Abstract
To investigate the impact of liraglutide (LIR) on experimental hypercholesterolemia-associated atherosclerosis and endothelial-monocyte adhesion, as well as elucidate the involvement of lectin-like oxidized low-density lipoprotein receptor 1 (LOX-1)/NF-κB signaling pathway in this process. High-fat diet-fed ApoE−/− mice were treated with LIR (300 mg/kg, subcutaneous injection, twice a week) or normal saline for 6 weeks. Normal diet-fed ApoE−/− and C57BL/6 mice were served as control. In parallel, thoracic aorta endothelial cells (TAECs) were exposed to ox-LDL (50 mg/L) in the presence or absence of LIR. The thoracic aorta histology and vasodilatory function, TAECs viability, monocyte adhesion to TAECs, as well as mRNA and protein levels of LOX-1, NF-κB p65, ICAM-1, and VCAM-1 in the thoracic aorta and TAECs were determined. LIR decreased plasma levels of triglyceride and total cholesterol, reduced aorta plaque size, improved endothelial-dependent relaxation, and inhibited the mRNA and protein expression levels of LOX-1, phosphorylated NF-κB p65, ICAM-1, and VCAM-1. Mechanistically, LIR or selective IκB kinase (IKK) inhibitor IKK-16 enhanced cell viability of TAECs, mitigated monocyte adhesion to TAECs, and reduced ICAM-1 and VCAM-1 mRNA and protein expression. Liraglutide improved vasodilation function and alleviated atherosclerosis by inhibiting endothelial-monocyte adhesion via downregulation of the LOX-1/NF-κB pathway.
Supplementary Information
The online version contains supplementary material available at 10.1038/s41598-025-13014-2.
Keywords: Liraglutide, Endothelial cells, Adhesion, Lectin-like ox-LDL receptor 1, Nuclear factor-κB
Subject terms: Cell biology, Cardiology
Introduction
Atherosclerotic cardiovascular disease (ASCVD) is the leading cause of mortality worldwide1, and dyslipidemia, characterized by elevated levels of plasma low-density lipoprotein (LDL) cholesterol or total cholesterol, represents one of its significant risk factors. Epidemiological studies have consistently indicated a high and escalating prevalence of dyslipidemia in China, with hypercholesterolemia exhibiting the most pronounced surge2. The current intervention strategy for managing ASCVD risk associated with hypercholesterolemia primarily relies on lipid-lowering therapy, predominantly statins3. However, despite undergoing lipid-lowering treatment, a subset of patients still face an increased risk of recurrent cardiovascular disease, commonly referred to as residual cardiovascular risk4. Therefore, a comprehensive understanding of the determinants of residual risk in ASCVD and the identification of novel molecular targets for intervention are crucial to optimize overall cardiovascular outcomes in patients with hypercholesterolemia5.
The lipid infiltration hypothesis posits that hyperlipidemia, particularly hypercholesterolemia, plays a significant contributory role in the development of atherosclerosis6. Specifically, in atherogenic conditions, circulating LDL cholesterol undergoes oxidation to form oxidized LDL (ox-LDL), which is subsequently phagocytosed by vascular endothelial cells and macrophages, thereby initiating and promoting the development of atherosclerosis. The lectin-like ox-LDL receptor 1 (LOX-1), initially identified on endothelial cells in 1997, is a transmembrane glycoprotein that specifically binds and internalizes ox-LDL within the endothelium, thereby facilitating endothelial dysfunction and promoting plaque formation7,8. The synthesis of LOX-1 is primarily initiated by the activation of the ORL1 promoter, predominantly through nuclear factor κB (NF-κB)9. Conversely, binding of LOX-1 to ox-LDL triggers the liberation of NF-κB from its inhibitor, leading to an augmented expression of inflammatory cytokines10. Therefore, blocking the positive feedback loop between LOX-1 and NF-κB in a high-fat environment may present a novel strategy for preventing and treating hypercholesterolemia-associated ASCVD.
The glucagon-like peptide-1 receptor agonist (GLP-1RA) is a novel class of antidiabetic medication that exerts direct and indirect effects on the cardiovascular system. Consistent findings from cardiovascular outcome trials demonstrate that GLP-1RA significantly mitigates the risk of major adverse cardiovascular events in patients with type 2 diabetes, thus warranting its prioritized use in individuals with diabetes accompanied by ASCVD or ASCVD risk factors11,12. Nevertheless, the available evidence is inadequate to substantiate the effectiveness of GLP-1RA in mitigating ASCVD events associated with hypercholesterolemia. Furthermore, only a restricted number of animal studies have indicated its potential for ameliorating atherosclerosis in ApoE knockout mice subjected to a high-fat diet13,14. Additionally, the role of LOX-1 in the atheroprotective effects of GLP-1RA against hypercholesterolemia-induced vascular damage remains insufficiently investigated. Dai et al. have shown that liraglutide, a GLP-1RA, effectively inhibits the upregulation of LOX-1 expression in vascular smooth muscle cells induced by ox-LDL and reduces the generation of reactive oxygen species15. The study conducted by Ma et al. demonstrated that GLP-1RA exendin-4 effectively mitigates the inhibitory impact of ox-LDL on macrophage migration through suppression of ox-LDL-induced expression of intercellular adhesion molecule 1 (ICAM-1) and migration inhibitory factor, potentially mediated via the NF-κB pathway16. However, to the best of our knowledge, no studies have yet investigated the effects of liraglutide on vascular endothelium-monocyte adhesion in a high lipid environment and elucidated the role of the LOX-1/NF-κB signaling pathway in this process.
Therefore, the objective of this study was to investigate the potential therapeutic effects of liraglutide on atherosclerotic lesions and vasodilation in ApoE knockout mice fed a high-fat diet. Additionally, we sought to explore the effects of liraglutide on endothelial cell proliferation and endothelium-monocyte interaction in an ox-LDL culture, as well as elucidate the possible involvement of the LOX-1/NF-κB pathway in these processes.
