Urotensin II system contributes to ischemic acute kidney injury in neonatal pigs

Abstract

The urotensin II (UII) system comprises UII, UII-related peptide (URP), and their shared receptor UT. Bioactive UII can be generated from its precursor, prepro-UII, through proteolytic cleavage by the serine protease furin. The kidney serves as a significant source of UII, with elevated levels reported in infants with chronic kidney disease. Here, we investigated the contribution of the UII system to the loss of kidney function during ischemia-reperfusion (IR)-induced acute kidney injury (AKI) in neonatal pigs. Intra-arterial renal infusion of porcine UII reduced renal blood flow and increased vascular resistance, effects reversed by the UT antagonist urantide. Although IR did not alter whole-kidney UT expression, it increased furin, UII, URP, and vascular UT levels. Urantide attenuated IR-induced kidney hypoperfusion, elevations in AKI biomarkers and circulating cytokines, and histological kidney injury. In primary neonatal pig proximal tubule epithelial cells (PTECs), chemical IR (cIR), modeled by 1 h of ischemia (ATP-, glucose-, and serum-depleted medium) followed by reperfusion (restoration of complete medium), elevated furin and UII production. The furin inhibitor SSM 3 trifluoroacetate (SSM 3) suppressed cIR-induced UII synthesis. Moreover, both urantide and SSM 3 mitigated cIR-induced PTEC injury. These findings suggest that in neonatal pigs: (1) renal IR upregulates furin, UII, and URP in kidney tissue and UT in the microvasculature, (2) furin promotes UII biosynthesis in renal epithelial cells, and (3) UT inhibition protects against ischemic AKI.

Graphic Abstract

Schematic representation illustrating the contribution of the UII system to ischemic acute kidney injury in neonatal pigs. In vivo, UII system components are upregulated in neonatal pigs subjected to renal IR injury. Pharmacological inhibition of the UT reverses UII-induced hemodynamic impairment and protects against IR-induced renal dysfunction, inflammation, and histological injury. In vitro, ischemic activation of furin enhances UII biosynthesis in primary renal epithelial cells, while pharmacological inhibition of furin and UT attenuates chemical IR–induced cytotoxicity. Abbreviations: coPf, cortical perfusion; RBF, renal blood flow; GFR, glomerular filtration rate; IL, interleukin; IR, ischemia-reperfusion; MAP, mean arterial pressure; RVR, renal vascular resistance; SSM3 tetraTFA, SSM3 trifluoroacetate; UII, urotensin II; URP, urotensin-related peptide; UT, urotensin receptor; PTECs, proximal tubule epithelial cells.

Created with BioRender.com

Introduction

Urotensin II (UII) is a vasoactive peptide hormone initially discovered in the urophysis of teleost fish [1–3]. It has since been identified in various mammalian species, including humans [1]. UII, its paralog UII–related peptide (URP), and their shared receptor UT comprise the UII system, which is expressed in multiple tissues, including the kidneys [1]. UII is derived from the precursor peptide prepro-UII through proteolytic cleavage [4]. Furin, a serine protease, is considered the predominant UII-converting enzyme, although trypsin may also play a role [5]. In mammals, the kidney is a primary source of UII [6,7].

Alterations in kidney expression of UII and UT, as well as changes in serum and urinary UII levels, have been linked to conditions such as hypertension, heart failure, and diabetic nephropathy [8,9]. In adult rodents, the UII system is upregulated in chronic kidney disease (CKD) and cardiac ischemia-reperfusion (IR) injury [10,11]. Pharmacological inhibition of UT has shown varying degrees of protection against CKD progression and myocardial or renal IR injury [10–12]. However, the expression, vascular physiology, and pathophysiology of UII in mammals appear to depend on species, anatomical site of vessels, and developmental stage [9,13–17]. UII has been detected in the rat metanephros and embryonic day 19 kidneys, with levels increasing postnatally [15]. Conversely, UT expression decreases between embryonic day 19 and birth and remains stable thereafter [15]. A postnatal rise in serum UII has also been observed in lambs [17]. In human infants, renal UII immunoreactivity and blood levels are elevated in conditions such as minimal change nephrotic syndrome, congenital heart disease, glomerulonephritis, and CKD, suggesting a potential pathophysiological role of the UII system in pediatric populations [18–20].

