Doxorubicin and Iron-doped Mesoporous Silica Nanoparticles for Chemodynamic Therapy and Chemotherapy of Breast Cancer

Abstract

Breast cancer is one of the most prevalent malignancies, necessitating the exploration of more effective synergistic treatment strategies to overcome the limitations of conventional therapies. Chemodynamic therapy (CDT) is an innovative antitumor approach that can be combined with chemotherapy to achieve potent synergistic effects. Mesoporous silica nanomaterials (MSNs) are ideal drug delivery vehicles in cancer therapy due to their unique advantages. This study presents an effective and straightforward strategy to design an intelligent drug delivery system (DDS) activated by the tumor-specific weakly acidic microenvironment to achieve efficient cancer treatment. By incorporating the chemotherapeutic drug doxorubicin (DOX) and divalent iron (Fe²⁺) into the unique mesoporous channels of MSNs, we fabricated MSNs@Fe²⁺@DOX. Under weakly acidic pH conditions, the functional components Fe²⁺ and DOX of MSNs@Fe²⁺@DOX are gradually released at the tumor site. The released Fe²⁺ can then consume hydrogen peroxide (H₂O₂) in tumor cells, increasing the levels of reactive oxygen species (ROS) and lipid peroxides through the Fenton reaction, thereby inducing ferroptosis. The combination of DOX-induced apoptosis and ferroptosis results in further enhanced cancer treatment. In vitro and in vivo experiments demonstrated that MSNs@Fe²⁺@DOX had an excellent therapeutic effect on breast cancer cells and tumor-bearing nude mice. We anticipate that this study will provide a promising biotechnological platform for combined breast cancer treatment by inducing CDT and chemotherapy.

Graphical Abstract

This study proposes a simple and effective strategy for designing an intelligent drug delivery system activated by the tumor-specific weakly acidic microenvironment, offering a promising biotechnological platform for combined breast cancer treatment.

1. Introduction

Breast cancer is one of the most prevalent malignancies and the leading cause of cancer-related deaths among women worldwide.¹ Conventional treatments, such as surgery, radiotherapy, and neoadjuvant systemic therapy, are commonly employed in managing breast cancer.² However, metastasis may occur in 20–30% of breast cancer patients, rendering surgical resection unfeasible.³ Additionally, resistance to ionizing radiation significantly limits the efficacy of breast cancer therapies.⁴ Therefore, combination chemotherapy is a crucial adjunct to improve outcomes for breast cancer patients at high risk of recurrence and metastasis.^{5, 6} Nonetheless, the high toxicity of chemotherapeutic agents to normal cells remains a significant challenge.⁷ Therefore, it is imperative to develop a drug delivery system that can precisely target chemotherapeutic agents to tumor sites, thereby minimizing damage to the surrounding normal cells.

Various materials have been widely utilized as drug-delivery vehicles, which can effectively penetrate deep into the tumor and enhance tumor immunity, significantly augmenting the efficacy of drug targeting towards tumors.^8–10 Among these, mesoporous silica nanoparticles (MSNs) stand out as prominent carriers within the drug delivery system (DDS) for cancer therapy, owing to their commendable biocompatibility, exceptional stability, expansive surface area, uniformity, tunability of particle size, favorable surface modification, and low biotoxicity.^11–13 The tumor microenvironment (TME) delineates the internal milieu wherein tumor cells proliferate and thrive, characterized by weak acidity, elevated concentrations of hydrogen peroxide (H₂O₂) and glutathione (GSH), hypoxia, and other factors.¹⁴ Tailoring mesoporous silica nanoplatforms to correspond with the TME holds promise as a novel approach in tumor therapy. The enhanced permeability and retention (EPR) effect of MSNs in solid tumors implies that their loaded anti-tumor agents can be effectively sequestered and subsequently released at the tumor site. Moreover, the acidic microenvironment inherent to cancer can expedite the liberation of drug payloads from MSNs, thereby fostering the accelerated demise of tumor cells.^15–17

