Summary
Studies, including our own, suggest that p75NTR plays a pivotal role in immune regulation. Here, we aimed to uncover the role of p75NTR signaling in regulating CD21lo B cell subsets, which are known to facilitate autoimmune activity, and to identify possible regulatory transcripts involved. Through in vitro assays, in vivo models, and RNA-seq analysis, we found that p75NTR expression and CD21lo B cell expansion were increased in B cells following TLR7/9 stimulation in vitro and in pristane-challenged mice in vivo. Interestingly, p75NTR deficiency led to a further expansion of CD21lo B cells and enhanced their pro-inflammatory characteristics. RNA-seq data revealed notable transcript alterations associated with CD21lo B cells, including increased Tbx21 expression. A potential role for p75NTR downstream signaling via phosphorylated p65 (p-p65) was also proposed. Our study provides insights into the role of p75NTR in restraining the development of CD21lo subsets and modulating autoimmune activity in response to autoimmune challenges.
Subject areas: Immunology, Molecular biology, Cell biology
Graphical abstract

Highlights
-
•
P75NTR expression increased in B cells following TLR7/9 stimulation
-
•
CD21lo B cells expand with increased activity after TLR7/9 stimulation
-
•
p75NTR loss enhances TLR7/9-induced expansion of CD21lo B cells
-
•
p75NTR may restrain CD21lo B cells via downstream p-p65 signaling
Immunology; Molecular biology; Cell biology
Introduction
The p75 neurotrophin receptor (p75NTR), also known as the nerve growth factor receptor (NGFR), is a pan-neurotrophic receptor that belongs to the tumor necrosis factor (TNF) superfamily.1,2,3 Within the central nervous system (CNS), p75NTR acts as a high-affinity receptor for pro-neurotrophins, influencing key processes such as neuronal survival, cell death, and synaptic plasticity, depending on its interaction with precursor or mature ligands, like brain-derived neurotrophic factor (BDNF) and its precursor.4,5,6 Notably, p75NTR is also expressed beyond the nervous system, including in immune cells such as microglia,7,8 macrophages,9 neutrophils,10 and plasmacytoid dendritic cells,11 where it plays a role in regulating inflammation and modulating immune cell function.
Our previous studies have demonstrated the role of p75NTR in modulating the functions of various immune cell subsets. In patients with the autoimmune disease multiple sclerosis, increased expression of p75NTR in lymphocytes facilitated the pathological effects of its high-affinity ligand, the brain-derived neurotrophic factor precursor (proBDNF), contributing to disease progression.12 Additionally, p75NTR expression was elevated in activated human peripheral monocytes/macrophages, promoting inflammatory immune responses.13,14 Recently, we identified an upregulation of p75NTR in antibody-secreting B cells (ASCs) in systemic lupus erythematosus. Deficiency of p75NTR in B cells was found to limit ASCs proliferation and differentiation.15 Furthermore, a study by Hernandez-Barranco et al. demonstrated that p75NTR acts as an immune tolerance checkpoint in germinal centers (GC); systemic p75NTR knockout led to abnormal GC formation and enhanced follicular dendritic cell and overall B cell activation.16 These findings suggest that p75NTR plays a critical role in regulating immune functions and development.
Recent studies have highlighted the specific role of dim CD21 expression on B cells during inflammation.17,18 CD21, also known as complement receptor 2 (CR2), is a cell surface protein primarily expressed on B cells and is crucial for their activation and regulation.19,20,21 In humans, CD21lo B cells expand under inflammatory conditions and represent an innate-like B cell population, characterized by decreased expression of homeostatic chemokine receptors and increased expression of inflammatory chemokine receptors.22 In mice, CD21lo B cells, referred to as age-associated B cells, accumulate with age.23 This population of CD21lo B cells expands in several autoimmune diseases,24,25,26,27 with toll-like receptors (TLRs) likely being key drivers of this subset.28 Specifically, TLR7 and TLR9 are important inducers of CD21lo B cell expansion.29,30 It is well established that TLRs, particularly TLR7 and TLR9, play pivotal roles in driving the development of autoimmunity.31,32,33 However, whether p75NTR regulates CD21 expression in B cells under TLR stimulation remains unknown.
In this study, we demonstrated that p75NTR expression increases in B cells in response to TLR7/9 stimulation in vitro and following pristane injection—a known activator of TLRs in B cells—in vivo. Targeted depletion of p75NTR in B cells led to a further increase in the proportion of CD21lo B cells, accompanied by transcriptomic changes, including upregulation of Tbx21, and heightened activation of downstream p75NTR signaling pathways of phosphorylated p65 (p-p65). These findings suggest that p75NTR upregulation in B cells serves a restraining role in the expansion of CD21lo B cell subtypes under autoimmune conditions.
Results
P75NTR expression increased in splenic B cells upon stimulation of TLRs in vitro
To explore the expression of p75NTR in B cells after TLRs activation, we stimulated splenic purified B cells from C57BL/6 mice with TLR9 agonist CpG-B, and TLR7 agonist R848 for 24 h (Figure 1A). Compared with resting B cells, the percentage of p75NTR+ cells and the p75NTR mean fluorescence intensity (MFI) was upregulated in B cells both activated by CpG-B and R848 (Figures 1B–1E). Correspondingly, western blot revealed increased protein levels of p75NTR (Figures 1F and 1G) and immunofluorescence indicated broad p75NTR expression in splenic B cells after treatment of CpG-B or R848 (Figures 1H and 1I). Therefore, these results proved an elevation of p75NTR expression in TLR7 or TLR9-activated B cells, which may be involved in regulating B cell immune functions.
Figure 1.
P75NTR expression exhibited an increase in splenic B cells upon stimulation of TLR7/9 in vitro
(A) B220+ splenic B cells from C57BL/6 mice were sorted with magnetic beads and then cultured with CpG-B (0.25 μmol) or R848 (200 ng/mL) for 24 h.
(B and C) Representative flow cytometry images and statistical analysis of the proportion of p75NTR+ cells in splenic B cells by treatment with CpG-B or R848.
(D and E) Representative flow cytometry images and statistical analysis show the changes of p75NTR MFI in splenic B cells after CpG-B or R848 treatment.
(F and G) Representative western blot images and statistical analysis of the gray value showing p75NTR expression in splenic B lymphocytes after CpG-B or R848 treatment.
(H and I) Immunofluorescence staining and statistical analysis were performed in splenic B cells after CpG-B or R848 treatment. Scale bar, 50 μm. Data are presented as mean ± SEM of three independent experiments, n = 3–6 in each group. One-way analysis of variance (ANOVA) was used for statistical analysis.
p75NTR deficiency resulted in the expansion of CD21lo B cells and promoted related immune characteristics
We next want to clarify the role of p75NTR in CD21 expression in B cells upon TLR7/9 stimulation. For that purpose, we used B-cell-specific p75NTR knockout mice as previously described (Figures S1A and S1B). Flow cytometry and western blot confirmed the significant down-regulation of p75NTR protein level in B220+ B cells in CD19cre-p75fl/fl mice relative to control (Figures S1C–S1E). As shown, the percentage of CD21lo B cells in cultured splenic B cells was increased both upon CpG-B and R848 stimulation (Figures 2A and 2B), in parallel with the CD21 MFI in B220+ cells reduced (Figures 2C and 2D). Notably, B cells lacking p75NTR showed a further elevation of CD21lo B cells, which happens similarly upon CpG-B or R848 stimulation (Figures 2E, 2F, and S2). CD21 expression was reduced following CpG-B or R848 treatment, and this reduction was further enhanced in splenic B cells lacking p75NTR under TLR7/9 stimulation (Figures 2G and 2H).
Figure 2.
Deficiency of p75NTR induces the expansion of CD21lo subsets and decreases CD21 MFI in B cells
(A–D) B220+ splenic B cells from C57BL/6 mice were sorted with magnetic beads and then cultured with CpG-B (0.25 μmol) or R848 (200 ng/mL) for 24 h. Representative flow cytometry and quantification showing CD21lo B cell percentages and CD21 MFI in B cells upon CpG-B or R848 stimulation.
