Abstract
Cats are among the most popular pets and can be infested with various intestinal parasites, including those with zoonotic character. The study aimed to evaluate the prevalence of intestinal parasites in owned cats, shelter cats, and felines housed in three Zoos in Slovakia, with special focus on Toxoplasma gondii. Between January 2022 and December 2024, a total of 2261 cats from different areas of the Bratislava region and 80 animals of various feline species from three Zoos situated in Bratislava, Trnava and Banská Bystrica regions were examined using coprological methods. The presence of T. gondii was further confirmed by PCR-based techniques. Intestinal parasites were recorded in 30.6% of the animals, with shelter cats showing a significantly higher prevalence (40.3%) compared to owned cats (29.5%). The most frequently identified parasite was Toxocara cati (13.6%), followed by Giardia spp. (11.9%), Cystoisospora felis (7.2%), and C. rivolta (4.2%). Toxoplasma gondii oocysts were confirmed in 0.4% of the animals. Among 80 Zoo felines representing 11 different species, only T. cati and Toxascaris leonina were detected, with 21 animals (26.3%) testing positive. A statistically significant difference was found between the two species, with 8.8% of animals being positive for T. cati and 23.8% positive for T. leonina. The results confirmed the presence of intestinal parasites in owned and stray cats, as well as the Zoo felines in Slovakia. It underlines the importance of regular parasite control and appropriate treatment to protect both animal and public health.
Keywords: Cat, Felines, Intestinal parasites, Toxoplasma gondii, Zoonotic parasites, Zoological garden
Graphical abstract
Highlights
-
•
Intestinal parasites in household and shelter cats and felines from Zoos in Slovakia were studied during 2022–2024.
•Nearly one-third (30.6 %) of cats were positive for intestinal parasites.
•Significant difference in positivity of owned (29.5 %) and shelter (40.3 %) cats was detected.
•Oocysts of Toxoplasma gondii were detected in 0.4 % of the cats.
•Toxocara cati and Toxascaris leonina were repeatedly detected in various wild feline species housed in Zoos.
1. Introduction
Cats are among the most popular pets worldwide, serving as companion animals and providing emotional support for their owners. Recent reports published by FEDIAF and GlobalPETS revealed that Europe is home to approximately 129 million cats (FlamingoTM, 2024). In fact, cats are top predators capable of adapting to almost any type of environment, particularly near urban settlements, and their feral populations continue to be on the rise across all continents (Chevalier et al., 2021; Fancourt et al., 2021). However, the growing number of animals living in close proximity to humans can contribute to the contamination of the environment and public spaces with infective parasitic stages that are difficult to control and pose a source of infection for animals and humans. Another factor increasing the risk of transmission of parasitic and infectious pathogens is predation. Cats have a very strong hunting instinct, and their often-independent nature makes them more prone to hunting than dogs (Roldan and Otranto, 2023).
Intestinal parasites of pets are of significant concern due to their adverse effects on animal health, as well as due to the zoonotic potential of certain species. Parasitic infections can cause a wide variety of clinical conditions, including gastrointestinal or respiratory signs, coagulopathies, neurological disorders, anaemia, dermatitis, and decreased body condition. Severe cases can be fatal, especially in young or immunocompromised animals (Taylor et al., 2016; Bourgoin et al., 2022). Furthermore, several parasitic species, e.g. Toxoplasma gondii, Toxocara cati or Giardia spp., are important zoonotic parasites causing diseases affecting human health, either through close contact with infected animals or exposure to a contaminated environment (Deplazes et al., 2011; Beugnet et al., 2014). Additionally, there has been a growing trend in recent years to return to a more natural pet diet, with an increasing number of dog and cat owners feeding their animals raw meat-based diets (Freeman et al., 2013; Cornack, 2024). As a result, the risk of transmitting parasitic species that can be spread through raw meat has also increased (Jarošová et al., 2021).
Today, Zoos are not merely places for visitor entertainment; they primarily aim to protect endangered animal species and biodiversity. However, animals in Zoos are kept in conditions that differ greatly from their natural habitats, often confined with others in cages and enclosures with limited space for extended periods. This confinement makes them more vulnerable and susceptible to diseases and infections, including parasitic ones. The occurrence of infections depends on the type of breeding, prophylactic measures and treatment protocols, with hygiene playing a crucial role in controlling the spread of infections (Lim et al., 2008). In the affected animals, heavy parasitic infestations can cause serious health problems or act as predisposing factor of secondary diseases or infections (Panayotova-Pencheva, 2013).
Since 2010, only a few studies have investigated the presence of intestinal parasites in domestic cats in European countries. In general, findings indicate that intestinal parasites are widespread, and their prevalence depends on various risk factors, including lifestyle, geographical location, and frequency of antiparasitic treatment (Mircean et al., 2010; Beugnet et al., 2014; Diakou et al., 2017; Giannelli et al., 2017; Symeonidou et al., 2018; Genchi et al., 2021; Bourgoin et al., 2022). Even fewer studies have examined the occurrence of intestinal parasites in Zoo felines, in many cases, animals were categorized simply as carnivores, without specific species identification (Fagiolini et al., 2010; Panayotova-Pencheva, 2013; Maesano et al., 2014; Esteban Sánchez et al., 2024; Kvapil et al., 2017).
Therefore, the aim of the study was to evaluate the occurrence and prevalence of intestinal parasites in domestic cats kept in households in Slovakia and in felines housed in three Slovak Zoos. Special attention was given to parasitic species with zoonotic potential, particularly Toxoplasma gondii.
2. Material and methods
2.1. Collection of biological material
The sampling of faecal samples took place between January 2022 and December 2024. During this period, faecal samples were collected from 2261 cats (2023 owned and 238 shelter cats) and 80 individuals from various wild feline species.
Cat faeces were collected in cooperation with their owners, veterinarians, and shelter staff in the city of Bratislava and in the surrounding Bratislava region, located in the southwest of Slovakia. The category “owned cats” included animals kept in households as companions or those kept under the supervision of the owner, with limited and at least partially controlled movement in the countryside. The animals were not dewormed at least three months before the sampling. The group of “shelter cats” consisted of stray, lost or abandoned animals that had been captured and placed in shelters. Faecal samples from these cats were collected upon their admission to the shelter, before deworming. Since the exact origin of most of these cats was unknown; this information was not included in the statistical analyses.
Additionally, faecal samples of 80 individuals of various wild feline species were collected in three Zoos located in Bratislava, Trnava and Banská Bystrica regions (one Zoo in each region). Sampling was carried out in cooperation with veterinarians responsible for the animals’ healthcare. The sampled felines represented 11 species: lion (Panthera leo, n = 18), tiger (Panthera tigris, n = 10), leopard (Panthera pardus, n = 18), jaguar (Panthera onca, n = 9), cougar (Puma concolor, n = 4), cheetah (Acinonyx jubatus, n = 4), ocelot (Leopardus pardalis, n = 2), Geoffroy’s cat (Leopardus geoffroyi, n = 3), Eurasian lynx (Lynx lynx, n = 9), caracal (Caracal caracal, n = 2), and serval (Leptailurus serval, n = 1). The animals had not been dewormed for at least three months prior to sampling.