Ferroptosis is a recently elucidated iron-dependent programmed cell death pathway distinct from apoptosis, necrosis, and autophagy by inducing redox dyshomeostasis to promote cell death.¹⁸ It plays pivotal roles in various biological processes such as development, immunity, and aging, and holds promising therapeutic potential, particularly in combating aggressive malignancies. Its primary mechanism pivots on the enhanced expression of unsaturated fatty acids within the cell membrane, which is catalyzed by divalent iron (Fe²⁺) and ester oxygenases. This ultimately leads to lipid peroxidation and ensuing rupture of the cell membrane, a process typically characterized by the disruption of the antioxidant system, the depletion of GSH, and a mitigated activity of the pivotal enzyme glutathione peroxidase 4 (GPX4).^19–21 Notably, ferroptosis is progressively emerging as the foremost mechanism of Chemodynamic therapy (CDT), an innovative therapeutic approach that leverages Fe²⁺-facilitated Fenton reactions to provoke intracellular oxidative stress by converting H₂O₂ into hydroxyl radicals (·OH). CDT makes full use of the TME to activate the Fenton reaction or Fenton-like reaction, which is not limited by the depth of tissue penetration and biologically safe.²² Combining CDT with conventional therapies such as chemotherapy has excellent synergistic therapeutic effects, with combination index (CI) of 0.94, and can overcome problems such as lack of specificity and poor drug delivery, showing good potential for clinical application.^{23, 24}

Iron metabolism plays a pivotal role in the initiation of ferroptosis, with the concentration of Fe²⁺ within cells serving as a critical determinant for the onset of this process.²⁵ Iron, typically in its Fe³⁺ form, undergoes reduction to Fe²⁺ via reducing agents, such as the metal reductase STEAP3. Subsequently, an excess of Fe²⁺ accumulates, consequently forming an unstable iron pool that instigates ferroptosis. Standard methodologies used in the examination of ferroptosis encompass genetic manipulation, the application of inhibitors or inducers to modulate the expression and functionality of iron-regulating proteins (IRPs), and transferrin, as well as interference with iron uptake, transportation, storage, and utilization.^26–28 Numerous studies have identified small molecular compounds and pharmaceutical agents, including erastin, RSL3, sorafenib, and artemisinin compounds, capable of accelerating ferroptosis. The chemotherapeutic agent doxorubicin (DOX) can exert a variety of anti-tumor effects by inducing apoptosis, DNA damage, reactive oxygen species (ROS) production, senescence, autophagy, pyroptosis, immunomodulation and ferroptosis²⁹. Recently, DOX has been observed to induce mitochondria-dependent ferroptosis, accompanied by down-regulation of GPX4 expression, and heighten Fe²⁺-catalyzed Fenton reactions by augmenting H₂O₂ production, thereby fostering ferroptosis.^{30, 31} However, the clinical application of these compounds is often hindered by their associated high toxicity, insufficient tumor targeting ability, and poor solubility, which substantiates the pertinence of an alternative approach. The use of mesoporous silica nanoparticles (MSNs) with drug-loading capabilities can potentially address such limitations. Yet, there exists a paucity of studies examining the impact of iron-based nanomaterials, particularly iron-infused and DOX-loaded MSNs, on the stimulation of ferroptosis and eradication of tumor cells for the enhancement of therapeutic efficacy against breast cancer.