Acute kidney injury (AKI) is characterized by a rapid, often reversible decline in renal function [21]. Due to kidney immaturity, infants are particularly vulnerable to AKI, especially under adverse perinatal conditions such as prematurity, asphyxia, sepsis, dehydration, congenital anomalies, nephrotoxic exposure, and renal ischemia [22–24]. Ischemic AKI results from reduced renal blood flow and oxygen delivery, with subsequent reperfusion exacerbating tissue injury [25,26]. In neonates, causes include hypotension, hypovolemia, and cardiac surgery [22,23,27]. AKI is prevalent in neonatal intensive care units and is associated with prolonged mechanical ventilation, increased morbidity, and higher mortality [22,27,28]. Growth-restricted newborns are particularly susceptible to AKI and face an elevated risk of death [29,30]. Notably, serum UII levels are higher in preterm low-birth-weight infants compared to their appropriate-for-gestational-age counterparts at term-equivalent age [31]. AKI is a known risk factor for CKD later in life, but the contribution of the UII system to neonatal AKI remains unclear.

We previously demonstrated that human UII (hUII) increases renal vascular resistance (RVR) in neonatal pigs [32]. hUII, an 11–amino acid cyclic peptide, is recognized as one of the most potent endogenous vasoconstrictors [33,34]. Porcine UII (pUII) is slightly longer, comprising 12 amino acids [35]. Despite differences in the N-terminal region, UII consistently retains a conserved cyclic core formed by a disulfide bond between two cysteine residues—an essential feature for its biological activity [4,13,36].

Given the close similarities between human and porcine renal anatomy and physiology, pigs serve as a valuable preclinical model for investigating AKI [37,38]. In this study, we first demonstrate that pUII reduces renal blood flow (RBF) and increases RVR in anesthetized, mechanically ventilated neonatal pigs. Since renal hypoperfusion is a key component of renal IR injury, we further tested the hypothesis that increased UII system activity contributes to the pathogenesis of ischemic AKI in neonates.

Materials and methods

Animals

The Institutional Animal Care and Use Committee of the University of Tennessee Health Science Center reviewed and approved the protocol (# 21-0276). This study was conducted in accordance with the National Institutes of Health guidelines for the Care and Use of Laboratory Animals and the ARRIVE guidelines. Male domestic piglets (3–7 days old, 2–3.5 Kg) were obtained from Nichols Hog Farm (Olive Branch, MS, USA). The piglets were divided randomly into experimental groups.

Anesthesia and mechanical ventilation

All animal experiments were conducted under general anesthesia. Anesthesia was induced with an intramuscular injection of ketamine (20 mg/kg) and xylazine (2.2 mg/kg). Piglets were then placed in a supine position on a heating pad, and adequate anesthetic depth was confirmed prior to performing a tracheostomy. A 3.5 mm endotracheal tube was inserted, and pressure-controlled mechanical ventilation was initiated using a Sechrist Millennium neonatal/infant ventilator (Anaheim, CA, USA) with the following settings: fraction of inspired oxygen (FiO₂) 0.21, peak inspiratory pressure 15 cmH₂O, positive end-expiratory pressure 5 cmH₂O, respiratory rate 20 breaths per minute, and inspiratory time 0.6 s. The femoral vein was catheterized for fluid and medication administration, while the left femoral artery was catheterized for intrarenal arterial (IA) drug delivery. The arterial catheter was advanced through the abdominal aorta until its tip reached the junction with the left renal artery, with final positioning confirmed at the conclusion of each experiment.

General anesthesia was maintained with intravenous (IV) α-chloralose, administered as a 50 mg/kg loading dose followed by intermittent boluses of 20 mg/kg as needed. Arterial blood gases, pH, and hematocrit were periodically measured using a GEM Premier 3000 Blood Gas Analyzer (Instrumentation Laboratory, Bedford, MA). Ventilator settings were adjusted to maintain physiological parameters: PCO₂ ∼30 mm Hg, PO₂ >85 mm Hg, and pH ∼7.4. Anesthetic depth was regularly monitored throughout the experiments, and supplemental doses were administered as needed [32]. All piglets received maintenance IV fluids using lactated Ringer’s solution at 4 mL/kg/h. Urine was drained via a ureteral catheter.

Renal hemodynamics measurement

Mean arterial pressure (MAP) was measured using a 3.5 Fr intra-arterial pressure catheter (Mikro-Tip SPR-524, Millar Instruments, Inc., Houston, TX) inserted into the right femoral artery and connected to a physiological pressure transducer (ADInstruments, Colorado Springs, CO). Piglets were then positioned in the right lateral recumbency to facilitate renal hemodynamic measurements. The left kidney was exposed via a retroperitoneal flank incision to access and isolate the renal pedicle. Total RBF was measured using a 2 mm transit-time ultrasound perivascular flow probe (Transonic PS Series, Ithaca, NY, USA) placed around the main renal artery and connected to a Transonic flowmeter. Local renal cortical perfusion was assessed using laser Doppler flowmetry (Periflux 5000, Perimed Inc.). All physiological recordings were acquired simultaneously using a PowerLab data acquisition system and LabChart Pro software (ADInstruments, Colorado Springs, CO). Baseline (0 h) hemodynamic values were obtained after all monitoring devices were in place, and data were recorded continuously throughout the experiment [32].