Methods
Experimental animals and grouping
The ApoE−/− and their genetic background mice (C57BL/6) were obtained from the Bomholtgard Breeding and Research Center (Silkeborg, Denmark). Thirty 8-week-old male ApoE−/− mice were randomly allocated into three groups: ApoE−/− group, HFD-ApoE−/− group, and Lir-HFD-ApoE−/− group. The mice in the ApoE−/− group were fed a normal diet, while those in the HFD-ApoE−/− and Lir-HFD-ApoE−/− groups were fed a high-fat diet (HFD) (TD-88137, Harlan Teklad, 42% calories from fat with 1% cholesterol). Ten age-gender-matched C57BL/6 mice fed a normal diet served as controls. The mice in the Lir-HFD-ApoE−/− group were administered subcutaneous injections of liraglutide at a dosage of 300 mg/kg twice weekly for a duration of 6 weeks, while the other groups received an equal volume of normal saline. All animals were provided with unrestricted access to water and food. The animal experiments conducted in this study were approved by the Animal Ethics Committee of Affiliated Hospital of Putian University.This study was carried out in compliance with ARRIVE guidelines.
Analysis of plasma levels of glucose and lipid profiles
After treatment, blood samples were collected following a 12-h fasting period through retroorbital puncture under barbital-induced anesthesia, and serum aliquots were stored at 4℃ until analysis. Blood glucose levels were determined using Glucotrend 2 (Roche Diagnostics, Mannheim, Germany), while plasma lipid profiles were assessed via enzymatic assay (Spinreact, Barcelona, Spain).
Quantification of atherosclerotic lesions in the ascending aorta
According to Lin et al.17, the atherosclerotic plaque area in the ascending aorta was quantified by analyzing 4 Hematoxylin-Eosin (H-E) stained consecutive sections, each with a thickness of 8 μm, collected at intervals of 10 μm, starting from the transition point where the aortic sinus merges into the ascending aorta. Sections were analyzed using a light microscope (Olympus, Tokyo, Japan) connected with computer-aided Image Pro Plus 6.0 software. The mean plaque area derived from the 4 serial sections was taken as the mean lesion size for each animal.
Organ chamber experiments
Endothelium-dependent vasodilation was assessed by organ chamber experiments as described previously18. In brief, the aorta was cleaned of adherent connective tissue under a dissecting microscope and cut into 2 mm rings for organ chamber experiments. Each ring was then connected to an isometric force transducer (PowerLab ML870 8/30, AD Instruments, Bella Vista, Australia), suspended in an organ chamber filled with 5 mL Krebs–Ringer bicarbonate solution (37 °C, pH 7.4), and bubbled with 95% O2 and 5% CO2. Concentration-effect curves were produced by adding graded concentrations of acetylcholine (10− 9~10− 5 mol/L) during submaximal contractions to norepinephrine (10− 5 mol/L). Relaxations were expressed as percentages of precontracted tension and pD2 values (− 1og10 EC50) for acetylcholine and interpolated from each curve.
Isolation and culture of thoracic aortic endothelial cells (TAECs)
Primary TAECs were isolated from 12-week-old wild-type C57BL/6 mice using a modified enzymatic explant technique as previously described19. Briefly, thoracic aortas were rapidly excised and meticulously cleaned of surrounding adipose and connective tissues. Subsequently, the aortas were sectioned into 1 mm rings. Each aortic ring was carefully opened and placed onto a growth factor-reduced matrix with the endothelium facing downwards. These segments were then cultured in an endothelial cell growth medium for approximately 4 days. Afterward, the segments were removed and the cells were continuously cultured until they reach confluence. The endothelial cells were harvested using neutral proteinase and subsequently cultured in an endothelial cell growth medium for an additional two passages before being utilized for in vitro experiments. For the treatment group, the cells were pre-treated with ox-LDL (LM-G5689, Shanghai Lianmai Bio) or vehicle for 1 h. Subsequently, they were exposed to liraglutide (Novo Nordisk Pharmaceutical Co., Ltd.), or selective IκB kinase (IKK) inhibitor IKK-16 for a duration of 24 h.
Cell viability assay
The CCK-8 assay (KGA317, Kekgen Biotech) was used to investigate the cell viability of TAECs cultured in 96-well plates. In brief, after different treatments, 100 µl CCK-8 solution at a 1:10 dilution was added to each well of the plate followed by a further 2 ~ 4 h incubation in the incubator. Absorbance was measured at 450 nm with a microplate reader (Molecular Devices, Sunnyvale, CA, USA). The mean optical density of five wells in the indicated groups was used to calculate the cell viability percentage. Experiments were performed in triplicate.
Monocyte adhesion assay
The adhesion of monocytic analog THP-1 cells (ATCC, USA) to TAECs was assessed using the Rose Bengal method20. TAECs were pretreated with ox-LDL or vehicle and cultured in a 96-well plate at a density of 1 × 104 cells/well. They were then incubated for 24 h at 37 °C in a medium supplemented with Lir or IKK-16. Following this, TPH-1 cells were added to each well at a density of 1 × 104 cells/well and incubated for 4 h at 37 °C in a humidified atmosphere containing 5%CO2. Nonadherent cells were removed by washing twice with PBS. Subsequently, Rose Bengal solution was added and incubated for 10 min at 25 °C. Absorbance was measured at a wavelength of 570 nm, and monocyte adhesion was expressed as a ratio relative to untreated controls.