(E–H) B220+ splenic B cells from CD19cre-p75fl/fl mice or their CD19-p75fl/fl control were sorted with magnetic beads and then cultured with CpG-B (0.25 μmol) or R848 (200 ng/mL) for 24 h. Representative flow cytometry and statistical analysis showing the changes of CD21lo B cell percentages and the CD21 MFI in B cells. Horizontal bars represent the mean ± SEM of at least three independent experiments. Statistical analyses were performed using one-way ANOVA for Figures 2B and 2D, and unpaired two-tailed Student’s t tests for Figures 2F and 2H.
Increased evidence related to the specific subtype of CD21lo B cells demonstrates its elevated proinflammatory profiles like CD86 and CD44 levels and production of IL-6 and TNF-α, which may exacerbate many inflammatory and autoimmune conditions.34 Correspondingly, compared to control, CpG-B or R848 promoted the expression of CD44 and CD86 in splenic B cells from CD19-p75fl/fl mice (Figures 3A, 3B, 3D, and 3E). p75NTR-deficient B cells revealed further elevation of CD44 and CD86 after CpG-B or R848 treatment (Figures 3A, 3B, 3D, and 3E). The percentage of CD44+ and CD86+ cells in splenic B cells also increased after CpG-B and R848 stimulation when deficient of p75NTR (Figures 3C and 3F). P75NTR deficiency in B cells increased expression of CD44 and CD86 in CD21lo B cell subsets (Figure S3). In addition, the multi-analyte flow assay revealed that the MFI of IL-6 in splenic B cells from CD19cre-p75fl/fl mice increased after CpG-B or R848 treatment compared to control (Figures 3G and 3H). In parallel, the TNF-α level increased in splenic B cells from CD19cre-p75fl/fl mice when stimulated with CpG-B or R848 relative to control (Figures 3I and 3J). Therefore, our results suggest a potential role of p75NTR upregulation in B cells under TLRs stimulation in controlling the differentiation of CD21lo B cell subsets and related proinflammatory responses.
Figure 3.
p75NTR deficiency in B cells showing proinflammatory profiles resembling CD21lo B cell subsets. B220+ splenic B cells from CD19cre-p75fl/fl mice or their CD19-p75fl/fl control were sorted with magnetic beads and then cultured with CpG-B (0.25 μmol) or R848 (200 ng/mL) for 24 h
(A–C) Representative flow cytometry histograms and statistical analysis showing CD44 and CD86 MFI (A and B), CD44, and CD86 positive cells (C) in splenic B cells after CpG-B treatment.
(D–F) Representative flow cytometry histograms and statistical analysis showing CD44 and CD86 MFI (D and E), CD44 and CD86 positive cells (F) in splenic B cells after R848 treatment.
(G–J) LEGENDplex multianalyte flow assays showing IL-6 and TNF-α levels in supernatant from B cells upon CpG-B or R848 treatment. Horizontal bars represent the mean ± SEM of at least three independent experiments. Statistical analyses were performed using unpaired two-tailed Student’s t tests.
Deficiency in p75NTR leads to increased CD21lo-related transcriptomics and proinflammatory profiles in vitro under TLR7/9 stimulation
To further investigate the role of p75NTR in TLR7/9-induced transcriptional regulation in B cells, we conducted RNA-seq to compare the transcriptomic differences in B cells lacking p75NTR upon TLR7 or TLR9 stimulation.
Principal component analysis (PCA) showed that principal component (PC) 1 distinguished the effects of CpG-B versus R848 stimulation in splenic B cells, while PC2 captured differences related to p75NTR deficiency in B cells (Figure 4A). The first two components accounted for the majority of transcriptomic variance, but it still clearly shows distinct expression patterns in p75NTR-deficient B cells. In CpG-B-stimulated B cells from CD19cre-p75fl/fl mice, we identified 389 differentially expressed genes (DEGs), including 170 upregulated and 45 downregulated genes. In R848-stimulated cells, there were 444 DEGs, with 205 upregulated and 51 downregulated (Figures 4B and S4A). KEGG analysis showed that DEGs in CpG-B-activated B cells were enriched in pathways such as cytokine-cytokine receptor interaction, Th1 and Th2 cell differentiation, and complement and coagulation cascades (Figure 4C). Under R848 stimulation, DEGs were associated with TNF and JAK-STAT signaling pathways, Th1 and Th2 cell differentiation, and the intestinal immune network for IgA production (Figure 4D). GO enrichment revealed that DEGs clustered in immune system processes, defense responses to viruses, bacterial responses, and cellular responses to IFN-β upon CpG-B or R848 stimulation in p75NTR-deficient B cells (Figures S4B and S4C).
Figure 4.
RNA-seq analysis in splenic B cells in mice deficient of p75NTR with CpG-B and R848 stimulation
(A) Principal components analysis (PCA) distinguished between CpG-B-stimulated and R848-stimulated differences in splenic B cells and differences in lacking p75NTR in B cells.
(B) Heatmap depicting differentially expressed transcripts between CD19cre-p75fl/fl mice and the control group with CpG-B and R848 treatment. Red indicates increased relative expression, and blue indicates decreased relative expression.
(C and D) Bubble diagram of KEGG enrichment top 20 between CD19cre-p75fl/fl mice and control group with CpG-B and R848 treatment.
(E) Venn diagram was generated to show an overlap of mapped DEGs from R848 treatment (set orange) and CpG-B (set blue) treatment between CD19cre-p75fl/fl mice and the control group. Sets orange and blue share an intersecting set of 113 genes.
(F) Heatmap showing the expression patterns of the DEGs between CD19cre-p75fl/fl mice and the control group with CpG-B and R848 treatment.
(G–L) Quantitative PCR validation of RNA-seq-identified genes (Tbx21, Zbp1, Cd11c) in splenic B cells from CD19cre-p75fl/fl vs. control mice after CpG-B or R848 treatment. Horizontal bars represent the mean ± SEM of at least three independent experiments. Statistical analyses were performed using unpaired two-tailed Student’s t tests.
Despite differences between the two ligands, 113 DEGs were shared across both datasets (Figure 4E), suggesting common transcriptional regulations by p75NTR following TLR7 and TLR9 stimulation. Notably, Tbx21, a key driver in the development of CD21lo B cells, showed elevated expression in p75NTR-deficient B cells (Figure 4F). CD21lo B cells are tissue-homing, innate-like B cells with potential for differentiation into antibody-secreting cells. Among the co-DEGs were genes associated with B cell receptor activity (Aicda), antibody production (Jchain), and proinflammatory responses (Zbp1, Ifng, Il21b, Tgtp1) (Figure 4F). These transcriptional changes indicate that p75NTR deficiency enhances B cell activity and proinflammatory responses under TLR challenges. The increased expression of Tbx21, Zbp1, and Cd11c—typically elevated in CD21lo B cells—were validated in p75NTR-deficient B cells upon TLR7/9 stimulation by qPCR (Figures 4G–4L). Therefore, our findings highlight the role of p75NTR in modulating CD21lo B cell expansion in response to immune challenges from DNA or RNA strands.
Upregulation of p75NTR in B cells restrained the expansion of CD21lo B cell subsets in mice upon pristine treatment
To confirm our in vitro results, we immunized mice with pristane, which induces a robust autoimmune-like response and activates TLR signaling in B cells. In pristane-treated mice, both the proportion of p75NTR+ cells and the MFI of p75NTR in splenic B cells were significantly higher compared to control mice (Figures 5A–5E). Western blot analysis also showed markedly increased p75NTR protein levels in the splenic lymphocytes of pristane-treated mice (Figures 5F and 5G). Additionally, immunohistochemistry and immunofluorescence demonstrated that p75NTR+ cells were upregulated and co-localized with B220+ splenic B cells in pristane-treated mice (Figures 5H and 5I). Importantly, pristane treatment led to an increase in the proportion of CD21lo B cells in the spleen. In mice with B cell-specific p75NTR deficiency, this increase was greater, along with a decrease in CD21 MFI in splenic B cells (Figures 5J–5M). These results further support the role of p75NTR in regulating CD21lo B cell expansion under autoimmune-like conditions.