In this study, we present a novel DDS achieved through the doping of mesoporous silica nanoparticles (MSNs) with both DOX and Fe²⁺. This intelligent DDS exhibits activation upon exposure to the tumor-specific weakly acidic microenvironment, thereby enabling highly efficient cancer treatment via a combination of chemotherapy and CDT. As illustrated in Scheme 1, MSNs were synthesized utilizing cetyltrimethylammonium chloride (CTAC) as a template, with tetraethoxysilane (TEOS) and triethanolamine (TEA) serving as precursors in a hydrothermal reaction. The resulting MSNs@Fe²⁺@DOX nanoparticles were obtained through a process involving mixing and stirring with FeCl₂ and DOX. Upon internalization of the constructed MSNs@Fe²⁺@DOX by cancer cells, Fe²⁺ and DOX are released in response to the weakly acidic TME. The liberated Fe²⁺ engages with the abundant H₂O₂ in the TME, generating ·OH, thereby inhibiting the activity of GPX4 and converting non-toxic membrane phospholipids (PL-PUFA-OH) into toxic lipid peroxides (PL-PUFA-OOH), thereby inducing ferroptosis. Meanwhile, DOX exerts its anticancer effects by inhibiting tumor cell proliferation and inducing apoptosis through its binding to DNA nitrogenous bases, thereby disrupting DNA replication, transcription, and RNA synthesis. Additionally, DOX may augment Fe²⁺-induced CDT efficacy by enhancing H₂O₂ production, and it could induce mitochondria-dependent ferroptosis by downregulating GPX4 expression. Ultimately, MSNs@Fe²⁺@DOX demonstrate enhanced therapeutic efficacy in breast cancer treatment through synergistic CDT and chemotherapy. The nanoagents presented herein effectively suppress tumor growth without inducing adverse effects, thus holding promise for advancing the field of nanomedicine in combined tumor therapy and providing valuable insights for the clinical application of nanoagents.

Scheme 1.

Schematic representation of doxorubicin and iron-doped MSNs for combined chemodynamic therapy and chemotherapy in breast cancer.

2. Materials and Methods

2.1. Materials

Tetraethyl orthosilicate (TEOS), triethanolamine (TEA), 3,3’,5,5’-tetramethylbenzidine (TMB), 5,5’-dithio-bis-(2-nitrobenzoic acid) (DTNB), Lipid Peroxidation malondialdehyde (MDA) Assay Kit, Calcein-AM/PI Living/Dead Cell Double Staining Kit, 2’,7’-dichlorodihydrofluorescein diacetate (DCFH-DA), hydrochloric acid (HCl), and doxorubicin (DOX) were obtained from Sigma-Aldrich (St. Louis, MO, USA). Cetyltrimethylammonium chloride (CTAC) and 4% paraformaldehyde (PFA) were purchased from TCI (Portland, OR, USA). Hydroxyphenyl Fluorescein (HPF) was purchased from Medbio (Grand Rapids, MI, USA); Ferrous chloride (FeCl₂) was acquired from Sinopharm Chemical Reagent Co. Ltd (Shanghai, China). DMEM medium, RPMI 1640 medium, fetal bovine serum (FBS), BCA Protein Assay Reagent, polyvinylidene fluoride (PVDF) membranes, and BODIPY 581/591 C11 (Lipid Peroxidation Sensor) were procured from Thermo Fisher Scientific (Grand Island, NY, USA). Penicillin-streptomycin was supplied by BI Biologicals Industries (Kibbutz Beit-Haemek, Israel). The Annexin V-FITC Apoptosis Detection Kit, RIPA protein lysate, and 2-(4-amidinophenyl)-6-indolecarbamidine dihydrochloride (DAPI) were sourced from Beyotime (Shanghai, China). Primary and secondary antibodies for Western blot were purchased from Cell Signaling Technology (Danvers, MA, USA).

2.2. Cell culture

Human breast cancer cell lines (MDA-MB-231, MDA-MB-468, MCF7), human cervical cancer cell line (GaSki), mouse-derived breast cancer cell line (4T1), and mouse myogenic cells (C2C12) were preserved by the Tumor Molecular Biology Research Laboratory, Cancer Research Institute, Central South University. 4T1 and GaSki cells were cultured in RPMI-1640 medium, whereas MDA-MB-231, MDA-MB-468, MCF7 and C2C12 were cultured in DMEM medium. Both media were supplemented with 10% FBS and 1% penicillin-streptomycin. All cells were incubated in a humidified incubator at 37°C with 5% CO₂.