To assess the effects of the UII system on renal hemodynamics, piglets received a continuous 1-h intrarenal arterial infusion via the left femoral artery catheter using a syringe pump. Animals were randomized to receive either Lactated Ringer’s solution (control) or pUII (1 µg/kg/min). A separate group of piglets was pretreated with the UT receptor antagonist urantide (URTD; 1 µg/kg/min) for 30 min prior to pUII infusion at the same dose.

Renal ischemia-reperfusion

A separate cohort of animals was used to investigate the role of the UII system in ischemic AKI through bilateral renal IR experiments. Under general anesthesia, bilateral flank incisions were made to expose the kidneys. In the IR group, both right and left renal pedicles were isolated and occluded for 1 h using non-traumatic microvascular clamps, followed by 8 h of reperfusion. The sham group consisted of piglets that underwent identical surgical procedures without renal pedicle occlusion. In the IR + URTD group, the protocol was the same as the IR group, except that piglets received a continuous intravenous infusion of urantide (URTD; 1 µg/kg/min) during the first hour of reperfusion. In contrast, the IR and sham groups received Lactated Ringer’s solution during this period. MAP, RBF, and coPf were measured throughout the experiment as described above.

Transdermal glomerular filtration rate determination

Glomerular filtration rate (GFR) was determined using a three-compartment model based on the clearance of fluorescein-isothiocyanate (FITC)–conjugated sinistrin, as previously described [39–41]. Briefly, a designated area on the abdomen of the anesthetized piglet was shaved and cleaned. Following battery activation, the optical transdermal GFR monitoring device (MediBeacon GmbH, Mannheim, Germany) was prepared and affixed to the skin using an adhesive patch. After a 3–5 min period of background signal stabilization, FITC-sinistrin was administered as a rapid intravenous bolus at a dose of 20 mg/kg. The device continuously recorded FITC-sinistrin clearance throughout the final 4 h of the reperfusion phase in the renal IR experiments. To ensure uninterrupted measurement, care was taken to minimize animal movement that could result in the device’s detachment or displacement. At the end of the recording period, the device was removed, and data were analyzed using MediBeacon Studio 3 software according to the manufacturer’s instructions [39–41]. Piglets exhibiting excessive movement or disruption of the device during the measurement period were excluded from GFR analysis.

Cellular model of IR

Primary renal proximal tubular epithelial cells (PTECs) isolated from one-day-old neonatal pigs (Cell Biologics Inc., Chicago, IL, USA; Catalog # P-6015) were cultured in complete epithelial cell medium under standard conditions. Ischemia was simulated using a previously established ATP-depletion protocol involving antimycin A treatment [42]. Briefly, cells were incubated for 1 h at 37 °C in glucose- and serum-free medium containing antimycin A (10 µM), 2-deoxyglucose (10 mM), and calcium ionophore A23187 (1 µM). Antimycin A inhibits oxidative phosphorylation, thereby depleting intracellular ATP and mimicking ischemic energy failure [43]. 2-deoxyglucose inhibits glycolysis, further preventing ATP production [44], while calcium ionophore A23187 induces intracellular calcium overload, which replicates the calcium dysregulation observed in ischemic renal tubular cells and contributes to epithelial injury [45]. To simulate reperfusion, cells were washed three times with phosphate-buffered saline and reincubated in glucose- and serum-containing epithelial cell medium (10% FBS) for 8 h at 37 °C and 5% CO₂. Control cells were maintained in glucose- and serum-supplemented medium throughout the experiment.

Additional treatment groups were pretreated with either the furin inhibitor SSM3 trifluoroacetate (10 µM) or the UT receptor antagonist urantide (10 µM) for 30 min prior to cIR induction. Furin and UII levels were quantified using porcine-specific ELISA kits from MyBioSource (Catalog # MBS087674, San Diego, CA, USA) and Bioassay Technology Laboratory (Catalog # E0490Po, Shanghai, China), respectively. Cytotoxicity was assessed using the QuantiChrom LDH Cytotoxicity Assay (C2LD-100, BioAssay Systems, Hayward, CA, USA) according to the manufacturer’s instructions.