Quantitative RT-PCR
Total RNA was extracted from the thoracic aorta of each mouse and the TAECs using the RNeasy Mini Kit and RNase-Free DNase Set purchased from Qiagen (Courtaboeuf, France). Subsequently, cDNAs were synthesized utilizing dNTP mix and random primers. The resulting cDNAs were amplified by employing the SYBR Green PCR Kit (Applied Biosystems, Foster City, CA, USA). Quantitative PCR analysis was conducted on an ABI PRISM 7700 sequence detection system (Perkin Elmer Life Sciences Inc., Boston, MA, USA). The relative abundance of mRNAs was determined using the comparative cycle threshold method, with GAPDH mRNA employed as the internal control. The primer sequences employed in this study are listed as follows: LOX-1 sense: 5’-ACTAGTAGCACTAGGAGCTCAA-3’; Antisense: 5’-CTATcGGTCGAGACATACGCTT-3’; NF-κB p65 sense: 5’-ATCACTGACCAGTGTCGATGACT-3’; Antisense: 5’-CACTAGCTAGCACGAGTGCATC-3’; ICAM-1 sense: 5’-ATGACTCACGAGTGTAGATACT-3’; Antisense: 5’-AAGTACATAGCAACAGTACAGC-3’; VCAM-1 sense: 5’-ACTCAGTGTCCACTGTAGTTGTCA-3’; Antisense: 5’-GACACTCTAAGACGTCTGCCAC − 3’ ; GAPDH sense: ' AGCATTAGCACAAGCG ATGCGTA − 3 ‘; antisense: ' AGCTTGCGCAGCAGCAGCTGGAAC − 3 ‘.
Western blot
For Western blot, protein extracts (15 µg) from the thoracic aorta or total cellular proteins (50 µg) were electrophoresed on 10% SDS-PAGE and transferred onto nitrocellulose membranes. The membranes were blocked with 5% dry milk in PBS-Tween buffer (0.1% Tween 20; pH 7.5) for 60 min and incubated with mouse monoclonal anti-β-actin (TA-08, Zhongqian Jinqiao, 1/2000), rabbit anti-LOX-1 (alias: OLR1, 11837-1-ap, Proteintech, 1/1000), rabbit polyclonal anti-phosphorylated-NF-ĸB p65 at Ser(536) (Santa Cruz Biotechnology, CA, USA, 1/1000), mouse monoclonal anti-ICAM-1 (Pharmingen, San Diego, USA, 1/1000), and mouse monoclonal anti-VCAM-1 (Pharmingen, San Diego, USA, 1/1000), respectively, for 3 h at room temperature.After undergoing five washes with TBST and two rinses with TBS, the membrane was incubated for 1 h at room temperature with horseradish peroxidase-conjugated secondary antibody (Abcam). Following another two washes with TBST, labeled proteins were visualized using ECL (Invitrogen, Carlsbad, CA) on high-performance chemiluminescence film. The intensity of the bands was quantified by densitometry with image analysis software.
Statistical analysis
The statistical analyses were conducted using SPSS 20.0 software (IBM, Armonk, NY, USA). The quantitative results were presented as mean ± standard deviation (SD). Normality of the data was checked by the Saphiro-Wilk test. One-way analysis of variance (ANOVA) was employed to compare the quantitative values among multiple groups, while the Tukey test was utilized for pairwise comparisons. Statistical significance was considered at α = 0.05 and P < 0.05.
Results
Effects of liraglutide on the body weight, blood lipid profile, and blood glucose levels in high-fat fed ApoE−/− mice
The body weight of mice in the HFD-ApoE−/− group showed a statistically significant increase compared to that of both the ApoE−/− and C57BL/6 groups (P < 0.05). Treatment with liraglutide effectively alleviated the weight gain observed in the HFD-ApoE−/− group (P < 0.05). Similarly, the plasma levels of triglycerides (TG), total cholesterol (TC), and low-density lipoprotein cholesterol (LDL-C) were significantly higher in mice from the HFD-ApoE−/− group than those from both ApoE−/− and C57BL/6 groups (P < 0.05). Conversely, plasma levels of TG, TC, and LDL–C were significantly reduced in the Lir-HFD-ApoE−/− group compared to those in the HFD-ApoE−/− group (P < 0 0.05). No statistically significant difference was found in fasting blood glucose (FBG) across all four groups (Fig. 1A-E).
Fig. 1.
Effects of liraglutide on the body weight, blood lipid profile, and blood glucose levels in high-fat fed ApoE−/− mice. TG: triglycerides; TC: total cholesterol; LDL-C: low-density lipoprotein cholesterol; FBG: fasting blood glucose. Values are expressed as mean ± SD, n = 10; aP<0.05 vs. C57BL/6 group; bP<0.05 vs. ApoE−/− group; cP<0.05 vs. HFD-ApoE−/− group.
Effect of liraglutide on the structure of ascending aorta in high-fat fed ApoE−/− mice
The H-E staining revealed that the ascending aortic wall in the C57BL/6 group exhibited regular morphology, characterized by a smooth intima. In the ApoE−/− group, the ascending aortic wall displayed irregularities and featured medium-sized plaques protruding into the vascular lumen from the intima, accompanied by plaque-associated vacuoles. Notably, in the HFD-ApoE−/− group, significant deformations were observed in the ascending aortic wall along with substantial intimal plaques and formation of large vacuoles within these plaques. Conversely, in the Lir-HFD-ApoE−/− group, there was an improved regularity of the ascending aortic wall characterized by medium-sized intimal plaques containing small vacuoles (Fig. 2A). The quantitative analysis revealed a significant increase in the plaque area in the ascending aorta of the HFD-ApoE−/− group compared to both the ApoE−/− and C57BL/6 groups (P < 0.05). Liraglutide exhibited inhibitory effects on atherosclerotic plaque formation in high-fat fed ApoE−/− mice, as evidenced by a significantly lower plaque area in the ascending aorta of the Lir-HFD-ApoE−/− group compared to that of the HFD-ApoE−/− group (P < 0.05) (Fig. 2B).
Fig. 2.
Effect of liraglutide on the structure of thoracic aorta in high-fat fed ApoE−/− mice. A: The HE staining of the thoracic aorta in mice revealed the absence of intimal plaque formation in the C57BL/6 group, whereas significant vacuole-like plaques were observed within the vessel intima in the HFD-ApoE−/− group. Conversely, minor vacuole-like plaques were detected within the vascular intima in the Lir-HFD-ApoE−/− group. B: Quantitative analysis of plaque area in thoracic aorta. Values are expressed as mean ± SD, n = 10; aP<0.05 vs. C57BL/6 group; bP<0.05 vs. ApoE−/−; cP<0.05 vs. HFD-ApoE−/− group.