2.2. Coprological examination
Following collection, faecal samples were transported to the laboratory and stored in a refrigerator (at 4–6 °C) prior to parasitological examination, which was performed within 24 h. Samples were examined for the presence of eggs and oocysts of intestinal parasites using standard flotation techniques with zinc sulfate solution (specific gravity 1.18–1.20) and Sheater’s sucrose solution (specific gravity 1.27–1.30). Approximately 3 g of faeces were mixed with water, passed through the sieve and centrifuged for 3 min at 2000 rpm. After discarding the supernatant, the sediment was mixed with a flotation solution, filling two-thirds of the test tube, stirred, and centrifuged again. Then, the test tube was filled with flotation solution until a meniscus formed at the top and covered with a cover glass. After 10 min, the cover glass was carefully removed, placed on a microscope slide, and detected eggs and oocysts were identified based on their morphological characteristics under a light microscope. Because the oocysts of Toxoplasma gondii and Hammondia hammondi are indistinguishable under microscopy, they were reported as T. gondii/H. hammondi oocysts and were later identified using molecular methods.
2.3. Molecular analyses
Feacal samples testing positive for T. gondii/H. hammondi oocysts were further analysed by PCR-based methods. Genomic DNA was extracted using the QIAamp DNA Stool Mini Kit (Qiagen, Hilden, Germany), following the manufacturer’s instructions. To identify T. gondii infection, three different gene fragments were targeted for amplification. Initially, a PCR assay targeting a 191-bp fragment of the TGR1E gene, as described by Lamoril et al. (1996), was used. As all tested samples were negative, additional analyses were performed using a heminested PCR targeting a 362-bp fragment of the B1 gene (Pujol-Riqué et al., 1999) and a nested PCR amplifying a 96-bp fragment the B1 gene (Jones et al., 2000) (Table 1).
Table 1.
Primer sequences and annealing temperatures used for amplification of Toxoplasma gondii gene fragments.
| Gene fragment | Primer | Primer sequence (5’-3’) | Annealing temperature | Reference |
|---|---|---|---|---|
| TGR1E (191 bp) | TGR1E 1 | ATGGTCCGGCCGGTGTATGATATGCGAT | 63 °C | Lamoril et al. (1996) |
| TGR1E 2 | TCCCTACGTGGTGCCGCATTGCCT | |||
| B1 (362 bp)a | B1a | GAGAGGTCCGCCCCCACAAG | 56 °C (1st PCR); 58 °C (2nd PCR) | Pujol-Riqué et al. (1999) |
| B1b | CTGCTGGTGCGAGGGGAGTG | |||
| B1c | CAGGAGTTGGATTTTGTAGA | |||
| B1 (96 bp)b | B1a out | GGAACTGCATCCGTTCATGAG | 57 °C (1st PCR); 63 °C (2nd PCR) | Jones et al. (2000) |
| B1b out | TCTTTAAAGCGTTCGTGGTC | |||
| B1c int | TGCATAGGTTGCAGTCACTG | |||
| B1d int | GGCGACCAATCTGCGAATACACC |
Heminested PCR.
Nested PCR.
To exclude the possibility of contamination with specific DNA, a negative control was included in each set of samples positive for T. gondii/H. hammondi during DNA extraction. Additionally, another negative control (water) was used in each PCR run. Moreover, all standard precautions recommended for minimizing the risk of contamination were strictly followed.
Positive PCR products were purified using the ExoSAP IT PCR Express Product Cleanup Reagent (Thermo Fisher Scientific, USA) and sequenced in both directions. The resulting nucleotide sequences were compared to GenBank entries using Basic Local Alignment Search Tool (BLAST) (Altschul et al., 1990) to determine sequence identity and species confirmation.
2.4. Statistical analyses
The prevalence values of parasitic infection in the examined animals were reported with a 95% confidence interval (95% CI). Chi-square test (χ2) with Yates’ continuity correction was used to test the differences in the prevalence of parasitic species and the occurrence of parasites among animal groups, with a significance level of P < 0.05. Yates’ chi-square test is a modified version of standard chi-square test, designed to correct for small sample sizes or situations with low expected frequencies in contingency tables. It is adjusted for small expected frequencies to reduce the likelihood of detecting spurious associations. Statistical analyses were performed using the Quantitative Parasitology on the Web software (Reiczigel et al., 2019).
3. Results
3.1. Intestinal parasites in domestic cats
During the monitored period, a total of 2261 cats were examined, and intestinal parasites were detected in 692 (30.6%) of animals. Parasitic infections occurred significantly more often (χ2(1) = 11.4, P = 0.0008) in shelter cats with 40.3% (n = 96) positive cases, compared to owned cats, where 29.5% (n = 596) tested positive (Table 2). The most frequent parasite was the nematode Toxocara cati, found in 13.6% of the cats, followed by the protozoan parasites Giardia spp. (11.9%), Cystoisospora felis (7.2%), and C. rivolta (4.2%). The prevalence of other parasites was lower, ranging from 0.04% to 1.5%. When analysing infection based on cat origin, a similar trend was observed in owned cats. However, among shelter cats, Giardia spp. (16.8%) slightly outnumbered T. cati infections (16.4%) (Table 2). In addition to Giardia spp. and T. cati, other parasites with zoonotic potential detected in both owned and shelter cats included T. gondii, Taenia spp., and Ancylostoma spp. (Table 2).
Table 2.
Overall prevalence of the intestinal parasites in owned and shelter cats studied during 2022–2024 in Slovakia.
| Species | Owned cats (N = 2023) |
Shelter cats (N = 238) |
χ2-value (P-value) | Total (N = 2261) |
|||
|---|---|---|---|---|---|---|---|
| n | P% (95% CI) | n | P% (95% CI) | n | P% (95% CI) | ||
| Giardia spp.a | 229 | 11.3 (10.0–12.8) | 40 | 16.8 (12.3–22.2) | 5.6 (0.02) | 269 | 11.9 (10.6–13.3) |
| Cystoisospora felis | 138 | 6.8 (5.8–8.0) | 24 | 10.1 (6.6–14.6) | 2.9 (0.09) | 162 | 7.2 (6.1–8.3) |
| Cystoisospora rivolta | 80 | 4.0 (0.2–0.8) | 15 | 6.3 (3.6–10.2) | 2.4 (0.12) | 95 | 4.2 (3.4–5.1) |
| Toxoplasma gondiia | 8 | 0.4 (0.2–0.8) | 1 | 0.4 (0.0–2.3) | 0.2 (0.62) | 9 | 0.4 (0.2–0.8) |
| T. gondiia/Hammondia hammondi | 11 | 0.5 (0.3–1.0) | 0 | 0 (0.0–1.3) | 0.4 (0.51) | 11 | 0.5 (0.2–0.9) |
| Taenia spp.a | 5 | 0.2 (0.1–0.6) | 1 | 0.4 (0.0–2.3) | 0.03 (0.86) | 6 | 0.3 (0.1–0.6) |
| Ancylostoma spp.a | 5 | 0.2 (0.1–0.6) | 1 | 0.4 (0.0–2.3) | 0.03 (0.86) | 6 | 0.3 (0.1–0.6) |
| Capillaria spp. | 31 | 1.5 (1.0–2.2) | 3 | 1.3 (0.3–3.6) | 0.002 (0.96) | 34 | 1.5 (1.0–2.1) |
| Toxascaris leonina | 1 | 0 (0.0–0.3) | 0 | 0 (0.0–1.3) | 1.7 (0.20) | 1 | 0.04 (0.0–0.3) |
| Toxocara catia | 269 | 13.3 (11.9–14.9) | 39 | 16.4 (11.9–21.7) | 1.5 (0.22) | 308 | 13.6 (12.2–15.1) |
| Trichuris spp. | 5 | 0.2 (0.1–0.6) | 0 | 0 (0.0–1.3) | 0.001 (0.97) | 5 | 0.2 (0.1–0.5) |
| Total | 596 | 29.5 (28.6–31.5) | 96 | 40.3 (34.1–46.9) | 11.4 (0.0008) | 692 | 30.6 (28.7–32.6) |
Abbreviations: N, total number examined; n, number of positive cats; P%, prevalence in %; 95% CI, 95% confidence interval.