2.3. Preparation of MSNs@Fe²⁺@DOX

First, 5.0 g of CTAC and 0.075 g of TEA were dissolved in 50 mL of deionized (DI) water and heated in an oil bath at 95 °C. After 1 hour, 3.75 mL of TEOS was added dropwise, and the mixture was stirred for an additional hour. The product was collected by centrifuging (10,000 rpm) and washed with ethanol three times to remove residual reactants. The residue was extracted by reflexing with an ethanol solution of HCl (10% v/v) at 80 °C for 6 hours to remove the CTAC, and MSNs were collected by centrifugation (10,000 rpm).

Next, 0.04 g of FeCl₂·H₂O was dissolved in 10 mL of DI water. An aqueous solution containing 20 mg of MSNs was added to the FeCl₂ solution and stirred for 24 hours. The MSNs@Fe²⁺ nanoparticles were collected by centrifugation (10,000 rpm) and washed three times with DI water.

Finally, 20 mg of MSNs@Fe²⁺ was mixed with a 1 mg/mL DOX-DMSO solution and stirred for 24 hours. The MSNs@Fe²⁺@DOX nanoparticles were collected by centrifugation (10,000 rpm) and washed with DI water three times.

2.4. Characterization of MSNs@Fe²⁺@DOX

Transmission electron microscopy (TEM, FEI Tecnai G2 F20, Oregon, USA) was used to observe the morphology of MSNs, MSNs@Fe²⁺, MSNs@DOX and MSNs@Fe²⁺@DOX. Absorption spectra were measured with a UV-2600 spectrophotometer (Shimadzu, Japan), and fluorescence spectra were recorded with an RF-6000 fluorescence spectrophotometer (Shimadzu, Japan). Size distribution and Zeta potential were evaluated using a Zetasizer Nano ZS90 (Malvern Instruments, UK). Fourier-transform infrared spectroscopy (FTIR) was performed using Nicolet Summit FTIR (Thermo, NY, USA) spectrometer. The crystal structure and phases were identified through X-ray diffraction analysis (Malvern Panalytical, Netherlands). Stability was assessed by dispersing 200 μg/mL of MSNs@Fe²⁺@DOX in DI water, PBS, RPMI-1640 complete medium, or DMEN complete medium for several days.

2.5. Loading and release assay of MSNs@Fe²⁺@DOX

To determine the loading efficiency of DOX in nanomaterials, 1 mg/mL of DOX-DMSO solution was co-incubated with 20 mg of MSNs or MSNs@Fe²⁺ for 24 hours. After centrifugation at 10,000 rpm, the supernatants were collected, and the DOX concentration (2, 2.5, 3, 3.5, 4, 5, 6, 8 μg/mL) versus fluorescence intensity at 591 nm was plotted. The amount of DOX loaded in the nanoparticles was calculated using Equation 1:

$$\text{Loading}\text{efficiency}=1-\left(\text{DOX}\text{in}\text{supernatant}/\text{initial}\text{DOX}\text{content}\times \mathrm{100\%}\right).$$

For the release efficiency of DOX, 1 mL of 200 μg/mL of MSNs@DOX or MSNs@Fe²⁺@DOX was dispersed in dialysis bags (3.5 kDa), which were placed in 30 mL of PBS buffers with different pH values: 5.3, 6.3, or 7.4, and stirred at 200 rpm under 37°C. For each group, 1 mL of buffer was withdrawn periodically (at 0, 1, 2, 4, 8, 12, 24, 36 and 48 hours), and 1 mL of new buffer was added. The DOX content was measured by fluorescence intensity at 591 nm. Release efficiency at different pH levels was calculated using Equation 2:

$$\text{Release}\text{efficiency}=\text{DOX}\text{in}\text{buffer}\text{/}\text{DOX}\text{in}\text{nanoparticles}\times \mathrm{100\%}.$$