Kidney injury and inflammation assays

Kidney function in neonatal pigs was assessed by measuring GFR, plasma creatinine, and blood urea nitrogen (BUN) levels. Plasma creatinine concentrations were determined using liquid chromatography–tandem mass spectrometry at the UAB/UCSD O’Brien Core Center for AKI Research (University of Alabama at Birmingham). BUN levels were measured with the IDEXX Catalyst BUN kit (98-11070-01) on a Catalyst One veterinary chemistry analyzer (IDEXX Laboratories, Westbrook, ME, USA). Plasma neutrophil gelatinase-associated lipocalin (NGAL) was quantified using a porcine-specific NGAL ELISA kit (BioPorto Diagnostics, Hellerup, Denmark). Interleukin (IL)-1β and IL-10 levels were measured in plasma using multiplex immunoassay technology on the Luminex MAGPIX platform (DiaSorin Inc., Saluggia, Italy). All plasma and urine samples were collected at the conclusion of the 8-h reperfusion period.

Quantitative RT-PCR

Kidney tissue and intrarenal arteries (a pooled sample of interlobar, arcuate, and interlobular arteries) were homogenized in TRIzol reagent (Zymo Research, Irvine, CA, USA) using a Bead Ruptor 12 homogenizer (Omni International, Inc., Kennesaw, GA, USA). Total RNA was extracted using the Direct-zol RNA Miniprep Plus Kit (Zymo Research), following the manufacturer’s instructions. Complementary DNA (cDNA) was synthesized from the isolated RNA using a reverse transcription kit (Life Technologies, Carlsbad, CA, USA). Quantitative real-time PCR (qRT-PCR) was performed using the QuantStudio system with SYBR Green Master Mix (Applied Biosystems, Life Technologies). Gene expression levels were normalized to 18S ribosomal RNA, which served as the internal reference. The gene-specific oligonucleotide primers used for amplification are listed in Table 1.

Table 1.

Oligonucleotide primer sequences.

Gene	Sequence	Accession	Length (bp)
18S ribosomal RNA		NR_046261.1	102
Forward	5′—CGAAAGCATTTGCCAAGAAT—3′
Reverse	5′—AGTCGGCATCGTTTATGGTC—3′
UT		XM_021066355.1	114
Forward	5′—CTTTCTGAACGGAGGGCTCG—3′
Reverse	5′——CTCGCCACGTCCAAGGATAA—3′
UII		NM_214143.1	117
Forward	5′—ACCATACAAGAAACGTGGGC—3′
Reverse	5′—GCACTGCTGTCAAGTCAAGC—3′
URP		XM_005670073.3	119
Forward	5′—TCTCCGCAGCTTTCCAGAAT—3′
Reverse	5′—GTCCAAAGCAAAGAGTGGTTGA—3′
Furin		XM_005653506.3	115
Forward	5′—TTTAGGGCAGCTTTCCAGGG—3′
Reverse	5′—CTGCCTGGATGGGAACCATT—3′

Histopathology

Histopathological processing and analysis were independently performed by Reveal Biosciences Inc. (San Diego, CA, USA). All tissue samples were trimmed, processed, and embedded as formalin-fixed, paraffin-embedded (FFPE) blocks. Sections were cut at 4 μm thickness and mounted onto positively charged SuperFrost slides to ensure optimal tissue adherence. Slides were stained with hematoxylin and eosin (H&E) following standard protocols. Automated image quality control tools were used to evaluate focus, artifacts, and color variation. Whole-slide images were generated using a PANNORAMIC SCAN digital slide scanner (3D Histech).

Histopathological evaluation was performed in a blinded manner by board-certified pathologists at Reveal Biosciences. Assessed features included tubular injury, infiltration of inflammatory cells within the glomeruli and interstitium, and glomerular and microvascular alterations. Renal injury was scored using a semiquantitative grading scale: 0 = within normal limits, 1 = minimal, 2 = mild, 3 = moderate, 4 = marked, 5 = severe.

Immunofluorescence

Cultured neonatal pig PTECs grown on glass coverslips were immunostained with primary antibodies against furin (1:25 dilution) and UII (1:50 dilution), followed by incubation with appropriate secondary antibodies (1:300 dilution). Fluorescence images were captured using a Leica DMi8 fluorescence microscope.

Immunohistochemistry

Standard immunohistochemistry was performed on paraffin-embedded kidney sections using reagents from Cell Marque (Rocklin, CA, USA) and Vector Laboratories (Burlingame, CA, USA). Sections were immunostained with rabbit anti-UII antibody (1:50 dilution). Detection was carried out using chromogenic 3,3′-diaminobenzidine as the substrate. Following staining, sections were dehydrated through graded alcohols, cleared in xylene, and mounted using a resin-based mounting medium. Stained sections were examined by light microscopy.