Parasites with zoonotic potential.
Oocysts of T. gondii/H. hammondi were detected in 20 animals. After applying molecular methods, nine (0.4%) cats were confirmed to be infected with T. gondii, eight of which were owned (0.4%) and one (0.4%) from a shelter. In the remaining 11 cats, T. gondii-specific PCR was negative. However, since H. hammondi-specific PCR was not performed and PCR inhibition could not be ruled out, these cases are reported as T. gondii/H. hammondi-positive (Table 2).
To confirm the presence of T. gondii oocysts, three different PCR methods were applied: one targeting a fragment of the TGR1E gene and two (nested and heminested PCR) targeting fragments of the B1 gene. The heminested PCR approach, with nine positive samples, appears to be the most sensitive for detecting T. gondii DNA extracted from faecal samples, as no samples were positive using TGR1E PCR, and seven were positive using the B1 nested PCR (all positive also in heminested PCR) (Table 3). Because the B1 nested PCR fragment was short (96 bp), only the sequences of isolates detected using heminested PCR were deposited in the GenBank database under the accession numbers PQ999203 and PV283223-PV283230.
Table 3.
Results of different PCR methods used for detecting Toxoplasma gondii DNA in cat faecal samples.
| PCR approach | No. examined | No. positive | GenBank ID |
|---|---|---|---|
| TGR1E (191 bp) | 20 | 0 | – |
| B1 heminested PCR (362 bp) | 20 | 9 | PQ999203, PV283223-PV283230 |
| B1 nested PCR (96 bp) | 20 | 7 | – |
The number of cats examined each year was similar (706 in 2022, 727 in 2023, and 828 in 2024). Similar (χ2(2) = 0.079, P = 0.96) were also the overall infection rates (30.3%, 31.1%, and 30.4%, respectively). However, statistical analyses showed significantly higher prevalence (P < 0.05) of intestinal parasites in shelter cats than in owned cats in each year of the study (Table 4).
Table 4.
Intestinal parasite species in owned and shelter cats studied during 2022–2024 in Slovakia.
| Species | 2022 (N = 706) |
2023 (N = 727) |
2024 (N = 828) |
|||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Owned cats (N = 624) |
Shelter cats (N = 82) |
Owned cats (N = 655) |
Shelter cats (N = 72) |
Owned cats (N = 744) |
Shelter cats (N = 84) |
|||||||
| n | P% (95% CI) | n | P% (95% CI) | n | P% (95% CI) | n | P% (95% CI) | n | P% (95% CI) | n | P% (95% CI) | |
| Giardia spp.a | 68 | 10.9 (8.6–13.6) | 21 | 25.6 (16.7–36.4) | 84 | 12.8 (10.4–15.6) | 9 | 12.5 (5.9–22.4) | 77 | 10.3 (8.3–12.8) | 10 | 11.9 (5.9–20.8) |
| Cystoisospora felis | 31 | 5.0 (3.4–7.0) | 6 | 7.3 (2.7–15.3) | 54 | 8.2 (6.3–10.6) | 7 | 9.7 (4.0–19.0) | 53 | 7.1 (5.4–9.2) | 11 | 13.1 (6.7–22.2) |
| Cystoisospora rivolta | 25 | 4.0 (2.6–5.9) | 9 | 11.0 (5.1–19.8) | 27 | 4.1 (2.7–5.9) | 3 | 4.2 (0.9–11.7) | 28 | 3.8 (2.5–5.4) | 3 | 3.6 (0.7–10.1) |
| Toxoplasma gondiia | 4 | 0.6 (0.2–1.6) | 0 | 0 (0.0–0.4) | 2 | 0.3 (0.1–1.3) | 1 | 1.4 (0.0–7.5) | 2 | 0.3 (0.0–1.0) | 0 | 0 (0.0–3.5) |
| T. gondiia/Hammondia hammondi | 2 | 0.3 (0.0–1.2) | 0 | 0 (0.0–0.4) | 2 | 0.3 (0.1–1.3) | 0 | 0.0 (0.0–0.4) | 7 | 0.9 (0.4–1.9) | 0 | 0 (0.0–3.5) |
| Taenia spp.a | 1 | 0.2 (0.0–1.0) | 1 | 1.2 (0.0–6.6) | 1 | 0.2 (0.0–0.9) | 0 | 0.0 (0.0–0.4) | 3 | 0.4 (0.1–1.2) | 0 | 0 (0.0–3.5) |
| Ancylostoma spp.a | 3 | 0.5 (0.1–1.4) | 0 | 0 (0.0–0.4) | 1 | 0.2 (0.0–0.9) | 1 | 1.4 (0.0–7.5) | 1 | 0.1 (0.0–0.8) | 0 | 0 (0.0–3.5) |
| Capillaria spp. | 3 | 0.5 (0.1–1.4) | 0 | 0 (0.0–0.4) | 10 | 1.5 (0.7–2.8) | 2 | 2.8 (0.3–9.7) | 18 | 2.4 (1.4–3.8) | 1 | 0.1 (0.0–6.5) |
| Toxascaris leonina | 1 | 0.2 (0.0–1.0) | 0 | 0 (0.0–0.4) | 0 | 0 (0.0–0.5) | 0 | 0 (0.0–0.4) | 0 | 0 (0.0–0.4) | 0 | 0 (0.0–3.5) |
| Toxocara catia | 87 | 13.9 (11.3–16.9) | 17 | 20.7 (12.6–31.1) | 87 | 13.3 (10.8–16.1) | 6 | 8.3 (3.1–17.3) | 95 | 12.8 (10.5–15.4) | 16 | 19.0 (11.3–29.1) |
| Trichuris spp. | 2 | 0.3 (0.0–1.2) | 0 | 0 (0.0–0.4) | 1 | 0.2 (0.0–0.9) | 0 | 0 (0.0–0.4) | 2 | 0.3 (0.0–1.0) | 0 | 0 (0.0–3.5) |
| Total positive | 174 | 27.9 (24.4–31.6) | 40 | 48.8 (37.6–67.1) | 204 | 31.1 (27.6–34.9) | 22 | 30.6 (20.2–42.5) | 218 | 29.3 (26.1–32.7) | 34 | 40.5 (29.9–51.8) |
| χ2-value (P-value) | 14.0 (0.0001) | 1.0 (0.001) | 3.9 (0.04) | |||||||||
Abbreviations: N, total number examined; n, number of positive cats; P%, prevalence in %; 95% CI, 95% confidence interval.
