Skip to main content
Clinical and Applied Thrombosis/Hemostasis logoLink to Clinical and Applied Thrombosis/Hemostasis
. 2025 Jul 22;31:10760296251362723. doi: 10.1177/10760296251362723

Selected PEAR1 and MRVI1 Gene Polymorphisms in Patients with Migraine and Sticky Platelet Syndrome

Tomas Simurda 1, Kristina Maria Belakova 1,, Jan Stasko 1, Maria Skerenova 2, Jela Ivankova 1, Miroslava Drotarova 1, Monika Brunclikova 1, Lucia Stanciakova 1, Ingrid Skornova 1, Juraj Sokol 1
PMCID: PMC12290346  PMID: 40696876

Abstract

One of the most common clinical manifestations of inherited platelet hyperaggregability also known as sticky platelet syndrome (SPS) is migraine. The aim of this study was to assess the role of single nucleotide polymorphisms (SNPs) of platelet endothelial aggregation receptor 1 (PEAR1) and murine retrovirus integration site 1 (MRVI1) genes in pathogenesis of SPS associated with migraine. Hundred patients with SPS and migraine as well as two hundred and seven patients with SPS and without migraine as a control group were enrolled. SPS was diagnosed by light transmission aggregometry (LTA) according to the method and criteria described by Mammen and Bick. Two SNPs within PEAR1 gene (rs12041331 and rs12566888) and two SNPs within MRVI1 gene (rs7940646 and rs1874445) were assessed using High resolution melting (HRM) analysis. Minor allele frequencies for both SNPs within PEAR1 and MRVI1 in patients with SPS and history of migraine as well as haplotypes did not significantly differ compared to the SPS control group. The study also suggests SPS as a complex interaction of several genes resulting in possible polygenic phenotype of migraine in SPS patients.

Keywords: sticky platelet syndrome, migraine, PEAR1, MRVI1, single nucleotide polymorphisms, haplotypes

Introduction

Sticky platelet syndrome (SPS) is a prothrombotic thrombocytopathy with multifactorial etiology and a common familial occurrence. 1 It was first described by Holiday et al at the Ninth Conference on Stroke and Cerebral Circulation in Arizona in 1983 in a group of young people suffering from ischemic stroke, including migraine.2,3 SPS is defined by an increased platelet aggregability in response to low concentration of inducers (agonists) of platelet aggregation – adenosine diphosphate (ADP) and/or epinephrine (EPI). Based on the laboratory findings it is classified as type I (hyperaggregability after both ADP and EPI), type II (hyperaggregability after EPI alone), and type III (hyperaggregability after ADP alone). 4

The most common clinical manifestation is arterial thrombosis. Other common manifestations are venous thrombosis, migraine, pregnancy complications related to impaired placental vascularization, such as intrauterine growth restriction and recurrent fetal loss or graft loss after renal transplantation which can lead to life-threatening complications.4,5 The first arterial or venous thrombotic episode often occures in younger patients, during the third and fourth decade of life, sometimes in adolescents and children as well. Affected individuals are usually without or have only mild acquired risk factors for thrombosis. Not all patients are carriers of the clinical symptoms, considering a possible autosomal dominant mode of inheritance.1,6,7 Pharmacological treatment and prevention is based on regular long-term receiving of antiplatelet therapy, usually acetylsalicylic acid, which effectively reduces platelet hyperaggregation. 5

The etiology of SPS is still uncertain and the exact cause of SPS have not been found yet, but from the limited epidemiological data available and from familial/case reports it is expected that defect in platelet membrane glycoproteins and/or intracellular signaling pathways involved in platelet activation and aggregation can be considered as strong causal factors.46,8 Different genetic studies proved a connection between SPS and single nucleotide polymorphisms (SNPs) of glycoprotein 6 (GP6) gene, growth arrest specific protein 6 (GAS6) gene, platelet endothelial aggregation receptor 1 (PEAR1) gene and murine retrovirus integration site 1 (MRVI1) gene.1,911

PEAR1 is a platelet transmembrane protein of the epidermal growth factor–like domain protein group, which is a receptor for platelet-platelet contact. 8 It becomes tyrosine-phosphorylated during platelet aggregation and signal induces through contacts between platelets independent of platelet activation. Genetic variants in PEAR1 gene which encodes PEAR1 protein are associated with increased platelet aggregation and reduced responsiveness to acetylsalicylic acid. 12

MRVI1 is a retrovirus integration site 1 homolog, which inhibites both ADP- and EPI-induced platelet aggregation. MRVI1 gene SNPs might cause the loss of its role in platelet inhibition, however their relation to SPS pathogenesis is not sufficiently explained.13,14

Material and Methods

Study Population and Inclusion/Exclusion Criteria

The study was approved by the local ethical committee. All patients agreed to participate in this study and signed a written informed consent or in case of a person was less than 18 years old an informed consent was signed by their parents or guardians. Patients were referred to the hematology laboratory in order to undergo platelet hyperaggregability screening as a part of the differential diagnosis of migraine. Initially, they were examined and tested at the National Centre of Haemostasis and Thrombosis in Martin University Hospital.