Western immunoblotting

Total protein was extracted from the kidney cortex and intrarenal arteries of piglets using RIPA lysis buffer. Protein concentrations were determined, and samples were denatured in an LDS sample buffer containing dithiothreitol and then heated at 70 °C for 10 min. Proteins were separated by SDS-PAGE using polyacrylamide gels in a Mini Trans-Blot Cell (Bio-Rad) and subsequently transferred onto PVDF membranes via semidry blotting. Membranes were blocked for approximately 1 h at room temperature in Tris-buffered saline with 0.05% Tween-20 (TBS-T) supplemented with 4% bovine serum albumin. They were then incubated overnight at 4 °C with the appropriate primary antibodies. Following washes in TBS-T, membranes were incubated with horseradish peroxidase (HRP)–conjugated secondary antibodies for approximately 1 h at room temperature. Immunoreactive bands were visualized using an enhanced chemiluminescent reagent.

Chemicals and antibodies

PUII ([Cyc(6,11)]H₂N-GPTSECFWKYCV-OH) was custom synthesized by Biosynth International (San Diego, CA). SSM3 trifluoroacetate was obtained from Tocris Bioscience (Bristol, UK), and urantide from Biosynth. For immunostaining, a mouse monoclonal anti-furin antibody (clone B6) was purchased from Santa Cruz Biotechnology (sc-133142, Santa Cruz, CA, USA), and a rabbit polyclonal anti-UII antibody was acquired from Abcam (ab194676, Boston, MA, USA). Secondary antibodies for immunofluorescence included highly cross-adsorbed CF488 donkey anti-mouse IgG (#20014) and CF555 donkey anti-rabbit IgG (#20038), both used at a 1:300 dilution (Biotium Inc., Fremont, CA, USA). The secondary antibody for immunohistochemistry was an HRP-conjugated anti-rabbit IgG (#7074, Cell Signaling Technology, Danvers, MA, USA) used at a 1:500 dilution.

For Western blot analysis, the primary antibodies included a rabbit polyclonal anti-furin antibody (18413-1-AP, Proteintech, Rosemont, IL, USA) at a 1:500 dilution and a rabbit polyclonal anti-GPR14 (UT receptor) antibody (TA358466, OriGene Technologies, Rockville, MD, USA) at a 1:100 dilution. The secondary antibody was an HRP-conjugated anti-rabbit IgG (Cell Signaling Technology) used at a 1:5000 dilution.

Statistical analysis

Statistical analyses were performed using GraphPad Prism software (GraphPad Software Inc., Sacramento, CA, USA). Data are presented as mean ± standard error of the mean (SEM) and as box-and-whisker plots representing the 5th to 95th percentiles. Comparisons between two groups were made using unpaired t-tests, while multiple group comparisons were analyzed using one-way analysis of variance (ANOVA) followed by Holm-Šídák’s post hoc test. A P-value < 0.05 was considered statistically significant.

Results

Porcine UII reduces renal blood flow and increases vascular resistance in neonatal pigs

Intrarenal arterial infusion of urantide, a potent and selective UT receptor antagonist [46], did not alter MAP, cortical perfusion, RBF, or RVR in neonatal pigs (Figure 1A–D). In contrast, intrarenal infusion of pUII significantly increased MAP and RVR while reducing RBF and cortical perfusion (Figure 1E–H). Notably, urantide attenuated the pressor and hypoperfusion effects induced by pUII (Figure 1E–H).

Figure 1.

Porcine UII reduces renal blood flow and increases vascular resistance in neonatal pigs. Line graphs showing percent changes from baseline in (A) mean arterial pressure (MAP), (B) cortical perfusion, (C) total renal blood flow (RBF), and (D) renal vascular resistance (RVR) in neonatal pigs infused with lactated ringer’s solution (control; n = 5) or urantide (URTD; 1 µg/kg/min; n = 6). Panels (E–H) show changes in MAP, cortical perfusion, RBF, and RVR, respectively, in pigs infused with lactated ringer’s (n = 3), porcine UII (1 µg/kg/min for 60 min; n = 4), or URTD (1 µg/kg/min for 30 min) followed by porcine UII (1 µg/kg/min for 60 min; n = 4). *p < 0.05 control vs. porcine UII (MAP: 10–30 and 60 min; cortical perfusion: 10–40 min; RBF: 10–40 min; RVR: 10–60 min). ^#p < 0.05 porcine UII vs. URTD + porcine UII (MAP: 10–40 and 60 min; cortical perfusion: 10–40 min; RBF: 10–50 min; RVR: 10–60 min). Two-way ANOVA and Holm-Šídák’s multiple comparisons tests.

Changes in UII system expression in neonatal pig kidneys following renal IR

Renal IR in neonatal pigs significantly increased the mRNA expression of furin, UII, and URP in the kidney compared to sham-operated controls (Figure 2A–C). In contrast, UT mRNA expression was not significantly altered (Figure 2D). However, IR injury upregulated both mRNA and protein expression of UT in intrarenal arteries (Figure 2E, F, G) and also increased furin protein levels in the kidney (Figure 2H, 1). Immunohistochemical analysis confirmed elevated UII expression in ischemia-reperfused kidneys relative to the sham group (Figure 2J, K).