Parasites with zoonotic potential.
Protozoans were the most commonly detected parasites, with 19.5% (n = 440) of the cats infected, and with shelter cats being positive significantly more often (24.3%; χ2(1) = 4.1, P = 0.043) than owned cats (18.9%). Cestodes were detected in only 1.7% (n = 35) of owned cats. Nematodes were found in 14.1% (n = 319) of the cats, with no significant difference between owned (13.9%) and shelter cats (15.5%). Overall, the difference in the occurrence of parasitic protozoans, cestodes and nematodes was statistically significant (χ2(2) = 369.9, P < 0.00001) (Table 5).
Table 5.
Occurrence of parasitic protozoans, cestodes and nematodes in owned and shelter cats studied during 2022–2024 in Slovakia.
| Parasite group | 2022 (N = 706) |
2023 (N = 727) |
2024 (N = 828) |
Total (N = 2261) |
|||||
|---|---|---|---|---|---|---|---|---|---|
| Owned cats (N = 624) |
Shelter cats (N = 82) |
Owned cats (N = 655) |
Shelter cats (N = 72) |
Owned cats (N = 744) |
Shelter cats (N = 84) |
Owned cats (N = 2023) |
Shelter cats (N = 238) |
χ2-value (P-value) |
|
| n (%) | n (%) | n (%) | n (%) | n (%) | n (%) | n (%) | n (%) | ||
| Protozoans | 114 (18.3) | 29 (35.4) | 137 (20.9) | 16 (22.2) | 131 (17.6) | 13 (15.5) | 382 (18.9) | 58 (24.3) | 4.1 (0.043) |
| Cestodes | 30 (0.5) | 0 (0) | 1 (0.2) | 0 (0) | 4 (0.5) | 0 (0) | 35 (1.7) | 0 (0) | 3.1 (0.08) |
| Nematodes | 92 (14.7) | 17 (20.7) | 91 (13.9) | 6 (8.3) | 99 (13.3) | 14 (16.7) | 282 (13.9) | 37 (15.5) | 0.3 (0.57) |
Abbreviations: N, total number examined; n, number of positive cats.
In most cats, only a single parasitic species was detected. Out of the 692 positive cats, 532 (76.9%) were infected with one species, 114 (16.5%) with two, 27 (3.9%) with three, and 3 (0.4%) and 1 (0.1%) cat with four and five parasitic species, respectively (Table 6). When analysed by origin, single-species infections were found in 31.5% of shelter cats and 22.6% of owned cats, this difference being statistically significant (χ2(1) = 8.9, P = 0.003) (Table 6). Single infections with T. cati were detected in 214 cats, with Giardia spp. in 178 cats, with C. felis in 81 cats, with C. rivolta in 29 cats, and with Capillaria spp. in 11 cats. Single infections with T. gondii, T. gondii/H. hammondi, Ancylostoma spp., Toxascaris leonina, or Taenia spp. were confirmed in only one or two animals each.
Table 6.
Number of parasite species in owned and shelter cats studied during 2022–2024 in Slovakia.
| No. of species | 2022 (N = 706) |
2023 (N = 727) |
2024 (N = 828) |
Total (N = 2261) |
|||||
|---|---|---|---|---|---|---|---|---|---|
| Owned cats (N = 624) |
Shelter cats (N = 82) |
Owned cats (N = 655) |
Shelter cats (N = 72) |
Owned cats (N = 744) |
Shelter cats (N = 84) |
Owned cats (N = 2023) |
Shelter cats (N = 238) |
χ2-value (P-value) |
|
| n (%) | n (%) | n (%) | n (%) | n (%) | n (%) | n (%) | n (%) | ||
| One species | 150 (24.0) | 31 (37.8) | 152 (23.2) | 17 (23.6) | 155 (20.8) | 27 (32.1) | 457 (22.6) | 75 (1.5) | 8.9 (0.003) |
| Two species | 29 (4.6) | 4 (4.9) | 41 (6.3) | 3 (4.2) | 37 (4.9) | 0 (0) | 107 (5.3) | 7 (2.9) | 2.0 (0.16) |
| Three species | 4 (0.6) | 5 (6.1) | 6 (0.9) | 1 (1.4) | 11 (1.5) | 0 (0.0) | 21 (1.0) | 6 (2.5) | 2.8 (0.09) |
| Four species | 1 (0.2) | 0 (0) | 2 (0.3) | 0 (0) | – | – | 3 (0.1) | 0 (0) | 0.12 (0.73) |
| Five species | – | – | – | – | 1 (0.1) | 0 (0) | 1 (0.05) | 0 (0) | 1.7 (0.2) |
Abbreviation: N, total number examined; n, number of positive cats.
Two parasite species were detected in 33 cats in 2022, in 44 cats in 2023, and in 37 cats in 2024, with double infections more common in owned (5.3%) than in shelter animals (2.9%) (Table 6). The most frequent combination was Giardia spp. + T. cati (27 cats), followed by C. felis + T. cati (18 cats), C. felis + C. rivolta (17 cats) and Giardia spp. + C. felis (15 cats).
Three-species infections were found in 9, 7 and 11 cats in 2022, 2023, 2024, respectively (Table 6). The most common combination was Giardia spp. + C. felis + C. rivolta (6 cats), followed by Giardia spp. + C. felis + T. cati (5 cats). Combination of four or five species included: Giardia spp. + C. rivolta + Capillaria spp. + T. cati in one owned cat in 2022; Giardia spp. + C. felis + C. rivolta + T. cati in two owned cats in 2023, and Giardia spp. + C. felis + Capillaria spp. + Taenia spp. + T. cati in one cat in 2024.
3.2. Intestinal parasites in felines in Zoos
Among the 80 animals belonging to 11 different species of felines from Zoos, only T. cati and T. leonina were detected in a total of 21 (26.3%) animals. A statistically significant difference in prevalence was observed between the two parasite species (χ2(1) = 5.6, P = 0.02), with 8.8% of animals testing positive for T. cati and 23.8% for T. leonina (Table 7). When analysing by year, the overall infection rates (30.6% in 2022, 27.6% in 2023 and 30.8% in 2024) did not differ significantly (χ2(2) = 0.45, P = 0.80), and a statistically significant difference in the prevalence of T. cati and T. leonina was found only in 2023 (χ2(1) = 5.2, P = 0.02). Parasites were consistently detected in lions and cougars each year, while animals of other species tested positive only occasionally (Table 8). As it is possible, that the same individual animals (e.g. lions, tigers, leopards, cougars) were examined every year, the overall prevalence of infection per species over the entire study period was not calculated.
Table 7.