Effects of liraglutide on the acetylcholine-induced vasodilation of the thoracic aorta in high-fat fed ApoE−/− mice
The vasodilatory response to acetylcholine (ACH) was significantly reduced in ApoE−/− mice compared to those with a C57BL/6 background within the concentration range 10− 7 M to 10− 5 M (P < 0.05). This impairment was further exacerbated by high-fat diet feeding. However, treatment with liraglutide effectively improved ACH-induced endothelial relaxation function in the thoracic aorta of HFD-ApoE−/− mice. This improvement is indicated by a significant increase in pD2 value when compared with saline-treated HFD-ApoE−/− mice (P < 0.05) (Fig. 3A and B).
Fig. 3.
Effects of liraglutide on the acetylcholine-induced relaxation of the thoracic aorta in high-fat fed ApoE−/− mice. After a 1-h incubation period, the aortic rings were precontracted using norepinephrine (10− 5 M). Subsequently, the rings were exposed to an incremental concentration range of acetylcholine (10− 9~10− 5 M) to evaluate endothelium-dependent vasodilation. (A) Concentration-effect curve of endothelium-dependent relaxation to ACH. (B) pD2 is expressed as the negative logarithm of the molar concentration producing 50% of the maximum vasodilatory effect. Values are expressed as mean ± SD, n = 4; aP<0.05 vs. C57BL/6 group; bP<0.05 vs. ApoE−/− group; cP<0.05 vs. HFD-ApoE−/− group.
Effect of liraglutide on mRNA expression of LOX-1, NF-κB p65, ICAM-1, and VCAM-1 in thoracic aorta of high-fat fed ApoE−/− mice
The Q-PCR results demonstrated a significant upregulation in the mRNA expression levels of LOX-1, ICAM-1, and VCAM-1 in the thoracic aorta of the HFD-ApoE−/− group compared to both the ApoE−/− and C57BL/6 groups (P < 0.05). Treatment with liraglutide effectively mitigated the mRNA expression of LOX-1, ICAM-1, and VCAM-1 in the thoracic aorta of high-fat-fed ApoE−/− mice. In comparison to the HFD-ApoE−/− group, there was a notable reduction in the mRNA expression levels of LOX-1, ICAM-1, and VCAM-1 in the thoracic aorta of Lir-HFD-ApoE−/− group (P < 0.05). No significant differences were observed in NF-kB p65 mRNA expression levels among all groups (P > 0.05) (Fig. 4A-D).
Fig. 4.
Effect of liraglutide on mRNA expression of LOX-1, NF-κB p65, ICAM-1 and VCAM-1 in thoracic aorta of high-fat fed ApoE−/− mice. LOX-1, lectin-like ox-LDL receptor 1; NF-κB p65, nuclear factor-κB p65 subunit; ICAM-1, intercellular adhesion molecule; VCAM-1, Vascular cell adhesion molecule. Values are expressed as mean ± SD, n = 4; aP<0.05 vs. C57BL/6 group; bP<0.05 vs. ApoE−/− group; cP<0.05 vs. HFD-ApoE−/− group.
Effect of liraglutide on protein expression of LOX-1, T-NF-κB p65, P-NF-κB p65, ICAM-1, and VCAM-1 in thoracic aorta of high-fat fed ApoE−/− mice
The Western blot analysis revealed that there was a statistically significant upregulation in LOX-1, phosphorylated NF-κB p65 (P-NF-κB p65), ICAM-1, and VCAM-1 protein expressions within the thoracic aorta of HFD-ApoE−/− mice when compared to both ApoE−/− and C57BL/6 groups (P < 0.05). Administration of liraglutide resulted in decreased expressions of LOX-1, P-NF-κB p65, ICAM-1, and VCAM-1 protein in the thoracic aorta of high-fat fed ApoE−/− mice. In comparison to the HFD-ApoE−/− group, a significant decrease in protein expression levels of LOX-1, P-NF-κB p65, ICAM-1, and VCAM-1 was observed within the thoracic aorta of the Lir-HFD-ApoE−/− group. No significant difference was found among all groups regarding total NF-κB p65 (T-NF-κB p65) protein expression (P > 0.05) (Fig. 5A-F).
Fig. 5.
Effect of liraglutide on protein levels of LOX-1, T-NF-κB p65, P-NF-κB p65, ICAM-1, and VCAM-1 in thoracic aorta of high-fat fed ApoE−/− mice. A. Representative image of Western blot (original uncropped blot images with visible membrane edges are provided in the Supplementary material); B-F. Quantification analysis of Western blot. The target protein/β-actin OD ratio represents the target protein level. LOX-1, lectin-like ox-LDL receptor 1; P-NF-κB p65, phosphorylated nuclear factor-κB p65 subunit; T-NF-κB p65, total nuclear factor-κB p65 subunit; ICAM-1, intercellular adhesion molecule; VCAM-1, Vascular cell adhesion molecule. Values are expressed as mean ± SD, n = 4; aP<0.05 vs. C57BL/6 group; bP<0.05 vs. ApoE−/− group; cP<0.05 vs. HFD-ApoE−/− group.
Effect of liraglutide on P-NF-κB p65 protein expression in ox-LDL-cultured TAECs cells
The expression of P-NF-κB p65 in TAECs cells exhibited a significant time-dependent upregulation following treatment with ox-LDL (50 mg/L), showing a notable increase after 60 min and reaching peak levels (P < 0.05). Liraglutide demonstrated a dose-dependent reduction in the protein expression level of P-NF-κB p65 in ox-LDL-cultured TAECs cells across concentrations ranging from 10− 5 to 10− 3 mol/L. The expression of P-NF-κB p65 protein was significantly reduced by liraglutide at concentrations of 10− 5 mol/L (P < 0.05) and further decreased at a concentration of 10− 3 mol/L (P < 0.05). Neither ox-LDL nor liraglutide had significant effects on T-NF-κB p65 protein expression(P > 0.05) (Fig. 6A and B).
Fig. 6.