Figure 5.
Upregulation of p75NTR in B cells regulates CD21lo B cells in pristane-treated mice
(A) Spleens were collected from mice at 3 months or 4 months after pristane injection.
(B and C) Flow cytometry plots (left) and statistical analysis (right) show the percentage of p75NTR+ B cells in mice after pristane immunization.
(D and E) Flow cytometry plots (left) and statistical analysis (right) show p75NTR MFI in B220+ B cells in mice after pristane immunization.
(F and G) Representative western blot images (left) and statistical analysis of the gray value (right) showing p75NTR expression in splenic lymphocytes from pristane-immunized mice and their corresponding controls.
(H–I) Immunohistochemistry (left) and immunofluorescence (right) staining were performed in splenic sections from pristane-injected mice and their controls. Scale bar = 20 μm.
(J–M) Representative flow cytometry diagrams and statistical analysis of CD21lo B cells and CD21 MFI in B cells in CD19cre-p75fl/fl mice and the control group after pristane immunization. Horizontal bars represent the mean ± SEM of at least three independent experiments. Data were analyzed by one-way ANOVA (Figures 5G–5K and 5M) or unpaired t-tests (Figures 5C–5E).
Upregulation of CD21lo-related transcriptomes in B cells lacking p75NTR in mice challenged with pristane
Correspondingly, we analyzed the transcriptomic differences in B cells lacking p75NTR in mice 4 months following pristane challenges. As shown, there were 659 DEGs in B cells between CD19cre-p75fl/fl mice and the controls after being immunized with pristane, among which 515 genes were upregulated and 114 genes were downregulated (Figures 6A and 6B). In the DEGs, we found that Cd19, Cr2, and Ngfr expression decreased. The expression of Tbx21 and Itgax (Cd11c), which were highly expressed in the CD21lo B cell subtype were increased (Figure 6C). Chord workflow of KEGG enrichment revealed pathways involved in hematopoietic cell lineage, cytokine-cytokine receptor interaction, Th1 and Th2 cell differentiation, complement and coagulation cascades, and so on (Figure 6D). Gene ontology (GO) analysis indicated that the gene differences were enriched in immune system process, inflammatory response, and positive regulation of T cell proliferation, etc (Figure 6E). Concordant with this finding, GSEA showed inhibition of the B cell receptor signaling pathway and activation of the complement and coagulation cascades in splenic B cells in CD19cre-p75fl/fl mice immunized with pristane when compared to control littermate (Figures 6F and 6G).
Figure 6.
Upregulation of CD21lo-related transcriptomes in B cells lacking p75NTR in mice challenged with pristane
(A) Heatmap depicting differentially expressed transcripts in splenic B cells between CD19cre-p75fl/fl mice and controls with pristane injection. Red indicates increased relative expression, and blue indicates decreased relative expression.
(B) Statistical chart of DEGs.
(C) The volcano plot shows differentially expressed genes. The red and green dots indicate upregulated and downregulated DEGs, respectively, with p-value <0.05.
(D) Chord plot depicting the relationship between DEGs and KEGG pathways in splenic B cells in mice with pristane injection.
(E) GO enrichment analysis of DEGs.
(F and G) Enrichment plot from the B cell receptor signaling pathway and complement and coagulation upon GSEA with the DEGs obtained from the RNA-seq analysis in B220+ B cells.
Finally, we used GeneMANIA to investigate the potential co-expression, genetic interactions, and pathways involving Ngfr downstream and Tbx21, aiming to explore the possible downstream signals responsible for p75NTR-induced expansion of CD21lo B cell subsets. The gene set uploaded for analysis included Nfkb1, Rela, Mapk1, Traf6, Ngfr, and Tbx21, with the first three genes being well-established in pathways related to p75NTR activity. As expected, the network revealed strong physical interactions, co-expression, and pathway involvement among Ngfr, Rela, Nfkb1, Mapk1, and Traf6. Notably, co-expression and predicted interactions were observed between Rela and Tbx21, suggesting a potential functional relationship (Figure 7A). Several previous studies have reported the regulatory role of p-p65 in driving Tbx21 activity in T cells.35 To further explore this, we examined downstream signaling changes in B cells following stimulation with TLR7/9. Stimulation with CpG-B and R848 significantly elevated the activity of p-p65, p-Erk, and Traf6 in B cells (Figure S5). In comparison to controls, p75NTR knockout in B cells resulted in further upregulation of p-p65 and p-Erk, but not Traf6, when challenged with immune activation (Figures 7B–7E). Similarly, the pristane challenge led to increased levels of p-p65 and p-Erk in splenic B cells of CD19cre-p75fl/fl mice (Figures 7F–7H), with no significant differences in Traf6 expression (Figure 7I). These results suggest that p-p65 may play a role in p75NTR-induced expansion of CD21lo B cell subsets during TLR-mediated immune challenges.
Figure 7.
Deficiency of p75NTR in B cells resulted in further elevation of phosphorylated-p65 and phosphorylated-Erk in splenic B cells following pristane challenge
(A) A network diagram generated using GeneMANIA illustrates the protein and genetic interactions, pathways, and co-expression patterns involving Ngfr downstream and Tbx21.
(B–E) The expression levels of p65, phosphorylated p65 (p-p65), Erk, phosphorylated ErK (p-Erk), traf6, and β-actin were analyzed in CD19cre-p75fl/fl mice and control groups following CpG-B and R848 treatment for 24 h.
(F–I) The expression of p65, p-p65, Erk, p-Erk, traf6, and β-actin was also evaluated in CD19cre-p75fl/fl mice and control groups after pristane challenge. Horizontal bars represent the mean ± SEM of at least three independent experiments. Statistical analyses were performed using unpaired two-tailed Student’s t tests.
Discussion
B cells play a pivotal role in the modulation of immune responses. In this study, we demonstrated that murine B cells express low levels of p75NTR in a steady state, but show upregulated expression following TLR stimulation in vitro and pristane immunization in vivo. Notably, we identified that the specific knockout of p75NTR in B cells elevated the loss of CD21 expression, thereby increasing the proportion of a recently identified CD21lo population of B cell subsets under autoimmune-like challenges. Transcriptomic analysis revealed a parallel elevation of CD21lo-driven transcriptomes, including Tbx21, and related enrichment of proinflammatory, antigen-presenting, and immune crosstalk pathways. Therefore, our study proposes that increased expression of p75NTR in B cells restrains the development of CD21lo subsets of B cells when facing immune challenges.
Despite the fact that p75NTR belongs to the tumor necrosis factor receptor superfamily (TNFRSF), it performs multiple biological functions not shared with other TNFR members. Predominantly, it serves as a receptor for neurotrophic factors, usually by binding to nerve growth factor (NGF) or proBDNF, regulating neuronal apoptosis and pruning.36,37,38 Besides its well-documented role in the nervous system, researchers have demonstrated the expression and role of p75NTR in immune systems, particularly in plasmacytoid dendritic cells (pDCs). Bandola et al. reported that p75NTR is expressed in pDCs after TLR9 activation and modulates the disease progression of asthma in an interferon regulatory factor 3 and 7 dependent pathway.11 Additionally, p75NTR expression increases in innate immune cells during neuronal infection,39 and knockout of p75NTR mitigates neuroinflammation damage.7 Similar p75NTR expression in myeloid cells has also been proven.40,41 A recent study using Ngfr full-knockout mice showed that loss of Ngfr leads to spontaneous activation of follicular dendritic cells, upregulation of B-cell activation markers, generation of autoreactive clones, and increased autoantibody production.16
Our team has explored the immune regulatory role of p75NTR, supporting its expression in not only monocytes/macrophages13,42 but also in B and T lymphocytes.15,43 We recently identified that the precursor of brain-derived neurotrophic factor elevated in antibody-secreting B cell subsets drives the development of systemic lupus erythematosus in a p75NTR-dependent manner,15 highlighting an immune-modulating role of proBDNF-p75NTR signaling in B cells. In this manuscript, we further identified a close relationship between the elevation of p75NTR in response to autoimmune-like challenges and the suppression of CD21 expression in B lymphocytes. Thus, our findings extend and validate the potential role of p75NTR in B lymphocytes in immune regulation.