Inclusion criteria were migraine verified by neurological examination and platelet hyperaggregability in response to low concentration of EPI and/or ADP during the light transmission aggregometry (LTA) established by Mammen and Bick,15,16 documented at least two times. Patients with hyperaggregability in response to only 1 low concentration of EPI or ADP and patients with insufficiently documented diagnosis of migraine were not included to the study. Patients did not receive antiplatelet therapy (discontinuation of acetylsalicylic acid or ADP inhibitors before testing for at least 7 days), they were omitting the use of other drugs which affects platelet activity such as non-steroidal anti-inflammatory drugs and did not suffer from acute migraine attack through the examination. All blood samples were taken outside the menstrual period or other active bleeding, white blood cell count was in normal range (normal range 4-10 × 109/L) and possible inflammatory process was excluded by measuring C-reactive protein level (normal value < 5.0 mg/L).

A control group were patients with verified SPS and with negative personal history of migraine. The family and personal history of migraine, clinical characteristics and medication were assesed during interview by a hematologist.

Diagnostics of SPS

Platelet hyperaggregability is laboratory diagnosed by LTA. Testing of SPS used the antecubital venous blood collected intovials prefilled with 3.2% buffered natrium citrate (anticoagulant–blood ratio 1:9). The blood samples were processed and analyzed within 2 h after sampling. Platelet aggregability was tested with platelet-rich plasma, assesed photometrically by the platelet aggregometer (AggRAM, Helena Laboratories, Beaumont, TX, USA). Each blood sample was tested with 3 low concentrations of ADP (2.34, 1.17, and 0.58 mmol/L) and EPI (11.0, 1.1, and 0.55 mmol/L).The criteria established by Mammen and Bick15,16 were used for the classification of SPS into type I, II and III. Testing of platelet aggregation was performed 2 times to confirm the diagnosis.

DNA Analysis

Antecubital venous blood used for DNA analysis was collected into tubes containing 5.4 mg K2EDTA (spray-coated). Blood samples were processed within 2 h after collection and stored at – 20 °C. DNA was extracted from peripheral blood leukocytes. Isolation of genomic DNA from whole blood was performed with MagNA Pure LC DNA Isolation Kit I (Roche Diagnostics, Mannheim, Germany) on MagNA Pure LC 2.0 Instrument (Roche Diagnostics, Mannheim, Germany) according to the instructions. 17 SNP genotyping used High resolution melting (HRM) analysis on LightCycler 480 II (Roche Diagnostics, Mannheim, Germany). The selection and designing of primer sequences were performed by Primer3 software. 18

Gene Analysis

We selected representative SNPs within suspected genes for platelet hyperaggregability: 2 SNPs within PEAR1 gene (rs12041331 and rs12566888), as well as 2 SNPs within MRVI1 gene (rs7940646 and rs1874445). 11 The basic characteristics of analyzed SNPs including nucleotide sequence is given in Table 1. High-resolution melting analysis (HRMA) was carried out on a LightCycler® 480 instrument using the High Resolution Melting Master Mix (Hoffmann-La Roche Ltd, Basel, Switzerland), following the manufacturer's protocol. Each 15 µL reaction contained 7.5 µL of 2× HRM Master Mix, 3 mMMgCl₂ (final concentration), 0.25 µM of each forward and reverse primer, and 15 ng of genomic DNA. The thermal cycling conditions included an annealing temperature of 58 °C and a total of 40 cycles.

Table 1.

Characteristics of Analyzed SNPs.

Gene Chromosome SNP (Intronic) Major/Minor Allele Amplicon Lenght (bp) Primer Sequences (5′→ 3’)
PEAR1 1 rs12041331 G/A 68 F: TCCCTTCTGCTGTCTCACTTC
R: TGGACAAGAGGATCCATTTCTAT
PEAR1 1 rs12566888 G/T 59 F: GGACTAGAAGCTTTGTACTCCAG
R: TTCTCCATCTCCCTCTCTCTC
MRVI1 11 rs7940646 C/T 81 F: GAGCCTCTTTGTACCCTCAG
R: AGCCACAGTAGGAAGCTGAC
MRVI1 11 rs1874445 C/T 49 F: CCCTTAGTCCAACAGAGAACA
R: TTCTAAAATGCAAAATCTCACTCA

Abbreviations: A, adenine; C, cytosine; G, guanine; MRVI1, murine retrovirus integration site 1; PEAR1, platelet endothelial aggregation receptor 1; SNP, single nucleotide polymorphism; T, thymine - [ref/alt] allele in GRCh38.p14.