Effect of liraglutide on P-NF-κB p65 protein expression in ox-LDL-cultured TAECs cells. A-C represents the temporal correlation between the impact of ox-LDL on NF-κB p65 phosphorylation in TAECs cells. D-F represents the concentration-effect relationship of liraglutide on NF-κB p65 phosphorylation induced by ox-LDL in TAEC cells. Original uncropped blot images with visible membrane edges are provided in the Supplementary material. The ratio of target protein to β-actin was used to indicate the level of target protein. P-NF-κB p65, phosphorylated nuclear factor-κB p65 subunit; T-NF-κB p65, total nuclear factor-κB p65 subunit. Values are expressed as mean ± SD, n = 4 independent experiments; aP<0.05 vs. Control group; bP<0.05 vs. ox-LDL (50 mg/L).
Effects of Liraglutide or IKK-16 on LOX-1, T-NF-κB p65, P-NF-κB p65, ICAM-1 and VCAM-1 protein expression in ox-LDL-cultured TAECs
The Western blot results demonstrated a significant increase in the protein levels of LOX-1, P-NF-κB p65, ICAM-1, and VCAM-1 in ox-LDL-cultured TAECs compared to vehicle-cultured cells (P < 0.05). Treatment with liraglutide (10− 3 mol/L) or the selective IκB kinase (IKK) inhibitor IKK-16 (10− 6 mol/L) significantly attenuated the protein expression levels of LOX-1, P-NF-κB p65, ICAM-1, and VCAM-1 in ox-LDL-cultured TAECs (P < 0.05). Neither liraglutide nor IKK-16 had significant effects on T-NF-κB p65 protein expression(P > 0.05) (Fig. 7A-E).
Fig. 7.
Effects of liraglutide or IKK-16 on LOX-1, T-NF-κB p65, P-NF-κB p65, ICAM-1, and VCAM-1 protein expression in ox-LDL-cultured TAECs cells. A. Representative image of Western blot (original uncropped blot images with visible membrane edges are provided in the Supplementary material); B-E. Quantification analysis of Western blot. LOX-1, lectin-like ox-LDL receptor 1; P-NF-κB p65, phosphorylated nuclear factor-κB p65 subunit; T-NF-κB p65, total nuclear factor-κB p65 subunit; ICAM-1, intercellular adhesion molecule; VCAM-1, Vascular cell adhesion molecule. Values are expressed as mean ± SD, n = 4 independent experiments; aP<0.05 vs. vehicle-treated TAECs; bP<0.05 vs. ox-LDL-treated TAECs.
Effects of liraglutide or IKK-16 on ox-LDL-induced monocytes adhesion to TAECs
The monocyte adhesion assay demonstrated a significant increase in the adhesion rate of TPH-1 cells to TAECs in ox-LDL-treated TAECs compared to vehicle-treated TAECs (P < 0.05), indicating that ox-LDL intervention could enhance monocyte adhesion to endothelial cells. Liraglutide (10− 3 mol/L) or IKK-16(10− 6 mol/L) attenuated the adhesion of ox-LDL-induced TPH-1 cells to TAECs, and when compared with the vehicle-treated TAECs, the adhesion rate of TPH-1 cells to TAECs was significantly reduced in cultures treated with liraglutide (10− 3 mol/L) or IKK-16 (10− 6 mol/L) (P < 0.05) (Fig. 8).
Fig. 8.

Effect of liraglutide or IKK-16 on ox-LDL-induced monocyte adhesion to endothelial. Values are expressed as mean ± SD, n = 4 independent experiments; aP<0.05 vs. vehicle-treated TAECs; bP<0.05 vs. ox-LDL-treated TAECs.
Effects of liraglutide or IKK-16 on cell viability of ox-LDL-cultured TAECs
The results of the CCK8 assay showed that co-culture of TPH-1 alone with TAECs did not have a significant impact on TAECs cell viability (P > 0.05). However, intervention with ox-LDL (50 mg/L) significantly decreased TAECs cell viability (P < 0.05). Treatment with liraglutide (10− 3 mol/L) or IKK-16(10− 6 mol/L) attenuated the inhibitory effect of ox-LDL on TAECs cell viability. Compared to TAECs co-cultured with ox-LDL-TPH-1, both Lir-ox-LDL-TPH-1 and IKK-16-ox-LDL-TPH-1-treated TAECs exhibited a significant increase in cell activity (P < 0.05) (Fig. 9).
Fig. 9.

Effects of liraglutide or IKK-16 on cell viability of ox-LDL-cultured TAECs. Values are expressed as mean ± SD, n = 4; aP<0.05 vs. vehicle-treated TAECs, bP<0.05 vs. ox-LDL-TPH-1-co-cultured TAECs.
Discussion
Cardiovascular outcome trials have provided evidence that GLP-1 receptor agonists effectively mitigate the risk of non-fatal myocardial infarction, non-fatal stroke, and cardiovascular mortality in both diabetic and non-diabetic patients21,22. However, there is still limited understanding regarding the underlying mechanism involved in individuals without diabetes. This study demonstrates at both animal and cellular levels that liraglutide has potential benefits in ameliorating hyperlipidemia-induced atherosclerosis by reducing plaque area and improving vasodilation function. These beneficial effects are likely mediated through inhibiting inflammatory factor release and decreasing monocyte adhesion to endothelial cells via down-regulation of the LOX-1/NF-κB signaling pathway.
