2009-08-240101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Cammarata G, Augugliaro L, Salemi D, Agueli C, Rosa M La, Dagnino L, et al. Differential expression of specific microRNA and their targets in acute myeloid leukemia. Am J Hematol. 2010;85(5):331 –9. doi: 10.1002/ajh.21667. [DOI] [PubMed] [Google Scholar]
- 19.Eis PS, Tam W, Sun L, Chadburn A, Li Z, Gomez MF, et al. Accumulation of miR-155 and BIC RNA in human B cell lymphomas. Proc Natl Acad Sci. 2005;102(10):3627–32. doi: 10.1073/pnas.0500613102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Palma CA, Al Sheikha D, Lim TK, Bryant A, Vu TT, Jayaswal V, et al. MicroRNA-155 as an inducer of apoptosis and cell differentiation in Acute Myeloid Leukaemia. Mol Cancer. 2014;13(1):1–15. doi: 10.1186/1476-4598-13-79. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.George-Gay B, Parker K. Understanding the complete blood count with differential. J perianesthesia Nurs Off J Am Soc PeriAnesthesia Nurses. 2003;18(2):96–7. doi: 10.1053/jpan.2003.50013. [DOI] [PubMed] [Google Scholar]
- 22.Faeqali Jan M, Muneer Al-Khafaji H, Hasan Al-Saadi B, Aneed Al-Saedi MK. Assessment of Interleukin-8 in Bronchial Asthma in Iraq. Arch Razi Inst. 202;76(4):913–23. doi: 10.22092/ari.2021.355733.1712. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Yang LH, Wang SL, Tang LL, Liu B, Ye W, Wang LL, et al. Universal Stem-Loop Primer Method for Screening and Quantification of MicroRNA. PLoS One. 2014;9:e115293. doi: 10.1371/journal.pone.0115293. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Ghareeb ZA, Al-Khafaji Hma-H, Al-Saedi MKA. Low-density lipoprotein receptor-related protein-1 and mir-205 expression for cardiovascular disease in familial hypercholesterolemia and non-familial hypercholesterolemia in Iraqi population. Iran J Ichthyol. 2021;8:246 –54. [Google Scholar]
- 25.Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc. 2008;3(6):1101–8. doi: 10.1038/nprot.2008.73. [DOI] [PubMed] [Google Scholar]
- 26.SPSS. Statistical Package for the Social Sciences. Version 26 2019. [Google Scholar]
- 27.Soares MP, Teixeira L, Moita LF. Disease tolerance and immunity in host protection against infection. Nat Rev Immunol. 2017;17(2):83–96. doi: 10.1038/nri.2016.136. [DOI] [PubMed] [Google Scholar]
- 28.Rybka J, Butrym A, Wróbel T, Jaźwiec B, Stefanko E, Dobrzyńska O, et al. The expression of Toll-like receptors in patients with acute myeloid leukemia treated with induction chemotherapy. Leuk Res. 2015;39(3):318–22. doi: 10.1016/j.leukres.2015.01.002. [DOI] [PubMed] [Google Scholar]
- 29.Patergnani S, Danese A, Bouhamida E, Aguiari G, Previati M, Pinton P, et al. Various Aspects of Calcium Signaling in the Regulation of Apoptosis, Autophagy, Cell Proliferation, and Cancer. Int J Mol Sci. 2020;21(21):8323. doi: 10.3390/ijms21218323. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Alwan AF, Zedan ZJ, Salman OS. Acute myeloid leukemia: clinical features and follow-up of 115 Iraqi patients admitted to Baghdad Teaching Hospital. Tikrit Med J. 2009;15(1):1–8. [Google Scholar]
- 31.Gloeckler Ries LA, Reichman ME, Lewis DR, Hankey BF, Edwards BK. Cancer survival and incidence from the Surveillance, Epidemiology, and End Results (SEER) program. Oncologist. 2003;8(6):541–52. doi: 10.1634/theoncologist.8-6-541. [DOI] [PubMed] [Google Scholar]
- 32.Pouls RK, Shamoon RP, Muhammed NS. Clinical and haematological parameters in adult AML patients: a four year experience at Nanakaly Hospital for blood diseases. Zanco J Med Sci. 2012;16(3):199–203. [Google Scholar]
- 33.Abdulateef S, Almothaffar A, Al-khafaji KR. Molecular study of FLT3-ITD mutation in Iraqi adult acute myeloid leukemia patients; Its correlation with clinicopathological parameters. Pathol Lab Med. 2017;1:79 –82. [Google Scholar]