Statistics

The haplotype association analysis was performed with PLINK software (https://zzz.bwh.harvard.edu/plink/).1921 Fisher's exact test was used to estimate a significance of deviation from Hardy–Weinberg equilibrium and to execute basic allelic association and genotypic association. A haplotype frequency estimation used the expectation–maximization algorithm. Statistically significant P value was considered lower than .05. Risk was assesed by Odds ratios (ORs) with 95% confidence intervals (95% CIs).

Results

A total of 100 patients, 34 men and 66 women with the mean age of 20.9 + 9.9 years were included in the study. In the patient group 59 had SPS type I, 41 type II, and no one had SPS type III. SPS control group had 207 patients with SPS and without migraine, 75 men and 132 women with the mean age of 30.5 + 10.1 years.

We examined 4 SNPs recognized in intronic regions of PEAR1 and MRVI1 genes (rs12041331, rs12566888, rs7940646, and rs1874445). The P-values for the Hardy-Weinberg equilibrium (HWE) tests of all SNPs were above 0.1, indicating ‘little or no evidence’ against equilibrium. Minor allele frequencies of both SNPs within PEAR1 and MRVI1 genes in patients with SPS and history of migraine were not significantly different compared to the individuals with SPS and without migraine (rs12041331A: 0.085 vs 0.085, OR: 1.006, 95% CI: 0.549-1.843; rs12566888T: 0.090 vs 0.085, OR: 1.071, 95% CI: 0.591-1.942; rs7940646T: 0.335 vs 0.336, OR: 0.997, 95% CI: 0.697-1.425; rs1874445T: 0.410 vs 0.406, OR: 1.018, 95% CI: 0.722-1.434). Summary of frequency of minor alleles in patients with SPS and migraine compared to SPS controls is given in Table 2.

Table 2.

Summary of Frequency of Minor Alleles in Patients with SPS and Migraine Compared to SPS Control Group.

Gene SNP Minor Allele Frequency (SPS) Frequency (Control) Fishers Exact P, Allelic Association OR Minor Allele Cl (95%)
PEAR1 rs12041331A 0.085 0.085 1.000 1.006 0.549-1.843
PEAR1 rs12566888T 0.090 0.085 0.878 0.071 0.591-1.942
MRVI1 rs7940646T 0.335 0.336 1.000 0.997 0.697-1.425
MRVI1 rs1874445T 0.410 0.406 0.930 1.018 0.722-1.434

Abbreviations: CI, confidence interval; MRVI1, murine retrovirus integration site 1; OR, odds ratio; PEAR1, platelet endothelial aggregation receptor 1; SNP, single nucleotide polymorphisms; SPS, sticky platelet syndrome.

We did not found any interesting or significant results of minor alleles in patients with SPS and migraine. Haplotype analysis of PEAR1 and MRVI1 in SPS patients with migraine compared to SPS controls was also without the significant results as shown in Table 3.

Table 3.

Haplotype Analysis of PEAR1 and MRVI1 in Patients with SPS and Migraine Compared to SPS Control Group.

Gene Haplotype Frequency (SPS) Frequency (Control) P Value Chi-Squared χ2 Odds Ratio
PEAR1 GG 0.915 0.922 .767 0.088 1.020
PEAR1 TA 0.085 0.078 .767 0.088 1.100
MRVI1 CC 0.586 0.591 .899 0.016 0.973
MRVI1 TT 0.328 0.331 .949 0.004 0.984
MRVI1 TC 0.086 0.078 .734 0.116 1.100

Abbreviations: A, adenine; C, cytosine; G, guanine; MRVI1, murine retrovirus integration site 1; PEAR1, platelet endothelial aggregation receptor 1; SPS, sticky platelet syndrome; T, thymine.