Although the definition of CD21lo B cells remains unclear, these cells have garnered particular interest in recent years due to their increased frequency with age and during chronic infections and autoimmune inflammatory conditions.22,28,44,45 While much attention has been given to understanding the characteristics of these transitional B cell subsets, studies on their regulation are limited. CD21lo B cells are mature B cells, as evidenced by their lack of CD93. They are positive for both B220 and CD19 but lack canonical follicular, marginal zone, or B1 B-cell markers CD23, CD21, and CD43, respectively. CD21lo B cells express exceptionally high levels of co-stimulatory molecules such as CD80 and CD8634 and the type I transmembrane protein CD11c, which is highly expressed in some myeloid cells.24 These cells are characterized by a T-bet-driven transcriptional program, robust responsiveness to TLR7 and TLR9 ligands, and a propensity for IgG2a/c production.23,46 Additionally, CD21lo B cells can transform into long-lived plasma cells by activating the Blimp-1 program and expressing plasma cell markers.19
In the present study, we reported a link between increased p75NTR expression and the development of CD21lo B cell subsets induced by autoimmune signals. It has been reported that B cell activation induces CD21 shedding.47 Our results align with these previous findings, indicating that CD21 expression is downregulated after both TLR7 and TLR9 activation in vitro as well as pristane stimulation in vivo. Under these conditions, p75NTR expression was significantly induced in B cells, while p75NTR knockdown further promoted the population of CD21lo subsets. The upregulation of CD21lo B cell-driven genes, including Tbx21 and Itgax, and alterations in related signaling pathways in p75NTR-deficient B cells from RNA-seq data support a regulatory role for p75NTR in CD21 expression in B lymphocytes. Upon TLR engagement, p75NTR expression increases and acts to dampen downstream proliferative signals—potentially by attenuating NF-κB and/or ErK pathway activity—to prevent excessive expansion of CD21lo B cells and uncontrolled inflammation. In the p75NTR-knockout setting, this control is lost, so TLR signals drive even greater CD21lo B-cell proliferation. Thus, TLR-induced p75NTR serves to limit CD21lo expansion, reconciling our observations of both inducible up-regulation and enhanced proliferation in the absence of p75NTR. This evidence indicates an intrinsic p75NTR-dependent inhibitory pathway that suppresses the overproduction of CD21lo subsets in B cells facing immune disorders, especially those related to TLR signals. Hence, our findings contribute to an understanding of the intricate molecular mechanisms associated with p75NTR in regulating B cell development amidst immune dysregulations.
Multiple functional downstream pathways are involved in p75NTR’s function, which vary by cell type and disease. Of these, NRAGE, NADE, and NRIF have been associated with the induction of apoptosis, while FAP-1, RIP2, and TRAF6 appear to promote cellular survival.11 A recent gene network interaction analysis identified 10 highly interconnected genes with p75NTR: Stat1, Stat3, Sp1, Jun, Egfr, Traf6, Jak2, Nras, Tp53, and Mdm2.48 Therefore, identifying the signaling cascades activated by p75NTR is complex and challenging, especially when linking various p75NTR binding proteins to specific p75NTR-dependent functions. In our present study, we observed increased expression of p-p65, p-ErK, and Traf6 in B cells after TLR stimulation in vitro. The deficiency of p75NTR further elevated the expression of p-p65 and p-ErK but not Traf6. This implies that activation of p75NTR in B cells may modulate the CD21lo B cell subpopulation through downstream signals involving p-p65 and p-ErK. A report from Bandoła et al. studying pDCs indicated that the deficiency of p75NTR resulted in lower levels of phosphorylation of IRF3, IRF7, IKKα/β, and c-Jun, but not MyD88, IRAK4, TRAF6, PI3K, etc., when compared to control.11 Thus, it is possible that TRAF6 is not crucial for the immune regulatory role of p75NTR. However, we must acknowledge that the crucial question remains unanswered: the precise mechanism by which p75NTR signaling limits the accumulation of CD21lo subsets and B cell hyperactivation under immune disorder conditions remains unanswered.
Additionally, different ligands activate different downstream pathways of p75NTR. The high-affinity ligand for p75NTR is proBDNF, but mature BDNF also binds to it and elicits biological functions. Neurotrophic factors and their receptors are differentially expressed throughout B lymphocyte development, such as in human-activated B cells, memory B cells, and mouse spleen and bone marrow B cells.49 In our previous study, we found that immune cells, including myeloid cells and lymphocytes, have the potential to secrete proBDNF and modulate immune responses. Hence, it will be interesting to further investigate whether proBDNF from immune cells acts as an autocrine or paracrine regulatory mechanism involved in regulating p75NTR in CD21lo B cell subsets. Given the high affinity of proBDNF in enhancing p75NTR signaling, strategies that modulate proBDNF levels or enhance its interaction with p75NTR may represent promising avenues for intervention. Such approaches—including the administration of exogenous protease-resistant proBDNF or small molecules that promote p75NTR activation—could help restore immune homeostasis in patients with dysregulated B cell responses.
In summary, the central finding of our present study provides evidence that the functional expression of p75NTR by B cells plays a critical role in restraining CD21lo B cell subsets within the context of autoimmune pathology. The absence of p75NTR in B cells led to an increased ratio of CD21lo B cell subsets, accompanied by overactivation of these cells and significant changes in their transcriptomic profile. Our results provide insights into the role of p75NTR in the regulation of B cell activation and function and in preserving immune homeostasis amidst disorders.
Limitations of the study
There are several limitations in the present study. While our study primarily focused on the CD21lo B cell subset due to its established relevance in autoimmune responses, we acknowledge that p75NTR deficiency may have broader effects on other B cell populations. A detailed characterization of additional B cell subsets was not performed in this study and remains an important avenue for future investigation. In addition, we acknowledge that we did not assess downstream autoimmune parameters such as autoantibody levels, inflammatory cytokine profiles, or kidney pathology in the pristane-induced lupus model. These represent important limitations of the current study. Future investigations will determine whether the expansion of CD21lo B cells in the absence of p75NTR contributes functionally to autoimmune disease progression. Furthermore, although our findings suggest that p75NTR modulates TLR7/9-driven responses in B cells, the downstream signaling mechanisms remain incompletely defined. Future studies using pharmacological inhibitors and genetic perturbations of key signaling intermediates will be essential to establish a direct mechanistic link.
Resource availability
Lead contact
All requests for reagents and resources should be directed to the lead contact, Ru-Ping Dai (xyeyyrupingdai@csu.edu.cn).
Materials availability
This study did not generate new unique reagents.
Data and code availability
RNA-sequencing data of this work have been deposited at Sequence Read Archive (SRA) data repository and are publicly available as of the date of publication. Accession numbers (SRA: PRJNA1182849) are listed in the key resources table. This paper does not report original code. Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.
Acknowledgments
This study was supported by the National Natural Science Foundation of China (NSFC 82371292 to RD, 82101285 to CL, 82102284 to WS, 82271379 to ZH), Science and Technology Innovation Program of Hunan Province (2021RC4015 to RD), Science Foundation of Hunan province for Distinguished Young Scholars (2023JJ10088 to ZLH) and the Fundamental Research Funds for the Central Universities of Central South University (2023XQLH146 to AHZ).