Figure 2.

Upregulation of the UII system in the kidneys of neonatal pigs following IR injury. Quantitative RT-PCR analysis showing relative mRNA expression levels of (A) furin, (B) UII, (C) URP, and (D) UT in whole kidney tissue, and (E) UT in intrarenal arteries from sham and IR piglets (n = 4 per group). (F–G) Representative Western blot and densitometric analysis of UT protein expression in intrarenal arteries (n = 4 per group). (H–I) Western blot and quantification of furin protein expression in kidney tissues (n = 4 per group). (J–K) representative immunohistochemistry (IHC) images and quantification of UII immunostaining intensity in renal tubules from sham and IR piglets (4 kidney sections per group). *p < 0.05, unpaired t-test.

UT receptor inhibition mitigates renal IR-induced hemodynamic impairment and increased levels of AKI biomarkers, inflammatory cytokines, and kidney injury in neonatal pigs

Renal IR in neonatal pigs resulted in a marked reduction in RBF and cortical perfusion, along with an increase in RVR (Figure 3A–C). Plasma levels of creatinine, BUN, and NGAL—established biomarkers of AKI—were significantly elevated in the IR group compared to sham-operated controls (Figure 3D–F). Additionally, IR-exposed piglets exhibited delayed FITC-sinistrin clearance, corresponding to a > 50% reduction in GFR relative to sham animals (Figure 3G). Inflammatory markers were also elevated, with significantly higher plasma concentrations of IL-1β and IL-10 in the IR group (Figure 3H, 1). Histological evaluation revealed minimal kidney injury in sham-operated animals (Figure 4A). In contrast, the IR group displayed extensive tubular degeneration and dilatation, interstitial leukocyte infiltration, and perivascular edema and hemorrhage (Figure 4A). The composite kidney injury score was significantly higher in IR-exposed piglets compared to sham controls (Figure 4B).

Figure 3.

UT inhibition mitigates renal IR-induced renal hemodynamic impairment, AKI biomarkers, and inflammatory cytokine expression in neonatal pigs. Cortical perfusion (A), total renal blood flow (RBF; B), and renal vascular resistance (RVR; C) in sham-operated piglets and those subjected to renal IR, with or without UT inhibition using urantide (URTD; 1 µg/kg/min during the first 60 min of reperfusion; n = 5 per group). (D–I) Plasma biomarkers of kidney function and inflammation: (D) creatinine (crea), (E) blood urea nitrogen (BUN), (F) neutrophil gelatinase-associated lipocalin (NGAL), (G) glomerular filtration rate (GFR; n = 4 per group), (H) interleukin-1β (IL-1β), and (I) interleukin-10 (IL-10) in sham, IR, and URTD + IR groups (n = 5 per group for D–F, H–I). *p < 0.05 sham vs. IR; ^#p < 0.05 IR vs. URTD + IR. One-way ANOVA and Holm-Šídák’s multiple comparisons tests.

Figure 4.

UT inhibition attenuates renal IR-induced histological kidney injury in neonatal pigs. (A) Representative hematoxylin and eosin–stained kidney sections and (B) Quantification of combined histological injury scores in sham-operated piglets and those subjected to renal IR, with or without UT inhibition using urantide (URTD; 1 µg/kg/min during the first 60 min of reperfusion; n = 5 per group). *p < 0.05 sham vs. IR; ^#p < 0.05 IR vs. URTD + IR. One-way ANOVA and Holm-Šídák’s multiple comparisons tests. Scale bar = 50 µm. Black arrowheads indicate areas of tubular degeneration characterized by cytoplasmic vacuolization. Red arrowheads highlight tubular dilatation and intraluminal cast formation.

Treatment with the UT receptor antagonist urantide mitigated IR-induced reductions in RBF, cortical perfusion, and GFR, while also attenuating the rise in RVR and plasma levels of AKI biomarkers (Figure 3A–G). Urantide further suppressed the IR-associated increases in plasma IL-1β and IL-10 (Figure 3H, 1) and significantly reduced histopathological evidence of kidney injury (Figure 4A, B).

Furin inhibition reduces chemical IR-driven UII production, and UT and furin inhibitors attenuate chemical IR-induced cytotoxicity in primary neonatal pig PTECs

Immunofluorescence staining demonstrated colocalization of furin and UII in PTECs (Figure 5A). Exposure to chemical IR (cIR) significantly increased intracellular furin production (Figure 5B), which was accompanied by elevated UII levels (Figure 5C). cIR-induced increase in UII production was attenuated by the furin inhibitor SSM3 trifluoroacetate (SSM3; Figure 5C). Moreover, inhibition of furin with SSM3 and inhibition of UT with urantide both significantly reduced cIR-induced cytotoxicity (Figure 5D), indicating that furin-dependent UII production and UT signaling contribute to PTEC injury under ischemic conditions.