Overall positivity of felines from three Zoos for intestinal parasites in 2022–2024 in Slovakia.
| Parasite | n/N | P% (95% CI) | χ2-value (P-value) |
|---|---|---|---|
| Toxocara catia | 7/80 | 8.8 (3.6–17.2) | 5.6 (0.02) |
| Toxascaris leonina | 19/80 | 23.8 (15.0–34.9) | |
| Total | 21/80 | 26.3 (17.0–37.3) | – |
Abbreviations: n, number of positive; N, number of examined; P%, prevalence in %; 95% CI, 95% confidence interval.
Parasite with zoonotic potential.
Table 8.
Occurrence of intestinal parasites in felines studied in the three Zoos in Slovakia in 2022, 2023 and 2024.
| Species | 2022 |
2023 |
2024 |
||||||
|---|---|---|---|---|---|---|---|---|---|
|
T. cati |
T. leonina |
Total |
T. cati |
T. leonina |
Total |
T. cati |
T. leonina |
Total |
|
| n/N | n/N | n/N | n/N | n/N | n/N | n/N | n/N | n/N | |
| Lion (Panthera leo) | 0/6 | 4/6 | 4/6 | 1/7 | 4/7 | 5/7 | 0/5 | 3/5 | 3/5 |
| Tiger (Panthera tigris) | ne | ne | ne | 0/6 | 1/6 | 1/6 | 0/4 | 1/4 | 1/4 |
| Leopard (Panthera pardus) | 0/7 | 0/7 | 0/7 | 0/6 | 0/6 | 0/6 | 0/5 | 0/5 | 0/5 |
| Jaguar (Panthera onca) | 0/4 | 0/4 | 0/4 | 0/3 | 0/3 | 0/3 | 0/2 | 0/2 | 0/2 |
| Cougar (Puma concolor) | 0/1 | 1/1 | 1/1 | 0/1 | 1/1 | 1/1 | 0/2 | 1/2 | 1/2 |
| Cheetah (Acinonyx jubatus) | 0/1 | 1/1 | 1/1 | 0/1 | 1/1 | 1/1 | 0/2 | 0/2 | 0/2 |
| Ocelot (Leopardus pardalis) | 0/1 | 0/1 | 0/1 | 0/1 | 0/1 | 0/1 | ne | ne | ne |
| Geoffroy’s cat (Leopardus geoffroyi) | 0/1 | 0/1 | 0/1 | 0/1 | 0/1 | 0/1 | 0/1 | 0/1 | 0/1 |
| Eurasian lynx (Lynx lynx) | 3/4 | 1/4 | 3/4 | 0/1 | 0/1 | 0/1 | 3/4 | 0/4 | 3/4 |
| Caracal (Caracal caracal) | ne | ne | ne | 0/1 | 0/1 | 0/1 | 0/1 | 0/1 | 0/1 |
| Serval (Leptailurus serval) | ne | ne | ne | 0/1 | 0/1 | 0/1 | ne | ne | ne |
| Total | 3/25 (12.0%) | 7/25 (28.0%) | 9/25 (36.0%) | 1/29 (3.4%) | 7/29 (24.1%) | 8/29 (27.6%) | 3/26 (11.5%) | 5/26 (19.2%) | 8/26 (30.8%) |
| 95% CI (%) | 2.6–31.2 | 12.1–49.4 | 18.0–57.5 | 0.1–17.8 | 10.3–43.5 | 12.7–47.2 | 2.5–30.1 | 6.6–39.4 | 14.3–51.8 |
| χ2-value (P-value) | 2 (0.16) | – | 5.2 (0.02) | – | 0.59 (0.449) | – | |||
Note: Due to the low number of examined animals, only the overall prevalence of parasites in all animals examined per year was calculated.
Abbreviations: n, number of positive; N, number of examined; ne, not examined; 95% CI, 95% confidence interval.
4. Discussion
The present survey provides an overview on intestinal parasite infestations in cat population in Slovakia between 2022 and 2024. It demonstrates that nearly one-third (30.6%) of the 2261 cats examined carried at least one parasite at the time of testing, with shelter cats being positive significantly more often (40.3%) than owned cats (29.5%). A similar prevalence of gastrointestinal parasites (35.9%) was observed in 2020 in 987 cats in Italy (Genchi et al., 2021). Likewise, an earlier study involving 1519 owned cats from France, Italy and Austria, Belgium, Hungary, Romania, and Spain found 35.1% animals positive for endoparasites (Beugnet et al., 2014). In contrast, a study conducted in France between November 2017 and July 2018 found that only 14.6% of 414 cats harboured at least one parasite species (Bourgoin et al., 2022). A significant difference between stray (32.9%) and owned animals (16.5%) was also recorded in an earlier study by Miró et al. (2004), who examined 317 stray and 220 household cats in Spain. The discrepancies in parasites prevalence across studies and countries may be influenced by several factors, including the age, living conditions and lifestyle of the cats, frequency of deworming, diet, presence of other animals, and differences in coprological techniques and the experience of the personell performing the examinations.
In the presented study, the most prevalent parasitic species were Toxocara cati (13.6%) and Giardia spp. (11.9%), both of which have zoonotic potential. Larval toxocariasis, a human disease caused by Toxocara spp., is asymptomatic in many patients, but can also lead to clinical illness. The main clinical syndromes of toxocariasis are visceral larva migrans (VLM), with symptoms of lung and liver damage, ocular larva migrans (OLM), which involves the eyes, and neural larva migrans (NLM) associated with neurological symptoms (Despommier, 2003).
Giardia spp., flagellate protozoans, are common cause of acute gastroenteritis in humans and many animal species worldwide. Clinical signs vary but often include diarrhoea, abdominal pain, anorexia, and weight loss (Mravcová et al., 2019; Kurnosova et al., 2024). Currently, six Giardia species are considered taxonomically valid: G. agilis in amphibians, G. ardeae and G. psittaci in birds, G. microti and G. muris in rodents, and G. duodenalis in mammals. Of these, G. duodenalis is the only species that infects humans (Ryan and Cacciò, 2013).
Both species, T. cati and Giardia spp., occurred more often in shelter cats than in owned cats, suggesting that animals that can move freely in their environment without the owner supervision are at greater risk of infection. Toxocara cati was the most common intestinal parasite (19.7%) also in the study of Beugnet et al. (2014), where Giardia spp. occurred in only 3.2% of examined cats. Contrariwise, Giardia spp. were reported in 22.47–36.84% of 156 owned cats examined in Italy in 2010–2011, while T. cati occurred less frequently (5.26–22.39%), depending on geographical origin (Zanzani et al., 2014). More recently, a study conducted between 2018 and 2021 in Moscow, Russia, found that 5.26% of cats were infected with Giardia spp. and 4.15% with T. cati (Kurnosova et al., 2023).