- 34.Al-Husseiny AH. Acute myeloid leukemia in adolescent and adult Iraqi patients clinical and haematological study. Diala J. 2008;29:1. [Google Scholar]
- 35.Ahmed HA, Maklad AM, Khaled SA, Elyamany A. Interleukin-27 and interleukin-35 in de novo acute myeloid leukemia: expression and significance as biological markers. J Blood Med. 2019;10:341–9. doi: 10.2147/JBM.S221301. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Haider RZ, Ujjan IU, Khan NA, Urrechaga E, Shamsi TS. Beyond the In-Practice CBC: The Research CBC Parameters-Driven Machine Learning Predictive Modeling for Early Differentiation among Leukemias. Diagnostics (Basel, Switzerland) 2022;12(1):138. doi: 10.3390/diagnostics12010138. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Morsi MG, El Gharabawy MM, Hamed NA, El Sawy MM, Abou Seada NM, Hashad RA. Quantitative expression of toll-like receptors TLR-7 and TLR-9 on peripheral blood mononuclear cells in leukemias. J Hematol. 2016;5(1):17–24. [Google Scholar]
- 38.Lu CC, Kuo HC, Wang FS, Jou MH, Lee KC, Chuang JH. Upregulation of TLRs and IL-6 as a marker in human colorectal cancer. Int J Mol Sci. 2014;16(1):159–77. doi: 10.3390/ijms16010159. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Vidya MK, Kumar VG, Sejian V, Bagath M, Krishnan G, Bhatta R. Toll-like receptors: Significance, ligands, signaling pathways, and functions in mammals. Int Rev Immunol. 2018;37(1):20–36. doi: 10.1080/08830185.2017.1380200. [DOI] [PubMed] [Google Scholar]
- 40.González-Reyes S, Fernández JM, González LO, Aguirre A, Suárez A, González JM, et al. Study of TLR3, TLR4, and TLR9 in prostate carcinomas and their association with biochemical recurrence. Cancer Immunol Immunother. 2011;60(2):217–26. doi: 10.1007/s00262-010-0931-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Elmaagacli AH, Steckel N, Ditschkowski M, Hegerfeldt Y, Ottinger H, Trenschel R, et al. Toll-like receptor 9, NOD2 and IL23R gene polymorphisms influenced outcome in AML patients transplanted from HLA-identical sibling donors. Bone Marrow Transplant. 2011;46(5):702–8. doi: 10.1038/bmt.2010.166. [DOI] [PubMed] [Google Scholar]
- 42.Wallace JA, O’Connell RM. MicroRNAs and acute myeloid leukemia: therapeutic implications and emerging concepts. Blood. 2017;130(11):1290–301. doi: 10.1182/blood-2016-10-697698. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Handschuh L. Not only mutations matter: molecular picture of acute myeloid leukemia emerging from transcriptome studies. J Oncol. 2019;2019:7239206. doi: 10.1155/2019/7239206. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Wang XS, Gong JN, Yu J, Wang F, Zhang XH, Yin XL, et al. MicroRNA-29a and microRNA-142-3p are regulators of myeloid differentiation and acute myeloid leukemia. Blood. 2012;119(21):4992–5004. doi: 10.1182/blood-2011-10-385716. [DOI] [PubMed] [Google Scholar]
- 45.Abdelhalim DA, Elgamal BM, ElKafoury MR, Hassan NM, Hussein MM, Elhefnawi MM, et al. MicroRNA-150 down regulation in acute myeloid leukaemia patients and its prognostic implication. Open access Maced J Med Sci. 2018;6(11):1993. doi: 10.3889/oamjms.2018.420. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Tang L, Sun G, Zhang T, Wu D, Zhou J, Ma B, et al. Down-regulation of miR-29c is a prognostic biomarker in acute myeloid leukemia and can reduce the sensitivity of leukemic cells to decitabine. Cancer Cell Int. 2019;19:177. doi: 10.1186/s12935-019-0894-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Tao Y, Ai R, Hao Y, Jiang L, Dan H, Ji N, et al. Role of miR-155 in immune regulation and its relevance in oral lichen planus. Exp Ther Med. 2019;17(1):575–86. doi: 10.3892/etm.2018.7019. [DOI] [PMC free article] [PubMed] [Google Scholar]