Figure 5.

Furin inhibition reduces cIR-driven UII production, and UT and furin blockade attenuate cIR-induced cytotoxicity in primary neonatal pig proximal tubule epithelial cells. (A) Representative fluorescence microscopy images showing furin and UII immunostaining and their colocalization in primary neonatal pig proximal tubule epithelial cells (PTECs; 3 biological replicates). (B) Quantification of intracellular furin levels in control (ctrl) and chemical ischemia-reperfusion (cIR)–treated cells (n = 4). (C) Secreted UII levels in cIR-treated cells in the absence or presence of the furin inhibitor SSM3 trifluoroacetate (SSM3; n = 4). (D) cIR-induced cytotoxicity was significantly reduced by pharmacological inhibition of furin (SSM3) and by UT inhibition with urantide (URTD). *p < 0.05 ctrl vs. cIR; p < 0.05 cIR vs. SSM3 + cIR; ^$p < 0.05 cIR vs. both SSM3 + cIR and URTD + cIR. Unpaired t-test (B); One-way ANOVA and Holm-Šídák’s multiple comparisons tests (C–D); n = 4, each. Scale bar = 50 µm.

Discussion

This study demonstrates that the UII system contributes to the pathogenesis of ischemic AKI in neonatal pigs. Our findings reveal that: (1) renal IR upregulates furin, UII, and URP in kidney tissues, and increases UT expression in intrarenal arteries; (2) ischemic activation of furin promotes UII biosynthesis in primary renal epithelial cells; and (3) pharmacological inhibition of UT mitigates renal IR-induced functional, inflammatory, and structural kidney injury.

Consistent with the known vasoconstrictor role of hUII, intrarenal arterial infusion of pUII in neonatal pigs led to increased RVR and decreased RBF and cortical perfusion. This effect is likely due to the conserved C-terminal sequence of UII across mammalian species, which mediates its biological activity [4, 13,32,35,36]. Urantide, a potent and selective UT antagonist, reversed the hemodynamic effects of UII, confirming that UT activation mediates UII-induced renal hypoperfusion. In our previous work, inhibition of UT, phospholipase C (PLC), and inositol 1,4,5-trisphosphate (IP₃) signaling attenuated hUII-induced systemic and renal vasoconstriction, suggesting that UII–UT signaling may impair renal perfusion via PLC/IP₃-mediated pathways [32].

Renal IR injury results from a temporary loss of blood flow (ischemia) followed by its restoration (reperfusion), which paradoxically exacerbates tissue damage through oxidative stress and inflammation. The persistent reduction in RBF following reperfusion is driven in part by endothelial dysfunction and an imbalance in vasoactive mediators [47–49]. In our model, 1 h of bilateral renal ischemia followed by 8 h of reperfusion in neonatal pigs led to a significant reduction in RBF and cortical perfusion, along with increased RVR. These hemodynamic changes were accompanied by impaired renal function (decreased GFR, elevated plasma creatinine, BUN, and NGAL), systemic inflammation, and histological evidence of tubular injury. These findings were paralleled by marked upregulation of furin, UII, and URP in kidney tissues and UT in intrarenal arteries.

UT is a G protein–coupled receptor with two N-glycosylation sites [50–55]. In our previous work, we identified both glycosylated and non-glycosylated forms of UT in renal afferent arterioles of neonatal pigs [32]. In the present study, however, only the ∼70 kDa form of UT was detected in intrarenal arteries, and its expression was upregulated following renal IR injury. Although the precise functional role of UT glycosylation remains unclear, these findings suggest a tissue-, cell type–, or species-specific post-translational regulatory mechanism governing UT expression.

Since UT activation promotes renal vasoconstriction and hypoperfusion, it may contribute to ischemic AKI by elevating RVR and impairing GFR. Supporting this, UT inhibition with urantide not only improved renal hemodynamics and GFR but also attenuated plasma levels of proinflammatory cytokines IL-1β and IL-10. IL-1β is a key mediator of inflammasome-driven systemic and kidney inflammation, while IL-10 acts as a protective anti-inflammatory cytokine [56,57]. Notably, IL-10 is also emerging as an early AKI biomarker in pediatric patients undergoing cardiac surgery [58]. UII has previously been implicated in inflammation by inducing cytokines such as MCP-1 and TGF-β and enhancing leukotriene B4 production via the UT–ROS–Akt pathway [59–61]. These data support the hypothesis that UII contributes to renal inflammation during IR injury, and that UT antagonism may offer a dual benefit by restoring perfusion and reducing inflammation.