Another zoonotic parasite identified in both owned and shelter cats (at the same prevalence of 0.4%) was T. gondii. Toxoplasmosis is a foodborne parasitic disease of global concern that poses a significant risk especially for pregnant women and immunosuppressed people. In healthy adults, the infection usually remains asymptomatic and does not cause serious illness. However, in immunocompromised individuals, toxoplasmosis can cause clinically apparent and potentially fatal disease and infection during pregnancy may result in spontaneous abortion or congenital defects such as blindness and mental retardation in the child (Montoya and Liesenfeld, 2004; Machala et al., 2015). Toxoplasmosis also affects livestock, particularly sheep and goats, where it can cause abortions and consequently financial losses for farmers. As the only source of oocysts, domestic and wild felines play a crucial role in the ecology and epidemiology of T. gondii (Montoya and Liesenfeld, 2004). In the present study, T. gondii oocysts were shed by nine (0.4%) cats. Another 11 (0.5%) animals shed oocysts identified only as T. gondii/H. hammondi. Since the possibility of false-negative T. gondii PCR results cannot be completely excluded, its actual prevalence may be higher, potentially up to 0.9%. Similarly, in a recent study in Romania, T. gondii-like oocysts were found in five of 31 examined cats, although PCR confirmation was positive in only two of them (Györke et al., 2024). An analysis of reports published before 2008 estimated that approximately 1% of all domestic cats are shedding oocysts at any given time (Dubey, 2008). A later meta-analysis of Hatam-Nahavandi et al. (2021) reported a 2.6% global pooled prevalence of domestic cats shedding oocyst. However, several factors may influence shedding prevalence, including the cats’ living conditions, diet, diagnostic methods used, and laboratory personnel expertise. Zhu et al. (2023) additionally reported a positive association between higher oocyst shedding prevalence and both human population density at sampling sites and greater mean diurnal temperature ranges.
Among the parasites identified in the present study, some species belonging to the genera Taenia and Ancylostoma may also have zoonotic potential. Only six (0.3%) cats tested positive for taeniid eggs, but identification to the species level was not possible. We assume that two tapeworm species may have been present in the examined cats, Taenia taeniaeformis, a relatively common cestode in cats that actively hunt (Lima and Piero, 2021), and Echinococcus multilocularis, zoonotic and the most pathogenic taeniid species for humans. The latter species is considered endemic in Slovakia, where it commonly occurs in red foxes and has also been reported in humans (Antolová et al., 2024). Nevertheless, its epidemiological significance in cats is believed to be low, due to typically low worm burdens and correspondingly minimal egg shedding. Therefore, cats are considered of minor importance in the maintenance of the E. multilocularis life cycle and its zoonotic transmission (Deplazes et al., 2011).
Ancylostoma spp. eggs were also detected in 0.3% cats what is much lower than in the studies from Greece (16.2%), Italy (7.2%) or Portugal (19.1%) (Spada et al., 2013; Waap et al., 2014; Symeonidou et al., 2018). Such discrepancies may be attributed to the warmer climate conditions in southern Europe compared to Slovakia, as higher temperatures and humidity favour the survival of hookworm larvae in the environment (Symeonidou et al., 2018).
In the present study, protozoans were the most frequently detected parasites, with a total of 440 (19.5%) positive cats. In addition to previously mentioned Giardia spp. and T. gondii, Cystoisospora felis and C. rivolta were found in 7.2% and 4.2% of cats, respectively. Over the past two decades, data on the prevalence of coccidia in cats in Europe have been relatively scarce. Reported prevalence of Cystoisospora spp. typically ranged from 4% to 10% and up to 46% reported in stray cats in Lisbon, Portugal (Beugnet et al., 2014; Waap et al., 2014; Dubey, 2018). Of the two species, C. rivolta is considered more pathogenic, likely due to the location of its development, since C. felis multiplies in surface epithelial enterocytes, whereas C. rivolta develops in enterocytes in the Lieberkühn glands (Dubey, 2018).
Across all monitored years, 2022, 2023 and 2024, the overall parasite positivity rate among cats remained consistent, averaging around 30%. In each year, a significantly higher prevalence of parasites was recorded in shelter cats compared to owned animals. This finding is consistent with the results of most studies comparing stray or shelter cats to household cats (Beugnet et al., 2014; Baneth et al., 2016; Szwabe and Błaszkowska, 2017; Roldan and Otranto, 2023). The higher prevalence of parasites in stray or shelter cats is primarily attributed to a lack of preventative measures and the possibility of hunting and feeding on infected prey.
In most positive cats (76.9% out of 692 positives), only one parasitic species was detected, followed by two, three and four or five species per animal. Infections with one species were significantly more common in shelter cats. However, the simultaneous presence of two, four and five parasitic species was more frequently observed in owned cats, although these differences were not statistically significant. This suggests that owned cats with outdoor access, who may hunt rodents and other prey, and lack of veterinary care, are at similar risk of parasitic infection as stray animals.
The parasite fauna of domestic and wild cats, including those living in captivity, is largely similar because they can be infected with the same endoparasite species (Mederle et al., 2023). In the present study, only T. cati and T. leonina were recorded each year in various species of felines kept in Zoos, with no other nematodes, cestodes, or protozoans detected. This indicates a generally high standard of health care and parasite control in the participating Zoos. However, the repeated occurrence of Toxocara and Toxascaris spp. may be linked to the high resistance of their eggs, which can remain infectious for up to two years in the environment (Overgaauw and van Knapen, 2000). Thus, despite regular deworming, reinfection may occur annually due to the persistence of viable eggs in the soil or Zoo enclosures.
Finally, it is necessary to note that the actual prevalence of parasites in the examined cats may be higher than reported. Several factors could influence the results of coprological examinations, e.g. sensitivity of diagnostic methods. Moreover, as samples were collected at a single time point, the intermittent shedding of parasite eggs or oocysts throughout their life cycle could have led to an underestimation of the true prevalence, as also reported by Beugnet et al. (2014).
5. Conclusions
The results of the present study confirmed the common and ongoing presence of T. gondii, T. cati and other intestinal parasites in both owned and stray cats in Slovakia. The clinical significance and zoonotic potential of several parasitic pathogens underline the necessity of regular parasite control in these animals and appropriate treatment. Similarly, the presence of parasites in Zoo animals emphasizes the importance of regular monitoring and control measures in zoological facilities. Implementing routine faecal examinations, maintaining proper hygiene, and managing stray animal populations are crucial steps toward reducing the risk these parasites pose to both animal and public health.
CRediT authorship contribution statement
Daniela Antolová: Conceptualization, Validation, Funding, Methodology, Writing – original draft, Writing – review & editing. Daniela Valentová: Conceptualization, Resources, Methodology, Formal analysis, Writing – review & editing. Katarína Strišková: Resources, Methodology, Writing – review & editing. Dominik Kaňuk: Methodology, Writing – review & editing.
Ethical approval
This study was conducted according to the guidelines of the Declaration of Helsinki, as revised in 2013, and approved by the Ethics Committee of the Institute of Parasitology, SAS, under the Statement EK/01/2020 issued on 30 July 2020. All cat owners agreed the participation in the study and signed informed consent forms.
Funding
This study was financially supported by the project VEGA 2/0024/24.
Declaration of competing interests
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Data availability
The data supporting the conclusions of this article are included within the article.