Author contributions
Conceptualization: C.L., W.-Y.S., and R.-P.D.; methodology: C.L., A.-H.Z., W.-Y.S., R.-Y.L., and R.-P.D.; investigation: C.L., A.-H.Z., and W.Y.S.; writing – original draft: C.L., A.-H.Z., W.-Y.S.; writing – review and editing: C.L., A.-H.Z., W.-Y.S., R.-Y.L., Z.-L.H., and R.-P.D.; funding acquisition: C.L., W.-Y.S., and R.P.D.; and supervision: C.L., W.-Y.S., Z.-L.H., and R.-P.D.
Declaration of interests
The authors declare no competing interests.
STAR★Methods
Key resources table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| PerCP/Cyanine5.5 anti-mouse CD45 | Biolegend | Cat# 157208; RRID:AB_2860728 |
| APC anti-mouse/human CD45R/B220 | Biolegend | Cat# 103212; RRID:AB_312997 |
| PE anti-mouse CD21/CD35 (CR2/CR1) | Biolegend | Cat# 123409; RRID:AB_940411 |
| FITC anti-mouse CD21/CD35(CR2/CR1) | Biolegend | Cat# 123407; RRID:AB_940403 |
| APC/Cyanine7 anti-mouse CD23 | Biolegend | Cat# 101630; RRID:AB_2571987 |
| PE-anti-human/mouse CD271 | Thermo Fisher | Cat# 12-9400-41; RRID:AB_2572709 |
| FITC-anti-mouse CD86 | Biolegend | Cat# 159220; RRID:AB_3106043 |
| BV421-anti-mouse CD3 | BD | Cat# 740014; RRID:AB_2739786 |
| PE/Cyanine7 anti-mouse/human CD44 | Biolegend | Cat# 103030; RRID:AB_830787 |
| p75NTR Rabbit mAb | CST | Cat# 8238; RRID:AB_10839265 |
| TRAF6 Rabbit mAb | CST | Cat# 8028; RRID:AB_10858223 |
| Sortilin Polyclonal antibody | Proteintech | Cat# 12369-1-AP |
| NF-κB p65 Rabbit mAb | CST | Cat# 8242; RRID:AB_10859369 |
| Phospho-NF-κB p65 Rabbit mAb | CST | Cat# 3033; RRID:AB_331284 |
| p44/42 MAPK (Erk1/2) Rabbit mAb | CST | Cat# 4695; RRID:AB_390779 |
| Phospho-p44/42 MAPK (Erk1/2) Rabbit mAb | CST | Cat# 4370; RRID:AB_2315112 |
| HRP-Conjugated Beta Actin Monoclonal Antibody | Proteintech | Cat# HRP-60008 |
| GAPDH Polyclonal antibody | Proteintech | Cat# 10494-1-AP |
| HRP-conjugated Goat Anti-Mouse IgG(H + L) | Proteintech | Cat# SA00001-1 |
| HRP-conjugated Goat Anti-Rabbit IgG(H + L) | Proteintech | Cat# SA00001-2 |
| Biotin-conjugated Goat Anti-Rabbit IgG(H + L) | Proteintech | Cat# SA00004-2 |
| Chemicals, peptides, and recombinant proteins | ||
| CD45R(B220) microbeads, mouse | MiltenyiBiotec | Cat# 130-049-501 |
| Pristane | Sigma-Aldrich | Cat# P2870 |
| CpG-B (ODN 1826) | InvivoGen | Cat# tlrl-1826 |
| R848 | InvivoGen | Cat# tlrl-r848 |
| Fixation buffer | Invitrogen | Cat# 00-8222-49 |
| Compensation Beads | Invitrogen | Cat# 01-3333-42 |
| Red cells lysis buffer | Biosharp | Cat# BL503B |
| Tween 20 | Biosharp | Cat# BS100 |
| Triton X-100 | Biosharp | Cat# BS084 |
| 1X PBS (without Ca2+) | Biosharp | Cat# BL302A |
| Ficoll | GE Health | Cat# 17-1440-02 |
| DMEM basic (1X) | Gibco | Cat# C11995500BT |
| Fetal bovine serum | Gibco | Cat# 10091-148 |
| Streptomycin/penicillin | Gibco | Cat# 15140-12 |
| L-Glutamine | Gibco | Cat# A2916801 |
| TRIzol | Ambion | Cat# 15596076 |
| SYBR qPCR SuperMix | Novoprotein | Cat# E096 |
| SDS-PAGE | Epizyme | Cat# PG112 |
| RIPA lysis buffer | Beyotime | Cat# P0013C |
| 5X SDS-PAGE Sample Loading Buffer | Beyotime | Cat# P0015 |
| PageRuler Prestained Protein ladder | Thermo Fisher | Cat# 26616 |
| DAPI | Southern Biotech | Cat# 0100-20 |
| 1X TAE | Tsingke | Cat# TSG001 |
| 100 bp DNA Ladder | Tsingke | Cat# TSJ100-100 |
| Agarose | Tsingke | Cat# TSJ001 |
| Immobilon ECL Ultra Western HRP | Millipore | Cat# WBULS0100 |
| Critical commercial assays | ||
| BCA Protein Assay Kit | Bioss | Cat# C05-02001 |
| LEGENDplex™ Carboxyl Beads A4 | Biolegend | Cat# 740167 |
| DAB color development kit | ZSBIO | Cat# ZLI-9019 |
| ABC HRP Kit | Vector Labs | Cat# PK-6100 |
| RevertAid First Strand cDNA Synthesis Kit | Thermo | Cat# K1622 |
| Zombie NIR™ Fixable Viability Kit | Biolegend | Cat# 423105 |
| Deposited data | ||
| Mice splenic B cells RNA-sequencing data | This paper | SRA: PRJNA1182849 |
| Experimental models: Cell lines | ||
| Mice: splenic lymphocytes | N/A | N/A |
| Mice: splenic B cells | N/A | N/A |
| Experimental models: Organisms/strains | ||
| C57BL6/J | Hunan Silaikejingda Experimental Animal | N/A |
| P75fl/fl mice | Beijing Viewsolid Biotech | N/A |
| CD19-Cre | Beijing Viewsolid Biotech | N/A |
| Software and algorithms | ||
| PRISM | GraphPad | Version 10 |
| Flow Jo | Flowjo | Version 10 |
| ImageJ | Rawak Software | https://imagej.nih.gov/ij/ |
| Other | ||
| BD Trucount tubes | BD | Cat# 340334 |
| PVDF transfer membranes | MerckMillipore | Cat# ISEQ00010 |
| 70 μm-mesh Nylon cell strainer | Biosharp | Cat# BS-70-CS |
Experimental model and study participant details
Mice
P75fl/fl mice (on C57BL/6J background), provided by Beijing Viewsolid Biotech Co. Ltd, were generated using loxP system targeting exon 3 of the Ngfr gene. The p75fl/fl mice were crossed with CD19-Cre transgenic mice (B6 genetic background, Beijing Viewsolid Biotech Co. Ltd) to create CD19cre-p75fl/fl and wild-type (p75fl/fl) mice. C57BL/6J mice were purchased from SLAC Laboratory Animal Co. Ltd. All mice were housed in individually ventilated cages in a specific pathogen-free environment and under standard conditions (20°C–26°C, 40–60% humidity, 12:12 h light-dark cycle) with ad libitum access to food and water at Central South University Animal Services (Changsha, China). Animal procedures were approved by the Animal Research Ethics Committee of Xiangya Hospital, Central South University (no. 2020147, Changsha, China) and conformed to the National Institutes of Health Guide for the Care and Use of Laboratory Animals. The pristane-induced lupus model utilized 6-week-old female mice. All cellular experiments were performed using adult mice (8–12 weeks old) without sex restriction.
Primary cell cultures
B220+ splenocytes were magnetically isolated from the spleens of 8–12 week old C57BL/6J mice, or from CD19cre-p75fl/fl mice and CD19-p75fl/fl littermate controls. Isolated cells were resuspended in DMDM complete medium (10% fetal bovine serum, 1% streptomycin/penicillin) in 37°C and 5% CO2.