Discussion

Migraine is a common chronic neurological disease affecting around 14% of adults in Europe, more frequently women and the common age group is 18–50 years-old. Its clinical manifestation can be very variable, in terms of symptoms, frequency and intensity of headaches, and in terms of impact. 22 Hyperaggregability of platelets in migraine attack is a well-known phenomenon, and the involvement of an altered platelet reactivity in migraine seems to be supported by an increased platelet responsiveness to 5-hydroxytryptamine (5-HT, ie serotonin) and also to biologically active agents such as adenosine diphosphate (ADP), prostaglandins and catecholamines. In addition plasma of migraineurs increases levels of ß-thromboglobulin and platelet factor 4 (PF-4).2327 A longer duration of migraine attacks may result in greater thrombocyte microaggregation and, consequently, a lower level of platelets. However, there is no evidence of correlation between platelet hyperaggregability and either the severity of migraine or the occurrence of migraine-associated neurologic symptoms. 22 Migraine is considered polygenic, due to multiple genetic variants each having a minor effect accumulating to lead to the disease. 23

In our study, we focused on variability of the two genes (MRVI1, PEAR1) and we examined the association between selected SNPs and the risk for migraine in patients with SPS. According to our knowledge their influence on etiology of SPS manifested as migraine has not been studied and published so far. The main goal of our study was to analyse the contribution of selected SNPs to the pathogenesis of migraine complications in patients with platelet hyperaggregability, often in younger age and children as well.

We did not find significantly different minor allele frequencies for both SNPs within PEAR1 and MRVI1 in patients with SPS and history of migraine compared to the SPS control group of patients without migraine. There was no association of these two genes with increased risk of migraine in patients with SPS in our study.

Unlike us, Sokol et al studied PEAR1 gene and MRVI1 gene SNPs in patients with SPS and history of fetal loss and reported a significantly increased occurrence of two identical SNPs within PEAR1 as used also in our study (rs12041331 and rs12566888) compared to healthy population. 12

Various clinical studies observed the combined influence of SNPs on platelet aggregation and platelet membrane glycoproteins. Interaction of several genetic polymorphisms can contribute to the heterogenity of phenotype in SPS patients.

There were several limitations in our study. Firstly, the number of patients with migraine and diversity was limited, secondly the migraine itself, since the symptomatic classification might cover different pathomechanisms, thirdly interpretation of platelet hyperaggregability, which should be standardized during platelet studies. Platelet aggregability is greatly affected by preanalytical issues, and therefore, is potentially accordingly adversely influenced. In addition this study was retrospective and assesed patients with migraine who already received antiplatelet therapy, which could have influenced the results.

Conclusion

The study suggests that there is no association of minor allele frequencies for both SNPs within PEAR1 (rs12041331 and rs12566888) and MRVI1 (rs7940646 and rs1874445) neither association of haplotypes in patients with SPS and history of migraine. According to different studies SPS phenotype is based on additional genetic defect of various alleles. Therefore, we assume that the SPS is a complex interaction of several genetic modifications and multiple alleles may contribute to the clinical manifestation resulting in possible polygenic phenotype of migraine in SPS patients. These results should be confirmed by further independent research.

Acknowledgements

The work was supported by Vega 1/0059/25 and Vega 1/0250/22 projects.

ORCID iD: Tomas Simurda https://orcid.org/0009-0006-9057-3727

Kristina Maria Belakova https://orcid.org/0009-0008-8795-5032

Ethical Considerations: The study was approved by the local ethical committee (approval no. EK3/2023) on March 30, 2023. All participants provided written informed consent prior to participating.

Funding: The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: The authors reported there is no funding associated with the work featured in this article.

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Data Availability Statement: The data that support the findings of this study are available.