References
- Altschul S.F., Gish W., Miller W., Myers E.W., Lipman D.J. Basic local alignment search tool. J. Mol. Biol. 1990;215:403–410. doi: 10.1016/S0022-2836(05)80360-2. [DOI] [PubMed] [Google Scholar]
- Antolová D., Šnábel V., Jarošová J., Cavallero S., D’Amelio S., Syrota Y., et al. Human alveolar echinococcosis in Slovakia: epidemiology and genetic diversity of Echinococcus multilocularis, 2000–2023. PLoS Negl. Trop. Dis. 2024;18 doi: 10.1371/journal.pntd.0011876. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Baneth G., Thamsborg S.M., Otranto D., Guillot J., Blaga R., Deplazes P., Solano-Gallego L. Major parasitic zoonoses associated with dogs and cats in Europe. J. Comp. Pathol. 2016;155:S54–S74. doi: 10.1016/j.jcpa.2015.10.179. [DOI] [PubMed] [Google Scholar]
- Beugnet F., Bourdeau P., Chalvet-Monfray K., Cozma V., Farkas R., Guillot J., et al. Parasites of domestic owned cats in Europe: Co-infestations and risk factors. Parasites Vectors. 2014;7:291. doi: 10.1186/1756-3305-7-291. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bourgoin G., Callait-Cardinal M.P., Bouhsira E., Polack B., Bourdeau P., Roussel Ariza C., et al. Prevalence of major digestive and respiratory helminths in dogs and cats in France: Results of a multicenter study. Parasites Vectors. 2022;15:314. doi: 10.1186/s13071-022-05368-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chevalier V., Davun H., Sorn S., Ly P., Pov V., Ly S. Large scale dog population demography, dog management and bite risk factors analysis: A crucial step towards rabies control in Cambodia. PLoS One. 2021;16 doi: 10.1371/journal.pone.0254192. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cornack K. Frontiers Pets. 2024. The ultimate guide to a raw meat cat food: Meat-based diet for cats.https://frontierpets.com.au/blogs/beyond-the-bowl/ultimate-guide-to-raw-meat-cat-food?srsltid=AfmBOopancC7fBhFZ91hNlOzScg6tUELCqowG2QbID8IDni_E6TqwceD Accessed 21 March 2025. [Google Scholar]
- Deplazes P., van Knapen F., Schweiger A., Overgaauw P.A. Role of pet dogs and cats in the transmission of helminthic zoonoses in Europe, with a focus on echinococcosis and toxocarosis. Vet. Parasitol. 2011;182:41–53. doi: 10.1016/j.vetpar.2011.07.014. [DOI] [PubMed] [Google Scholar]
- Despommier D. Toxocariasis: clinical aspects, epidemiology, medical ecology, and molecular aspects. Clin. Microbiol. Rev. 2003;16:265–272. doi: 10.1128/CMR.16.2.265-272.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Diakou A., Sofroniou D., Di Cesare A., Kokkinos P., Traversa D. Occurrence and zoonotic potential of endoparasites in cats of Cyprus and a new distribution area for Troglostrongylus brevior. Parasitol. Res. 2017;116:3429–3435. doi: 10.1007/s00436-017-5651-3. [DOI] [PubMed] [Google Scholar]
- Dubey J.P. The history of Toxoplasma gondii - the first 100 years. J. Eukaryot. Microbiol. 2008;55:467–475. doi: 10.1111/j.1550-7408.2008.00345.x. [DOI] [PubMed] [Google Scholar]
- Dubey J.P. A review of Cystoisospora felis and C. rivolta-induced coccidiosis in cats. Vet. Parasitol. 2018;263:34–48. doi: 10.1016/j.vetpar.2018.09.016. [DOI] [PubMed] [Google Scholar]
- Esteban-Sánchez L., García-Rodríguez J.J., García-García J., Martínez-Nevado E., de la Riva-Fraga M.A., Ponce-Gordo F. Wild animals in captivity: An analysis of parasite biodiversity and transmission among animals at two zoological institutions with different typologies. Animals. 2024;14:813. doi: 10.3390/ani14050813. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fagiolini M., Riccardo P.L., Laricchiuta P., Cavicchio P., Mannella R., Cafarchia C., et al. Gastrointestinal parasites in mammals of two Italian zoological gardens. J. Zoo Wildl. Med. 2010;41:662–670. doi: 10.1638/2010-0049.1. [DOI] [PubMed] [Google Scholar]
- Fancourt B.A., Augusteyn J., Cremasco P., Nolan B., Richards S., Speed J., et al. Measuring, evaluating and improving the effectiveness of invasive predator control programs: Feral cat baiting as a case study. J. Environ. Manag. 2021;280 doi: 10.1016/j.jenvman.2020.111691. [DOI] [PubMed] [Google Scholar]
- FlamingoTM, 2024. Pets in Europe, The Netherlands and Belgium: Trends and statistics. https://www.flamingo.be/en/news/pets-in-europe-trends-and-statistics. (Accessed 21 March 2025).
- Freeman L.M., Chandler M.L., Hamper B.A., Weeth L.P. Current knowledge about the risks and benefits of raw meat-based diets for dogs and cats. J. Am. Vet. Med. Assoc. 2013;243:1549–1558. doi: 10.2460/javma.243.11.1549. [DOI] [PubMed] [Google Scholar]
- Genchi M., Vismarra A., Zanet S., Morelli S., Galuppi R., Cringoli G., et al. Prevalence and risk factors associated with cat parasites in Italy: A multicenter study. Parasites Vectors. 2021;14:475. doi: 10.1186/s13071-021-04981-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Giannelli A., Capelli G., Joachim A., Hinney B., Losson B., Kirkova Z., et al. Lungworms and gastrointestinal parasites of domestic cats: A European perspective. Int. J. Parasitol. 2017;47:517–528. doi: 10.1016/j.ijpara.2017.02.003. [DOI] [PubMed] [Google Scholar]
- Györke A., Balea A., Borşan S., Su C., Jiang T., Magdaş C., et al. Toxoplasma gondii genotypes and frequency in domestic cats from Romania. BMC Vet. Res. 2024;20:369. doi: 10.1186/s12917-024-04210-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hatam-Nahavandi K., Calero-Bernal R., Rahimi M.T., Pagheh A.S., Zarean M., Dezhkam A., Ahmadpour E. Toxoplasma gondii infection in domestic and wild felids as public health concerns: A systematic review and meta-analysis. Sci. Rep. 2021;11:9509. doi: 10.1038/s41598-021-89031-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jarošová J., Antolová D., Lukáč B., Maďari A. A survey of intestinal helminths of dogs in Slovakia with an emphasis on zoonotic species. Animals. 2021;11:3000. doi: 10.3390/ani11103000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jones C.D., Okhravi N., Adamson P., Tasker S., Lightman S. Comparison of PCR detection methods for B1, P30, and 18S rDNA genes of T. gondii in aqueous humor. Investig. Ophthalmol. Vis. Sci. 2000;41:634–644. [PubMed] [Google Scholar]