Method details
Pristane immunization
A pristane-immunized mouse model was induced by injecting 0.5 mL of pristane intraperitoneally (i.p.) into 6-week-old female mice; PBS i.p. injection was used as a control. Eighteen and twenty-two weeks post-immunization, the mice were sacrificed for further experiments.
Western blot
For protein extraction, tissues, and cells were lysed on ice using RIPA buffer supplemented with a protease inhibitor and phosphatase inhibitor cocktail. Protein concentration of lysates was determined using the BCA Protein Assay Kit according to the manufacturer’s instructions. Cell lysates were boiled for 8 min at 100°C with SDS, and subjected to 10% SDS–PAGE, and then transferred to PVDF membranes. After blotting, the membrane was blocked in 5% non-fat dry milk diluted in TBS-tween (TBST 0.5%) for 1 h to prevent unspecific antibody binding. Then, the membrane was incubated with anti-p75NTR (1:1000), anti-Traf6 (1:1000), anti-p65 (1:1000), anti-p-p65 (1:1000), anti-Erk (1:1000), anti-p-Erk (1:1000), anti-β-actin (1:5000), or anti-GAPDH (1:5000) overnight at 4°C. Subsequently, the membrane was thoroughly washed and incubated with the horseradish peroxidase (HRP)-conjugated secondary antibody specific to the species of the primary antibodies (1:5000) in 5% dry milk. ECL substrate was used for the development. Protein bands were visualized with the western blotting detection system (CLINX, Shanghai, China). Gray value analysis was done by ImageJ (v.1.50g, NIH) software.
Cell isolation and in vitro culture
The spleen was collected to prepare a single-cell suspension for the isolation of mice splenic B cells. Splenic lymphocytes were isolated through Ficoll density gradient centrifugation. Cells were then washed and resuspended in PBS. According to the manufacturer’s instructions, B220+ B cells were isolated from splenic lymphocytes using mouse CD45R(B220) microbeads. The purity of enriched B220+ B cells was determined by flow cytometry and was higher than 95%. Cells were cultured in complete Dulbecco’s modified Eagle’s medium with 10% fetal bovine serum, 1% streptomycin/penicillin in 96-well round-bottom plates in which each well contained 3 × 106 cells in 200 μL of medium at 37°C in a humidified atmosphere of 20% O2 and 5% CO2. The cells were stimulated with R848 (200 ng/mL) or CpG-B (0.25 μmol) for activation. After 24 h, the cells were collected for flow cytometry, immunofluorescence, quantitative PCR and RNA-seq analysis.
Flow cytometry
To determine B cell subsets and p75NTR expression, splenic lymphocytes or cultured cells were harvested and washed with phosphate-buffered saline (PBS). Cells were then incubated with fixable viability dyes for 10 min at room temperature. Then cells were washed with PBS (containing 1% BSA), and then stained with antibodies against different cell surface markers by incubation for 30 min at 4°C. Stained cells were washed and then read on a flow cytometer (Cytek, Fremont, California, USA). Data were analyzed using FlowJo V.10.4 software.
Cytometric bead-based immunoassays of multiple soluble analytes
Culture supernatants were collected and stored at −80°C for further detection. Cytokine levels were measured using a LEGENDplex multianalyte flow assay kit according to the manufacturer’s protocol, and the concentration of cytokines was determined by using LEGENDplex software (BioLegend).
Tissue immunohistochemistry and immunofluorescence
Spleens were fixed in 4% paraformaldehyde, and sectioned (4 μm) for immunohistochemical (IHC) analysis. Sections were deparaffinized in xylene and then rehydrated with graded alcohols. Antigen retrieval was done by microwave boiling in 10 mM citrate buffer for 20 min. Endogenous peroxidase was blocked using 3% H2O2 in methanol for 15 min. The slides were then washed with PBS and blocked using 10% BSA with 0.5% Triton X-100 in PBS for 1 h. The sections were incubated with rabbit anti-p75NTR antibody (1:500) at 4°C overnight, followed by incubation with biotin goat anti-Rabbit IgG (H + L) for 1 h. The slides were washed three times in PBS and incubated with the ABC HRP Kit. Staining was developed using DAB staining. The sections were dehydrated with increasing grades of alcohol and xylene, and then sealed with neutral resin. For immunofluorescence (IFC) staining, slides were incubated with rat anti-CD45R antibody (1:500) and rabbit anti-p75NTR antibody (1:500) at 4°C overnight, followed by incubation with Alexa Fluor 647 Donkey anti-Rat IgG and Alexa Fluor 488 goat anti-Rabbit IgG (H + L) for 1 h. After rinsing, slides were further stained with 4′,6-diamidino-2-phenylindole (DAPI). Images were collected by a scanning microscope (Pannoramic DESK, P-MIDI, P250, P1000) and analyzed using Case Viewer software.
Cell immunofluorescence
To assess the expression of p75NTR on B cells, 1×105 splenic B cells were collected after R848 (200 ng/mL), CpG-B (0.25 μmol), or PBS control treatment, and fixed in 4% paraformaldehyde at room temperature for 10 min. Subsequently, the cells were washed with PBS and blocked using 5% BSA with 0.3% Triton X-100 in PBS for 30 min. The sections were then incubated with rabbit anti-p75NTR antibody (1:1600) at room temperature for 2 h, followed by incubation with Alexa Fluor 488 goat anti-Rabbit IgG (H + L) for 1 h. The cell suspension was transferred onto an adhesive slide and allowed to dry before being further stained with DAPI. Images were collected by a scanning microscope (Pannoramic DESK, P-MIDI, P250, P1000).
RNA-seq analysis
Total RNA of splenic B cells from cell culture and mice was extracted with TRIzol, and subjected to RNA-seq analysis. RNA-seq was performed by OE (Shanghai, China) Biotechnology using the Illumina NovaSeq 6000 platform. Raw reads of fastq format were first processed through in-house perl scripts, and all the downstream analyses were based on clean data of high quality. Transcripts with a P-adjust <0.05 and fold change≥2 were assigned as differentially expressed.
Quantitative PCR
Total RNA from splenic B cells was extracted with TRIzol reagent and was reverse transcribed using revertAid first-strand complementary DNA (cDNA) synthesis kits. Diluted cDNAs were used as templates for qPCR with Fast SYBR Green Master Mix in the CFX96 Touch Deep-Well Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). The primer sequences used are shown in the Table below.
| Gene | Forword Primer (5′-3′) | Reverse Primer (3′-5′) |
|---|---|---|
| Tbx21 | TCAACCAGCACCAGACAGAG | AAACATCCTGTAATGGCTTGTG |
| Zbp1 | GACGACAGCCAAAGAAGTGA | GAGCTATGTCTTGGCCTTCC |
| Ifng | CGGCACAGTCATTGAAAGCCTA | GTTGCTGATGGCCTGATTGTC |
| Il12b | TGGTTTGCCATCGTTTTGCTG | ACAGGTGAGGTTCACTGTTTCT |
| Tgtp1 | TGGGACCACTAACTTCACACC | GGCCAGTTGTGCATCATTTTC |
| Aicda | GCCACCTTCGCAACAAGTCT | CCGGGCACAGTCATAGCAC |
| Jchain | TGACGACGAAGCGACCATTC | TTCAAAGGGACAACAATTCGGA |
| Egln3 | AGGCAATGGTGGCTTGCTATC | GCGTCCCAATTCTTATTCAGGT |
| Gapdh | TGTGTCCGTCGTGGATCTGA | TTGCTGTTGAAGTCGCAGGAG |
Quantification and statistical analysis
The significance of the differences between more than two groups was evaluated using ANOVA followed by Sidak’s multiple comparison test. Comparisons between two conditions were analyzed by unpaired 2-tailed Student’s t test. Statistical analyses were performed with Prism software (GraphPad). All data are presented as the mean ± SEM. p < 0.05 was considered significant. The statistical details of experiments can be found in the figure legends.
Published: July 3, 2025
Footnotes
Supplemental information can be found online at https://doi.org/10.1016/j.isci.2025.113055.