References

  • 1.Sokol J, Skerenova M, Jedinakova Z, et al. Progress in the understanding of sticky platelet syndrome. Semin Thromb Hemost. 2017;43(1):8-13. [DOI] [PubMed] [Google Scholar]
  • 2.Stasko J, Holly P, Kubisz P. A new decade awaits sticky platelet syndrome: Where are we now, how do we manage and what are the complications? Expert Rev Hematol. 2022;15(1):53-63. [DOI] [PubMed] [Google Scholar]
  • 3.Kessler P, Peliskova L, Prokopova J. Sticky platelet syndrome—diagnostic issues and controversies. Ann Blood. 2024;9(10):1-7. [Google Scholar]
  • 4.Favaloro EJ, Pasalic L, Fan BE, et al. Sticky platelet syndrome revisited? Semin Thromb Hemost. 2025;51(3):358-361. [DOI] [PubMed] [Google Scholar]
  • 5.Kubisz P, Holly P, Stasko J. Sticky platelet syndrome: 35 years of growing evidence. Semin Thromb Hemost. 2019;45(1):61-68. [DOI] [PubMed] [Google Scholar]
  • 6.Santimone I, Gemmati D. Sticky platelet syndrome and the role of glycoprotein receptors: A review of literature. J Blood Disorders Transf. 2013;4(6):000173. [Google Scholar]
  • 7.Tegkündüz E, Demir M, Erikci AA, et al. Sticky platelet syndrome in patients with uninduced venous thrombosis. Turk J Haematol. 2013;30(1):48-52. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Stanciakova L, Skerenova M, Holly P, et al. Genetic origin of the sticky platelet syndrome. Rev Hematol Mex. 2016;17(2):139-143. [DOI] [PubMed] [Google Scholar]
  • 9.Skerenova M, Sokol J, Biringer K, et al. GP6 Haplotype of missense variants is associated with sticky platelet syndrome manifested by fetal loss. Clin Appl Thromb Hemost. 2018;24(1):63-69. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Kubisz P, Ivanková J, Škereňová M, et al. The prevalence of the platelet glycoprotein VI polymorphisms in patients with sticky platelet syndrome and ischemic stroke. Hematology. 2012;17(6):355-362. [DOI] [PubMed] [Google Scholar]
  • 11.Johnson AD, Yanek LR, Chen M-H, et al. Genome-wide meta-analyses identifies seven loci associated with platelet aggregation in response to agonists. Nat Genet. 2010;42(7):608-613. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Sokol J, Biringer K, Skerenova M, et al. Different models of inheritance in selected genes in patients with sticky platelet syndrome and fetal loss. Semin Thromb Hemost. 2015;41(3):330-335. [DOI] [PubMed] [Google Scholar]
  • 13.Sokol J, Skerenova M, Ivankova J, et al. Association of genetic variability in selected genes in patients with deep vein thrombosis and platelet hyperaggregability. Clin Appl Thromb Hemost. 2018;24(7):1027-1032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Brunclikova M, Ivankova J, Skerenova M, et al. Association of genetic variability in selected genes with platelet hyperaggregability and arterial thrombosis. Acta Medica Martiniana. 2022;22(1):34-44. [Google Scholar]
  • 15.Mammen EF. Sticky platelet syndrome. Semin Thromb Hemost. 1999;25(4):361-365. [DOI] [PubMed] [Google Scholar]
  • 16.Bick RL. Sticky platelet syndrome: A common cause of unexplained arterial and venous thrombosis. Clin Appl Thromb Hemost. 1998;4(2):77-81. [Google Scholar]
  • 17.MagNA Pure LC Total Nucleic Acid Isolation Kit – High Performance, Roche Diagnostics, Version 11, Content version: August 2015, p. 7-10.
  • 18.Primer3 software. Accessed June 8, 2025. Available at: https://primer3.ut.ee/
  • 19.Plink. Whole genome association analysis toolset. Accessed June 8, 2025. Available at: https://zzz.bwh.harvard.edu/plink/
  • 20.Purcell S, Neale B, Todd-Brown K, et al. PLINK: A tool set for whole-genome association and population-based linkage analyses. Am J Hum Genet. 2007;81(3):559-575. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Slifer SH. PLINK: Key functions for data analysis. Curr Protoc Hum Genet. 2018;97(e59):1-20. [DOI] [PubMed] [Google Scholar]
  • 22.Donnet A, Ducros A, Radat F, et al. Severe migraine and its control: A proposal for definitions and consequences for care. Rev Neurol (Paris). 2021;177(8):924-934. [DOI] [PubMed] [Google Scholar]
  • 23.Lechner H, Ott E, Fazekas F, Pilger E. Evidence of enhanced platelet aggregation and platelet sensitivity in migraine patients. Int Haedache Soc. 1985;5(2):89-91. [DOI] [PubMed] [Google Scholar]
  • 24.Tozzi E, Tozzi-Ciancarelli MG, Di Massimo C, et al. Platelet responsiveness in migrainous children during headache-free period. Haedache. 1996;36(2):95-99. [DOI] [PubMed] [Google Scholar]
  • 25.Tietjen GE, Collins SA. Hypercoagulability and migraine. Headache. 2018;58(1):173-183. [DOI] [PubMed] [Google Scholar]
  • 26.Benedick A, Zeharia A, Markus TE. Comparison of thrombocyte count between pediatric patients with migraine or tension-type headache: A retrospective cohort study. J Child Neurol. 2019;34(13):824-829. [DOI] [PubMed] [Google Scholar]
  • 27.Ducros A. Genetics of migraine. Rev Neurol (Paris). 2021;177(7):801-808. [DOI] [PubMed] [Google Scholar]

Articles from Clinical and Applied Thrombosis/Hemostasis are provided here courtesy of SAGE Publications

RESOURCES