In this study, an atherosclerosis model was established in ApoE−/− mice through high-fat feeding. Compared to the control group, the model exhibited a significant increase in body weight and plasma levels of triglycerides, total cholesterol, and low-density lipoprotein cholesterol. However, there was no significant change in blood glucose levels, mimicking atherosclerosis associated with simple hyperlipidemia. Treatment with liraglutide significantly reduced body weight and lipid levels in high-fat-fed ApoE−/− mice but had no significant effect on blood glucose levels. These findings are consistent with clinical observations demonstrating that GLP-1RA can effectively lower plasma triglyceride and total cholesterol levels in patients with type 2 diabetes23. The current understanding of the mechanism underlying liraglutide’s effect on reducing blood lipid levels remains uncertain. The study conducted by Li et al. reported that liraglutide enhances lipid metabolism and reduces liver lipid accumulation in db/db mice fed a high-fat diet by promoting cholesterol efflux through the up-regulation of ABCA1, which is achieved via activation of the ERK1/2 pathway24. They also discovered that liraglutide inhibits the expression of proprotein convertase subtilisin/kexin type 9 (PCSK9) in HepG2 cells and db/db mice through a hepatocyte nuclear factor 1α-dependent mechanism25. Moreover, our findings are consistent with the earlier observations by Akhmedov et al., demonstrating elevated LOX-1 mRNA levels in ApoE−/− mice even in the absence of HFD compared to controls26. This suggests that a hyperlipidemic environment enhances the uptake of ox-LDL in both endothelial cells and macrophages. Liraglutide has been observed to decrease aortic plaque area and improve aortic vasodilatory response to acetylcholine. Q-PCR and Western blotting analysis revealed reduced mRNA and protein expression levels of LOX-1, P-NF-κB p65, ICAM-1, and VCAM-1 in the aorta. Our findings suggest that the vascular protective effects of liraglutide may be attributed to its ability to induce weight loss, reduce lipid levels, inhibit internalization of ox-LDL by endothelial cells, and attenuate vascular wall inflammation. This is in line with the findings of Rakipovski G et al., who also proposed that liraglutide’s vasoprotective effect may be achieved through various mechanisms, such as its anti-inflammatory properties. In aortic tissue, exposure to a high-fat diet al.ters gene expression in pathways associated with atherosclerosis, including leukocyte recruitment, leukocyte rolling, adhesion/extravasation, cholesterol metabolism, lipid-mediated signaling, extracellular matrix protein turnover, and plaque hemorrhage. Treatment with GLP-1RA significantly reversed these alterations27. However, other authors have documented that liraglutide reduces the expression of inflammatory factors and decreases the area of aortic plaque lesions without impacting LDL-C and glycated hemoglobin levels. This suggests that liraglutide may possess an independent anti-atherosclerotic role independent of its lipid-lowering and glucose-lowering effects28. We postulate that the inconsistent findings among these studies could be attributed to variations in drug dosage interventions and animal models.
In cellular experiments, we observed a time-dependent induction of NF-κB p65 phosphorylation in TAECs upon exposure to ox-LDL. However, liraglutide demonstrated a dose-dependent reduction in ox-LDL-induced NF-κB p65 phosphorylation, as well as suppression of ICAM-1 and VCAM-1 protein expression in TAECs. Moreover, the enhanced adhesion of TPH-1 to TAECs and the mitigated proliferative activity of TAEC cells induced by ox-LDL were ameliorated, with the NF-κB p65 inhibitor IKK-16 exhibiting equivalent biological efficacy as liraglutide. Our findings suggest that liraglutide exhibits the potential to mitigate ox-LDL-induced inflammation in endothelial cells and inhibit endothelial-monocyte adhesion, with this mechanism being associated with the suppression of NF-κB p65 phosphorylation. It has long been conventionally believed that IκB kinase (IKK) phosphorylates inhibitors of NF-κB (IκB), thereby triggering rapid degradation of IκB through a ubiquitin-proteasome pathway and facilitating nuclear translocation of NF-κB29. Additionally, IKK can also phosphorylate the serine 536 site on NF-κB p65 during cytokine-induced NF-κB activation, consequently promoting the expression of NF-κB target genes30. Our results showed that IKK inhibitor IKK-16 suppressed the NF-κB p65 phosphorylation at the Ser (536) residue, reducing the downstream adhesion molecule expression. However, some authors alternatively suggested that Ser (536) phosphorylation of NF-κB p65 is not required for its nuclear translocation, but instead inhibits NF-κB signaling to prevent deleterious inflammation31. Further investigations are warranted to elucidate the intricate regulatory relationship between GLP-1RA and different subunits of NF-κB, as well as its associated activity regulator IκB and IKK. Other studies have also confirmed that GLP-1 RA can prevent the adhesion of monocytes to human endothelial cells induced by ox-LDL, potentially through ameliorating the reduction of Kruppel-like transcription factor 2 caused by ox-LDL32,33. Our previous studies demonstrated that liraglutide alleviated oxidative stress and inflammation induced by ox-LDL in endothelial cells by GLP-1-dependent inhibition of LOX-1 expression34. Based on prior studies indicating that LOX-1 is a critical factor in ox-LDL-mediated monocyte adhesion to endothelial cells35, we hypothesize that liraglutide confers its atheroprotective effects by inhibiting the LOX-1/NF-κB signaling pathway. This inhibition reduces endothelial-monocyte adhesion, enhances vascular endothelial function (including vasodilation), and ultimately alleviates the progression of atherosclerosis. Further investigations are warranted to elucidate the roles of LOX-1, NF-κB p65, and KLF2 in endothelial dysfunction induced by ox-LDL, as well as the intricate regulatory effects of liraglutide on these molecules.
This study has several important limitations that should be acknowledged. First, the lack of a liraglutide-treated control group on normal diet prevents us from distinguishing between the drug’s specific effects and those influenced by dietary factors. Second, our evaluation of aortic plaques relied exclusively on semi-quantitative H&E staining, without the complementary use of Oil-red-O staining for precise lipid quantification, which would have offered more comprehensive characterization of plaque composition. Third, although our findings suggest LOX-1 signaling involvement, the exact mechanisms through which liraglutide improves endothelial function remain incompletely defined, particularly due to the absence of key experiments including additional scavenger receptor analyses, L-NAME treatment, and assessment of nuclear p65 translocation. Finally, while we identified an association between liraglutide’s endothelial protective effects and reduced atherosclerosis, our study did not investigate its potential actions on other critical cellular components of atherosclerosis, particularly macrophages and vascular smooth muscle cells.
In conclusion, our findings demonstrate that liraglutide effectively attenuates hyperlipidemia-induced atherosclerosis by ameliorating endothelial inflammation and reducing endothelium-monocyte adhesion. The beneficial effect is achieved by downregulating the proteins LOX-1, ICAM-1, and VCAM-1, as well as inhibiting the phosphorylation of NF-κB p65. Therefore, our study provides a solid theoretical and scientific foundation for the potential utilization of liraglutide in mitigating atherosclerotic cardiovascular events among non-diabetic populations in the future.