Contributor Information
Wei-Yun Shen, Email: swy13875978211@csu.edu.cn.
Ru-Ping Dai, Email: xyeyyrupingdai@csu.edu.cn.
Supplemental information
References
- 1.Dechant G., Barde Y.-A. The neurotrophin receptor p75NTR: novel functions and implications for diseases of the nervous system. Nat. Neurosci. 2002;5:1131–1136. doi: 10.1038/nn1102-1131. [DOI] [PubMed] [Google Scholar]
- 2.Johnson D., Lanahan A., Buck C.R., Sehgal A., Morgan C., Mercer E., Bothwell M., Chao M. Expression and structure of the human NGF receptor. Cell. 1986;47:545–554. doi: 10.1016/0092-8674(86)90619-7. [DOI] [PubMed] [Google Scholar]
- 3.He X.L., Garcia K.C. Structure of Nerve Growth Factor Complexed with the Shared Neurotrophin Receptor p75. Science. 2004;304:870–875. doi: 10.1126/science.1095190. [DOI] [PubMed] [Google Scholar]
- 4.Lee R., Kermani P., Teng K.K., Hempstead B.L. Regulation of cell survival by secreted proneurotrophins. Science. 2001;294:1945–1948. doi: 10.1126/science.1065057. [DOI] [PubMed] [Google Scholar]
- 5.Underwood C.K., Coulson E.J. The p75 neurotrophin receptor. Int. J. Biochem. Cell Biol. 2008;40:1664–1668. doi: 10.1016/j.biocel.2007.06.010. [DOI] [PubMed] [Google Scholar]
- 6.Feng D., Kim T., Ozkan E., Light M., Torkin R., Teng K.K., Hempstead B.L., Garcia K.C. Molecular and structural insight into proNGF engagement of p75NTR and sortilin. J. Mol. Biol. 2010;396:967–984. doi: 10.1016/j.jmb.2009.12.030. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Düsedau H.P., Kleveman J., Figueiredo C.A., Biswas A., Steffen J., Kliche S., Haak S., Zagrebelsky M., Korte M., Dunay I.R. p75NTR regulates brain mononuclear cell function and neuronal structure in Toxoplasma infection-induced neuroinflammation. Glia. 2019;67:193–211. doi: 10.1002/glia.23553. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Capsoni S., Malerba F., Carucci N.M., Rizzi C., Criscuolo C., Origlia N., Calvello M., Viegi A., Meli G., Cattaneo A. The chemokine CXCL12 mediates the anti-amyloidogenic action of painless human nerve growth factor. Brain. 2017;140:201–217. doi: 10.1093/brain/aww271. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Dourson A.J., Fadaka A.O., Warshak A.M., Paranjpe A., Weinhaus B., Queme L.F., Hofmann M.C., Evans H.M., Donmez O.A., Forney C., et al. Macrophage memories of early-life injury drive neonatal nociceptive priming. Cell Rep. 2024;43 doi: 10.1016/j.celrep.2024.114129. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Fu D., Gao S., Li J.N., Cui Y.H., Luo Y.W., Zhong Y.J., Li Q., Luo C., Dai R.P., Luo R.Y., Hu Z.L. P75NTR+CD64+ neutrophils promote sepsis-induced acute lung injury. Clin. Immunol. 2024;263 doi: 10.1016/j.clim.2024.110206. [DOI] [PubMed] [Google Scholar]
- 11.Bandoła J., Richter C., Ryser M., Jamal A., Ashton M.P., von Bonin M., Kuhn M., Dorschner B., Alexopoulou D., Navratiel K., et al. Neurotrophin Receptor p75NTR Regulates Immune Function of Plasmacytoid Dendritic Cells. Front. Immunol. 2017;8:981. doi: 10.3389/fimmu.2017.00981. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Hu Z.-L., Luo C., Hurtado P.R., Li H., Wang S., Hu B., Xu J.M., Liu Y., Feng S.Q., Hurtado-Perez E., et al. Brain-derived neurotrophic factor precursor in the immune system is a novel target for treating multiple sclerosis. Theranostics. 2021;11:715–730. doi: 10.7150/thno.51390. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Shen W.Y., Luo C., Reinaldo Hurtado P., Hurtado-Perez E., Luo R.Y., Hu Z.L., Li H., Xu J.M., Zhou X.F., Dai R.P. The regulatory role of ProBDNF in monocyte function: Implications in Stanford type-A aortic dissection disease. FASEB j. 2020;34:2541–2553. doi: 10.1096/fj.201901905RR. [DOI] [PubMed] [Google Scholar]
- 14.Li J.N., Luo R.Y., Luo C., Hu Z.L., Zha A.H., Shen W.Y., Li Q., Li H., Fu D., Dai R.P. Brain-Derived Neurotrophic Factor Precursor Contributes to a Proinflammatory Program in Monocytes/Macrophages After Acute Myocardial Infarction. JAHA. 2023;12 doi: 10.1161/JAHA.122.028198. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Shen W.-Y., Luo C., Hurtado P.R., Liu X.J., Luo R.Y., Li H., Hu Z.L., Xu J.M., Coulson E.J., Zhao M., et al. Up-regulation of proBDNF/p75NTR signaling in antibody-secreting cells drives systemic lupus erythematosus. Sci. Adv. 2022;8 doi: 10.1126/sciadv.abj2797. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Hernández-Barranco A., Santos V., Mazariegos M.S., Caleiras E., Nogués L., Mourcin F., Léonard S., Oblet C., Genebrier S., Rossille D., et al. NGFR regulates stromal cell activation in germinal centers. Cell Rep. 2024;43 doi: 10.1016/j.celrep.2024.113705. [DOI] [PubMed] [Google Scholar]
- 17.Portugal S., Obeng-Adjei N., Moir S., Crompton P.D., Pierce S.K. Atypical memory B cells in human chronic infectious diseases: An interim report. Cell. Immunol. 2017;321:18–25. doi: 10.1016/j.cellimm.2017.07.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Knox J.J., Kaplan D.E., Betts M.R. T-bet-expressing B cells during HIV and HCV infections. Cell. Immunol. 2017;321:26–34. doi: 10.1016/j.cellimm.2017.04.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Lau D., Lan L.Y.L., Andrews S.F., Henry C., Rojas K.T., Neu K.E., Huang M., Huang Y., DeKosky B., Palm A.K.E., et al. Low CD21 expression defines a population of recent germinal center graduates primed for plasma cell differentiation. Sci. Immunol. 2017;2 doi: 10.1126/sciimmunol.aai8153. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Barrington R.A., Schneider T.J., Pitcher L.A., Mempel T.R., Ma M., Barteneva N.S., Carroll M.C. Uncoupling CD21 and CD19 of the B-cell coreceptor. Proc. Natl. Acad. Sci. USA. 2009;106:14490–14495. doi: 10.1073/pnas.0903477106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Carroll M.C. CD21/CD35 in B cell activation. Semin. Immunol. 1998;10:279–286. doi: 10.1006/smim.1998.0120. [DOI] [PubMed] [Google Scholar]
- 22.Rakhmanov M., Keller B., Gutenberger S., Foerster C., Hoenig M., Driessen G., van der Burg M., van Dongen J.J., Wiech E., Visentini M., et al. Circulating CD21low B cells in common variable immunodeficiency resemble tissue homing, innate-like B cells. Proc. Natl. Acad. Sci. USA. 2009;106:13451–13456. doi: 10.1073/pnas.0901984106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Hao Y., O’Neill P., Naradikian M.S., Scholz J.L., Cancro M.P. A B-cell subset uniquely responsive to innate stimuli accumulates in aged mice. Blood. 2011;118:1294–1304. doi: 10.1182/blood-2011-01-330530. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Rubtsov A.V., Rubtsova K., Fischer A., Meehan R.T., Gillis J.Z., Kappler J.W., Marrack P. Toll-like receptor 7 (TLR7)-driven accumulation of a novel CD11c+ B-cell population is important for the development of autoimmunity. Blood. 2011;118:1305–1315. doi: 10.1182/blood-2011-01-331462. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Prokopec K.E., Rhodiner M., Matt P., Lindqvist U., Kleinau S. Down regulation of Fc and complement receptors on B cells in rheumatoid arthritis. Clin. Immunol. 2010;137:322–329. doi: 10.1016/j.clim.2010.08.006. [DOI] [PubMed] [Google Scholar]