- Kurnosova O.P., Panova O.A., Arisov M.V. The prevalence of potentially zoonotic intestinal parasites in dogs and cats in Moscow, Russia. Helminthologia. 2023;60:44–51. doi: 10.2478/helm-2023-0009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kurnosova O.P., Panova O.A., Arisov M.V. Prevalence of Giardia duodenalis in dogs and cats: Age-related predisposition, symptomatic, and asymptomatic cyst shedding. Vet. World. 2024;17:379–383. doi: 10.14202/vetworld.2024.379-383. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kvapil P., Kastelic M., Dovč A., Bártová E., Čížek P., Lima N., Štrus Š. An eight-year survey of the intestinal parasites of carnivores, hoofed mammals, primates, ratites and reptiles in the Ljubljana Zoo in Slovenia. Folia Parasitol. 2017;64:1–6. doi: 10.14411/fp.2017.013. [DOI] [PubMed] [Google Scholar]
- Lamoril J., Molina J.M., De Gouvello A., Garin Y.J., Deybach J.C., Modai J., Derouin F. Detection by PCR of Toxoplasma gondii in blood in the diagnosis of cerebral toxoplasmosis in patients with AIDS. J. Clin. Pathol. 1996;49:89–92. doi: 10.1136/jcp.49.1.89. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lim Y.A.L., Ngui R., Shukri J., Rohela M., Mat Naim H.R. Intestinal parasites in various animals at a zoo in Malaysia. Vet. Parasitol. 2008;157:154–159. doi: 10.1016/j.vetpar.2008.07.015. [DOI] [PubMed] [Google Scholar]
- Lima J.C.M.P., Piero F.D. Severe concomitant Physaloptera sp., Dirofilaria immitis, Toxocara cati, Dipylidium caninum, Ancylostoma sp. and Taenia taeniaeformis infection in a cat. Pathogens. 2021;10:109. doi: 10.3390/pathogens10020109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Machala L., Kodym P., Malý M., Geleneky M., Beran O., Jilich D. Toxoplasmosis in immunocompromised patients. Epidemiol. Mikrobiol. Imunol. 2015;64:59–65. [PubMed] [Google Scholar]
- Maesano G., Capasso M., Ianniello D., Cringoli G., Rinaldi L. Parasitic infections detected by FLOTAC in zoo mammals from Warsaw, Poland. Acta Parasitol. 2014;59:343–353. doi: 10.2478/s11686-014-0249-8. [DOI] [PubMed] [Google Scholar]
- Mederle N., Darabus G., Stancu A., Pentea M., Imre M., Luca I., et al. Intestinal endoparasitism in wild cat (Felis silvestris) from Banat area (Romania) Helminthologia. 2023;60:161–165. doi: 10.2478/helm-2023-0015. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mircean V., Titilincu A., Vasile C. Prevalence of endoparasites in household cat (Felis catus) populations from Transylvania (Romania) and association with risk factors. Vet. Parasitol. 2010;2:163–166. doi: 10.1016/j.vetpar.2010.03.005. [DOI] [PubMed] [Google Scholar]
- Miró G., Montoya A., Jiménez S., Frisuelos C., Mateo M., Fuentes I. Prevalence of antibodies to Toxoplasma gondii and intestinal parasites in stray, farm and household cats in Spain. Vet. Parasitol. 2004;126:249–255. doi: 10.1016/j.vetpar.2004.08.015. [DOI] [PubMed] [Google Scholar]
- Montoya J.G., Liesenfeld O. Toxoplasmosis. Lancet. 2004;363:1965–1976. doi: 10.1016/S0140-6736(04)16412-X. [DOI] [PubMed] [Google Scholar]
- Mravcová K., Štrkolcová G., Goldová M. The prevalence and assemblages of Giardia duodenalis in dogs: A systematic review in Europe. Folia Vet. 2019;63:38–45. doi: 10.2478/fv-2019-0036. [DOI] [Google Scholar]
- Overgaauw P.A.M., van Knapen F. In: Dogs, Zoonoses and Public Health. Macpherson C.N.L., Muslin F.X., Wandeler A.I., editors. CABI Publishing; Oxon: 2000. Toxocarosis; pp. 213–222. [Google Scholar]
- Panayotova-Pencheva M.S. Parasites in captive animals: A review of studies in some European Zoos. Zool. Garten N.F. 2013;82:60–71. doi: 10.1016/j.zoolgart.2013.04.005. [DOI] [Google Scholar]
- Pujol-Riqué M., Derouin F., Garcia-Quintanilla A., Valls M.E., Miró J.M., De Anta J.M.T. Design of a one-tube hemi-nested PCR for detection of Toxoplasma gondii and comparison of three DNA purification methods. J. Med. Microbiol. 1999;48:857–862. doi: 10.1099/00222615-48-9-857. [DOI] [PubMed] [Google Scholar]
- Reiczigel J., Marozzi M., Fabian I., Rozsa L. Biostatistics for parasitologists - a primer to quantitative parasitology. Trends Parasitol. 2019;35:277–281. doi: 10.1016/j.pt.2019.01.003. [DOI] [PubMed] [Google Scholar]
- Roldan J.A.M., Otranto D. Zoonotic parasites associated with predation by dogs and cats. Parasites Vectors. 2023;16:55. doi: 10.1186/s13071-023-05670-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ryan U., Cacciò S.M. Zoonotic potential of Giardia. Int. J. Parasitol. 2013;43:943–956. doi: 10.1016/j.ijpara.2013.06.001. [DOI] [PubMed] [Google Scholar]
- Spada E., Proverbio D., Della Pepa A., Domenichini G., De Giorgi B.G., Traldi G., Ferro E. Prevalence of faecal-borne parasites in colony stray cats in northern Italy. J. Feline Med. Surg. 2013;15:672–677. doi: 10.1177/1098612X12473467. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Symeonidou I., Gelasakis A.I., Arsenopoulos K., Angelou A., Beugnet F., Papadopoulos E. Feline gastrointestinal parasitism in Greece: Emergent zoonotic species and associated risk factors. Parasites Vectors. 2018;11:227. doi: 10.1186/s13071-018-2812-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Szwabe K., Błaszkowska J. Stray dogs and cats as potential sources of soil contamination with zoonotic parasites. Ann. Agric. Environ. Med. 2017;24 doi: 10.5604/12321966.1234003. [DOI] [PubMed] [Google Scholar]
- Taylor M., Coop R.L., Wall R. 4th ed. Wiley; USA: 2016. Veterinary Parasitology, [Google Scholar]
- Waap H., Gomes J., Nunes T. Parasite communities in stray cat populations from Lisbon, Portugal. J. Helminthol. 2014;88:389–395. doi: 10.1017/S0022149X1300031X. [DOI] [PubMed] [Google Scholar]
- Zanzani S.A., Gazzonis A.L., Scarpa P., Berrilli F., Manfredi M.T. Intestinal parasites of owned dogs and cats from metropolitan and micropolitan areas: Prevalence, zoonotic risks, and pet owner awareness in northern Italy. BioMed Res. Int. 2014;2014 doi: 10.1155/2014/696508. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhu S., VanWormer E., Shapiro K. More people, more cats, more parasites: Human population density and temperature variation predict prevalence of Toxoplasma gondii oocyst shedding in free-ranging domestic and wild felids. PLoS One. 2023;18 doi: 10.1371/journal.pone.0286808. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data supporting the conclusions of this article are included within the article.