Electronic supplementary material
Below is the link to the electronic supplementary material.
Acknowledgements
The authors would like to thank Changsheng Xu for his technical support.
Author contributions
The study was conceptualized and developed by Liming Lin and Meifang Wu. The tests were carried out by Aiping Wu, Ying Wu and Meiyan Song. Wen Chen and Kaizu Xu conducted the data analyses and drafted the article. The finalized manuscript was approved by all authors.
Funding
This study was supported by grants from the National Natural Science Foundation of China (Grant no. 81800278) and the Fujian Provincial Health Technology Project (Grant no. 2022CXA057) to Liming Lin, the Natural Science Foundation of Fujian Province to Kaizu Xu (Grant no. 2020J011259), Ying Wu (Grant no. 2021J01122508), Meifang Wu (Grant no. 2022J011433), Wen Chen (Grant no. 2022J011438), and Liming Lin (Grant no. 2022J011431) and the Education and scientific research project of young and middle-aged teachers in Fujian Education Department to Ying Wu (Grant no. JAT190553).
Data availability
The data that support the findings of this study are available on request from the corresponding author.
Declarations
Competing interests
The authors declare no competing interests.
Consent for publication
All authors agree to publication.
Ethics approval
All the experiments were approved by the Animal Ethics Committee of the Affiliated Hospital of Putian University and performed following institutional guidelines.
Consent to participate
Not applicable.
Footnotes
Aiping Wu and Ying Wu have contributed equally to this work.
The original online version of this Article was revised: The original version of this Article contained errors in Figures 6 and 8. Full information regarding the corrections made can be found in the correction for this Article.
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Change history
6/12/2026
A Correction to this paper has been published: 10.1038/s41598-026-57581-4
Contributor Information
Meifang Wu, Email: 626549128@qq.com.
Liming Lin, Email: 2533358160@qq.com.
References
- 1.Mensah, G. A., Fuster, V., Murray, C. J. L. & Roth, G. A. Global burden of cardiovascular diseases and risks, 1990–2022. J. Am. Coll. Cardiol.82 (25), 2350–2473. 10.1016/j.jacc.2023.11.007 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Li, J. J. et al. 2023 Chinese guideline for lipid management. Front. Pharmacol.14, 1190934. 10.3389/fphar.2023.1190934 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Hu, D. Dyslipidemia and management of atherosclerotic cardiovascular diseases in china: new evidence and new guidelines. Cardiovasc. Innovations Appl.2 (2), 143 (2017). [Google Scholar]
- 4.Davidson, M. H. Reducing residual cardiovascular risk with novel therapies. Curr. Opin. Lipidol.31 (2), 108–110. 10.1097/mol.0000000000000672 (2020). [DOI] [PubMed] [Google Scholar]
- 5.Dhindsa, D. S., Sandesara, P. B., Shapiro, M. D. & Wong, N. D. The evolving Understanding and approach to residual cardiovascular risk management. Front. Cardiovasc. Med.7, 88. 10.3389/fcvm.2020.00088 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Steinberg, D. Lipoproteins and the pathogenesis of atherosclerosis. Circulation76 (3), 508–514 (1987). [DOI] [PubMed] [Google Scholar]
- 7.Sawamura, T. et al. An endothelial receptor for oxidized low-density lipoprotein. Nature386 (6620), 73–77. 10.1038/386073a0 (1997). [DOI] [PubMed] [Google Scholar]
- 8.Akhmedov, A. et al. Lectin-like oxidized low-density lipoprotein receptor-1 (LOX-1): a crucial driver of atherosclerotic cardiovascular disease. Eur. Heart J.42 (18), 1797–1807. 10.1093/eurheartj/ehaa770 (2021). [DOI] [PubMed] [Google Scholar]
- 9.Barreto, J., Karathanasis, S. K., Remaley, A. & Sposito, A. C. Role of LOX-1 (Lectin-Like oxidized Low-Density lipoprotein receptor 1) as a cardiovascular risk predictor: mechanistic insight and potential clinical use. Arterioscler. Thromb. Vasc. Biol.41 (1), 153–166. 10.1161/atvbaha.120.315421 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Feng, Y. et al. TLR4/NF-κB signaling pathway-mediated and oxLDL-induced up-regulation of LOX-1, MCP-1, and VCAM-1 expressions in human umbilical vein endothelial cells. Genet. Mol. Research: GMR. 13 (1), 680–695. 10.4238/2014.January.28.13 (2014). [DOI] [PubMed] [Google Scholar]
- 11.9. Pharmacologic approaches to glycemic treatment: standards of medical care in Diabetes-2021. Diabetes Care. 44 (Suppl 1), S111–s24. 10.2337/dc21-S009 (2021). [DOI] [PubMed] [Google Scholar]
- 12.Ma, X. et al. GLP-1 receptor agonists (GLP-1RAs): cardiovascular actions and therapeutic potential. Int. J. Biol. Sci.17 (8), 2050–2068. 10.7150/ijbs.59965 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Bruen, R. et al. Liraglutide attenuates preestablished atherosclerosis in Apolipoprotein E-Deficient mice via regulation of immune cell phenotypes and Proinflammatory mediators. J. Pharmacol. Exp. Ther.370 (3), 447–458. 10.1124/jpet.119.258343 (2019). [DOI] [PubMed] [Google Scholar]
- 14.Tashiro, Y. et al. A glucagon-like peptide-1 analog liraglutide suppresses macrophage foam cell formation and atherosclerosis. Peptides54, 19–26. 10.1016/j.peptides.2013.12.015 (2014). [DOI] [PubMed] [Google Scholar]
- 15.Dai, Y. et al. LOX-1, a Bridge between GLP-1R and mitochondrial ROS generation in human vascular smooth muscle cells. Biochem. Biophys. Res. Commun.437 (1), 62–66. 10.1016/j.bbrc.2013.06.035 (2013). [DOI] [PubMed] [Google Scholar]