- 26.Warnatz K., Wehr C., Dräger R., Schmidt S., Eibel H., Schlesier M., Peter H.H. Expansion of CD19CD21 B Cells in Common Variable Immunodeficiency (CVID) Patients with Autoimmune Cytopenia. Immunobiology. 2002;206:502–513. doi: 10.1078/0171-2985-00198. [DOI] [PubMed] [Google Scholar]
- 27.Freudenhammer M., Voll R.E., Binder S.C., Keller B., Warnatz K. Naive- and Memory-like CD21low B Cell Subsets Share Core Phenotypic and Signaling Characteristics in Systemic Autoimmune Disorders. J. Immunol. 2020;205:2016–2025. doi: 10.4049/jimmunol.2000343. [DOI] [PubMed] [Google Scholar]
- 28.Masle-Farquhar E., Peters T.J., Miosge L.A., Parish I.A., Weigel C., Oakes C.C., Reed J.H., Goodnow C.C. Uncontrolled CD21low age-associated and B1 B cell accumulation caused by failure of an EGR2/3 tolerance checkpoint. Cell Rep. 2022;38 doi: 10.1016/j.celrep.2021.110259. [DOI] [PubMed] [Google Scholar]
- 29.Zhu D., Castrillon C., Carroll M.C. Follicular B cell derived CD21 loB cells are immediate precursors to autoreactive extrafollicular antibody secreting cells. J. Immunol. 2023;210:247.04. [Google Scholar]
- 30.Wen L., Zhang B., Wu X., Liu R., Fan H., Han L., Zhang Z., Ma X., Chu C.Q., Shi X. Toll-like receptors 7 and 9 regulate the proliferation and differentiation of B cells in systemic lupus erythematosus. Front. Immunol. 2023;14 doi: 10.3389/fimmu.2023.1093208. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Fillatreau S., Manfroi B., Dörner T. Toll-like receptor signalling in B cells during systemic lupus erythematosus. Nat. Rev. Rheumatol. 2021;17:98–108. doi: 10.1038/s41584-020-00544-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Barrat F.J., Coffman R.L. Development of TLR inhibitors for the treatment of autoimmune diseases. Immunol. Rev. 2008;223:271–283. doi: 10.1111/j.1600-065X.2008.00630.x. [DOI] [PubMed] [Google Scholar]
- 33.Chen J.-Q., Szodoray P., Zeher M. Toll-Like Receptor Pathways in Autoimmune Diseases. Clin. Rev. Allergy Immunol. 2016;50:1–17. doi: 10.1007/s12016-015-8473-z. [DOI] [PubMed] [Google Scholar]
- 34.Reincke M.E., Payne K.J., Harder I., Strohmeier V., Voll R.E., Warnatz K., Keller B. The Antigen Presenting Potential of CD21low B Cells. Front. Immunol. 2020;11 doi: 10.3389/fimmu.2020.535784. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Roessner P.M., Seufert I., Chapaprieta V., Jayabalan R., Briesch H., Massoni-Badosa R., Boskovic P., Benckendorff J., Roider T., Arseni L., et al. T-bet suppresses proliferation of malignant B cells in chronic lymphocytic leukemia. Blood. 2024;144:510–524. doi: 10.1182/blood.2023021990. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Meeker R.B., Williams K.S. The p75 neurotrophin receptor: at the crossroad of neural repair and death. Neural Regen. Res. 2015;10:721–725. doi: 10.4103/1673-5374.156967. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Zeng F., Lu J.-J., Zhou X.-F., Wang Y.-J. Roles of p75NTR in the pathogenesis of Alzheimer’s disease: A novel therapeutic target. Biochem. Pharmacol. 2011;82:1500–1509. doi: 10.1016/j.bcp.2011.06.040. [DOI] [PubMed] [Google Scholar]
- 38.Bibel M., Hoppe E., Barde Y.A. Biochemical and functional interactions between the neurotrophin receptors trk and p75NTR. EMBO J. 1999;18:616–622. doi: 10.1093/emboj/18.3.616. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Meeker R., Williams K. Dynamic nature of the p75 neurotrophin receptor in response to injury and disease. J. Neuroimmune Pharmacol. 2014;9:615–628. doi: 10.1007/s11481-014-9566-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Jiang Y., Chen G., Zhang Y., Lu L., Liu S., Cao X. Nerve growth factor promotes TLR4 signaling-induced maturation of human dendritic cells in vitro through inducible p75NTR 1. J. Immunol. 2007;179:6297–6304. doi: 10.4049/jimmunol.179.9.6297. [DOI] [PubMed] [Google Scholar]
- 41.Jiang Y., Chen G., Zheng Y., Lu L., Wu C., Zhang Y., Liu Q., Cao X. TLR4 signaling induces functional nerve growth factor receptor p75NTR on mouse dendritic cells via p38MAPK and NF-kappa B pathways. Mol. Immunol. 2008;45:1557–1566. doi: 10.1016/j.molimm.2007.10.008. [DOI] [PubMed] [Google Scholar]
- 42.Luo C., Zha A.H., Luo R.Y., Hu Z.L., Shen W.Y., Dai R.P. ProBDNF contributed to patrolling monocyte infiltration and renal damage in systemic lupus erythematosus. Clin. Immunol. 2024;259 doi: 10.1016/j.clim.2023.109880. [DOI] [PubMed] [Google Scholar]
- 43.Luo R.-Y., Luo C., Zhong F., Shen W.Y., Li H., Hu Z.L., Dai R.P. ProBDNF promotes sepsis-associated encephalopathy in mice by dampening the immune activity of meningeal CD4+ T cells. J. Neuroinflammation. 2020;17:169. doi: 10.1186/s12974-020-01850-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Cancro M.P. Age-Associated B Cells. Annu. Rev. Immunol. 2020;38:315–340. doi: 10.1146/annurev-immunol-092419-031130. [DOI] [PubMed] [Google Scholar]
- 45.Gao X., Cockburn I.A. The development and function of CD11c+ atypical B cells - insights from single cell analysis. Front. Immunol. 2022;13 doi: 10.3389/fimmu.2022.979060. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Naradikian M.S., Hao Y., Cancro M.P. Age-associated B cells: key mediators of both protective and autoreactive humoral responses. Immunol. Rev. 2016;269:118–129. doi: 10.1111/imr.12380. [DOI] [PubMed] [Google Scholar]
- 47.Masilamani M., Kassahn D., Mikkat S., Glocker M.O., Illges H. B cell activation leads to shedding of complement receptor type II (CR2/CD21) Eur. J. Immunol. 2003;33:2391–2397. doi: 10.1002/eji.200323843. [DOI] [PubMed] [Google Scholar]
- 48.Sajanti A., Lyne S.B., Girard R., Frantzén J., Rantamäki T., Heino I., Cao Y., Diniz C., Umemori J., Li Y., et al. A comprehensive p75 neurotrophin receptor gene network and pathway analyses identifying new target genes. Sci. Rep. 2020;10 doi: 10.1038/s41598-020-72061-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Brodie C., Gelfand E.W. Regulation of immunoglobulin production by nerve growth factor: comparison with anti-CD40. J. Neuroimmunol. 1994;52:87–96. doi: 10.1016/0165-5728(94)90166-x. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
RNA-sequencing data of this work have been deposited at Sequence Read Archive (SRA) data repository and are publicly available as of the date of publication. Accession numbers (SRA: PRJNA1182849) are listed in the key resources table. This paper does not report original code. Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.