Furin is a proprotein convertase responsible for cleaving prepro-UII to generate mature, bioactive UII⁵. In primary neonatal porcine renal epithelial cells, we observed colocalization of furin and UII, and confirmed that renal IR upregulates furin expression. In vitro, cIR increased both cellular furin and UII production, while pharmacological inhibition of furin with SSM3 significantly reduced UII levels. Notably, the inhibition of either furin or UT attenuated cIR-induced cytotoxicity, highlighting a functional link between furin-mediated UII biosynthesis and UT-dependent injury signaling. These results are consistent with prior studies showing furin activation under hypoxic and oxidative stress conditions [62,63], and with evidence that furin inhibition can mitigate renal IR injury in adult rodents [64]. Given that the disulfide bonds in serine proteases are redox-sensitive, hypoxia or reactive oxygen species generated during cIR may enhance UII biosynthesis by promoting prepro-UII processing in porcine tubular epithelial cells [65,66]. Together, these findings position furin as a potential upstream regulator of the UII system during ischemic stress. Studies are warranted to further evaluate the therapeutic potential of furin inhibition in vivo, particularly in neonatal models of AKI.

UT antagonists have shown promise in preclinical models of CKD and nephrotoxicity [11, 67]. Genetic deletion of UT in mice protected against diabetic nephropathy, while pharmacological UT antagonism with palosuran mitigated renal impairment in adult rodent models of AKI, diabetes, and cyclosporine-induced nephrotoxicity [12,68–70]. However, clinical trials with palosuran in diabetic patients yielded inconclusive outcomes [71]. Urantide is a potent UT antagonist with demonstrated efficacy in rodent models of inflammation and cardiovascular disease [72–74]. Urantide reduced MCP-1 and C-reactive protein levels in atherosclerotic rats [60]. However, Nitescu and colleagues [75] reported that urantide failed to improve renal function in rats with endotoxin-induced AKI, suggesting that UT antagonism may be effective primarily in ischemic, rather than inflammatory, AKI models. Our study focuses on neonatal ischemic AKI, a distinct clinical context where the UII system may play a unique pathogenic role.

One limitation of this study is the relatively short reperfusion period (8 h), which primarily captures the early phase of renal IR–induced AKI. Clinically, however, AKI in neonates is often diagnosed 24–72 h after the initial insult, when elevations in serum creatinine and changes in urine output become detectable [76,77]. As a result, the critical early window during which injury is initiated often goes unrecognized. Our model enabled the assessment of early functional, inflammatory, and histological changes that precede overt clinical manifestations. Targeting this subclinical phase may be essential for preventing progression to irreversible injury, CKD, or long-term cardiovascular complications. Future studies are warranted to define the optimal dosing and timing of UT receptor antagonists such as urantide and to evaluate their therapeutic efficacy in extended or delayed treatment paradigms. In addition, we acknowledge that the use of general anesthesia may influence renal hemodynamics. However, sedation and mechanical ventilation are standard in neonatal intensive care settings, where AKI is common, and are thus relevant to our translational model.

Neonatal AKI is a serious complication associated with increased mortality and long-term morbidity in critically ill infants [22,24]. While the UII system has been implicated in pediatric glomerular disease [20], its role in neonatal ischemic AKI has not been previously investigated. Our study provides the first evidence that the UII system is upregulated in neonatal pigs following renal IR and that pharmacological inhibition of UT preserves renal function, reduces inflammation, and limits histological injury. Furthermore, our findings implicate furin, a hypoxia- and redox-sensitive molecule, as an upstream regulator of UII biosynthesis during ischemia. Together, these data highlight the UII system as a potential therapeutic target for the prevention and treatment of ischemic AKI in critically ill neonates.

Funding Statement

This study was supported by the National Institutes of Health grants R01 DK120595 and R01 DK127625 awarded to Dr. Adebiyi. Dr. de la Cruz is a recipient of the American Heart Association Postdoctoral Fellowship (25POST1368875). Dr. Michael is supported by the American Heart Association Postdoctoral Fellowship (23POST1020787). Dr. Kanthakumar is a recipient of both the American Heart Association Postdoctoral Fellowship (830462) and Career Development Award (24CDA1273170).

Acknowledgement

AA conceived and designed the study. JED, OSM, PK, OOF, SAI, JMA, HS, and RK acquired and analyzed the data. AA, JED, OSM, PK, and RK wrote the manuscript. All authors reviewed and approved the manuscript.

Disclosure statement

The authors declare that they have no conflicts of interest.

Data availability statement

The data used and analyzed during the current study can be obtained from the corresponding author upon reasonable request.