- 16.Ma, G. F., Chen, S., Yin, L., Gao, X. D. & Yao, W. B. Exendin-4 ameliorates oxidized-LDL-induced Inhibition of macrophage migration in vitro via the NF-κB pathway. Acta Pharmacol. Sin.35 (2), 195–202. 10.1038/aps.2013.128 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Lin, L. M. et al. Coadministration of VDR and RXR agonists synergistically alleviates atherosclerosis through Inhibition of oxidative stress: an in vivo and in vitro study. Atherosclerosis251, 273–281. 10.1016/j.atherosclerosis.2016.06.005 (2016). [DOI] [PubMed] [Google Scholar]
- 18.Zhang, M. et al. VDR agonist prevents diabetic endothelial dysfunction through Inhibition of Prolyl Isomerase-1-Mediated mitochondrial oxidative stress and inflammation. oxidative medicine and cellular longevity. ;2018:1714896. (2018). 10.1155/2018/1714896 [DOI] [PMC free article] [PubMed]
- 19.Wang, J. M., Chen, A. F. & Zhang, K. Isolation and primary culture of mouse aortic endothelial cells. J. Visualized Experiments: JoVE. 10.3791/52965 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Gamble, J. R. & Vadas, M. A. A new assay for the measurement of the attachment of neutrophils and other cell types to endothelial cells. J. Immunol. Methods. 109 (2), 175–184. 10.1016/0022-1759(88)90240-2 (1988). [DOI] [PubMed] [Google Scholar]
- 21.Lincoff, A. M. et al. Semaglutide and cardiovascular outcomes in obesity without diabetes. N. Engl. J. Med.389 (24), 2221–2232. 10.1056/NEJMoa2307563 (2023). [DOI] [PubMed] [Google Scholar]
- 22.Ussher, J. R. & Drucker, D. J. Glucagon-like peptide 1 receptor agonists: cardiovascular benefits and mechanisms of action. Nat. Reviews Cardiol.20 (7), 463–474. 10.1038/s41569-023-00849-3 (2023). [DOI] [PubMed] [Google Scholar]
- 23.Hasegawa, Y., Hori, M., Nakagami, T., Harada-Shiba, M. & Uchigata, Y. Glucagon-like peptide-1 receptor agonists reduced the low-density lipoprotein cholesterol in Japanese patients with type 2 diabetes mellitus treated with Statins. J. Clin. Lipidol.12 (1), 62–9e1. 10.1016/j.jacl.2017.11.006 (2018). [DOI] [PubMed] [Google Scholar]
- 24.Wu, Y. R. et al. Liraglutide improves lipid metabolism by enhancing cholesterol efflux associated with ABCA1 and ERK1/2 pathway. Cardiovasc. Diabetol.18 (1), 146. 10.1186/s12933-019-0954-6 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Yang, S. H. et al. Liraglutide downregulates hepatic LDL receptor and PCSK9 expression in HepG2 cells and db/db mice through a HNF-1a dependent mechanism. Cardiovasc. Diabetol.17 (1), 48. 10.1186/s12933-018-0689-9 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Akhmedov, A. et al. Endothelial overexpression of LOX-1 increases plaque formation and promotes atherosclerosis in vivo. Eur. Heart J.35 (40), 2839–2848. 10.1093/eurheartj/eht532 (2014). [DOI] [PubMed] [Google Scholar]
- 27.Rakipovski, G. et al. The GLP-1 analogs liraglutide and semaglutide reduce atherosclerosis in ApoE(-/-) and LDLr(-/-) mice by a mechanism that includes inflammatory pathways. JACC Basic. Translational Sci.3 (6), 844–857. 10.1016/j.jacbts.2018.09.004 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Punjabi, M. et al. Liraglutide lowers endothelial vascular cell adhesion Molecule-1 in murine atherosclerosis independent of glucose levels. JACC Basic. Translational Sci.8 (2), 189–200. 10.1016/j.jacbts.2022.08.002 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Mulero, M. C., Huxford, T., Ghosh, G. & NF-κB, I. B. Integral components of immune system signaling. Adv. Exp. Med. Biol.1172, 207–226. 10.1007/978-981-13-9367-9_10 (2019). [DOI] [PubMed] [Google Scholar]
- 30.Sakurai, H., Chiba, H., Miyoshi, H., Sugita, T. & Toriumi, W. IkappaB kinases phosphorylate NF-kappaB p65 subunit on Serine 536 in the transactivation domain. J. Biol. Chem.274 (43), 30353–30356. 10.1074/jbc.274.43.30353 (1999). [DOI] [PubMed] [Google Scholar]
- 31.Pradère, J. P. et al. Negative regulation of NF-κB p65 activity by Serine 536 phosphorylation. Sci. Signal.9 (442), ra85. 10.1126/scisignal.aab2820 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Yue, W., Li, Y., Ou, D. & Yang, Q. The GLP-1 receptor agonist liraglutide protects against oxidized LDL-induced endothelial inflammation and dysfunction via KLF2. IUBMB Life. 71 (9), 1347–1354. 10.1002/iub.2046 (2019). [DOI] [PubMed] [Google Scholar]
- 33.Chang, W. et al. Glucagon-like peptide-1 receptor agonist dulaglutide prevents ox-LDL-induced adhesion of monocytes to human endothelial cells: an implication in the treatment of atherosclerosis. Mol. Immunol.116, 73–79. 10.1016/j.molimm.2019.09.021 (2019). [DOI] [PubMed] [Google Scholar]
- 34.Ying, W. et al. Liraglutide ameliorates oxidized LDL-induced endothelial dysfunction by GLP-1R-dependent downregulation of LOX-1-mediated oxidative stress and inflammation. Redox report: communications in free radical research. ;28(1):2218684. (2023). 10.1080/13510002.2023.2218684 [DOI] [PMC free article] [PubMed]
- 35.Li, D. & Mehta, J. L. Antisense to LOX-1 inhibits oxidized LDL-mediated upregulation of monocyte chemoattractant protein-1 and monocyte adhesion to human coronary artery endothelial cells. Circulation101 (25), 2889–2895. 10.1161/01.cir.101.25.2889 (2000). [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The data that support the findings of this study are available on request from the corresponding author.