2.6. Study of the Fenton reaction of MSNs@Fe²⁺@DOX

To test whether MSNs@Fe²⁺ and MSNs@Fe²⁺@DOX can induce the Fenton reaction, two ·OH probes, TMB and HPF, were used. First, 100 μL of 50 μg/mL MSNs@Fe²⁺ and MSNs@Fe²⁺@DOX were added to PBS buffers with pH 5.3, 6.3 or 7.4 containing 10 μL of 0.5 mM TMB. Next, 10 μL of 0.1 mM H₂O₂ was added to the experimental groups, and the final reaction volume was 1 mL. The mixed solutions were incubated for 10 minutes at room temperature. The UV-vis absorption spectra (500–800 nm) were measured with a UV-2600 spectrophotometer, and the absorbance values at 652 nm were recorded.

HPF was also used as an indicator of ·OH, as it emits solid green fluorescence at 515 nm after oxidation by ·OH. 10 μL of 1 μM HPF, 10 μL of 0.1 mM H₂O₂, and 100 μL of 50 μg/mL of MSNs@Fe²⁺ or MSNs@Fe²⁺@DOX were added to cuvettes, and the volume was adjusted to 1 mL with DI water (no H₂O₂ was added in the control group). After 30 minutes at room temperature, fluorescence spectra were obtained using an RF-6000 fluorescence spectrophotometer. The fluorescence intensities of the HPF+MSNs@Fe²⁺ at 515 nm were defined as F₀, F indicates the fluorescence intensity of different groups at 515 nm, and F/F₀ shows the relative fluorescence intensity.

2.7. Evaluation of in vitro cytotoxicity and therapeutic effect of MSNs@Fe²⁺@DOX

C2C12, GaSki and 4T1 cells were utilized for cytotoxicity assay. For the therapeutic effect assay, 4T1, MDA-MB-231, MDA-MB-468, and MCF7 cells were employed. Initially, cells were seeded in 96-well plates overnight. Subsequently, the cell medium was replaced with 200 μL of fresh medium containing nanomaterials (MSNs, or MSNs@Fe²⁺@DOX) at varying concentrations (0, 20, 40, 60, 80, 100, 120 μg/mL) for the cytotoxicity test, or with cell medium containing different nanomaterials (saline, MSNs, MSNs@Fe²⁺, MSNs@DOX or MSNs@Fe²⁺@DOX) at a concentration of 100 μg/mL for the therapeutic effect assay. After 24 hours, cells were washed three times with PBS, and then 20 μL of CCK-8 was added to each well. The optical density (OD) at 450 nm was measured after 2 hour of incubation. And cell viability was calculated using Equation 3:

$$\text{cell}\text{viability}=1-{\text{OD}}_{\text{sample}}/{\text{OD}}_{\text{control}}\times 100\%$$

2.8. In vitro cellular uptake of MSNs@Fe²⁺@DOX

Cells (10⁵ cells) were seeded on coverslips in a 12-well plate and incubated for 24 hours. Subsequently, MSNs@Fe²⁺@DOX at a concentration of 100 μg/mL was added. After incubating for 0, 2, 4, 6, 8 and 12 hours, cells were fixed with 4% PFA for 30 minutes, washed three times with PBS, and incubated with PBS containing 0.1% Triton for 10 minutes. Following this, cells were blocked with PBS containing 1% BSA for 30 minutes, stained with DAPI for 30 minutes, and mounted on glass slides with glycerol as a mounting medium. Confocal imaging was performed to record the cellular uptake and distribution of DOX, ensuring the entire process was conducted under protected light conditions.

2.9. Detection of apoptosis by flow cytometry

Apoptosis was detected using an Annexin V-FITC/PI kit according to the manufacturer’s instructions. Cells were seeded in 6-well plates and treated with various nanomaterials, including saline as a control group, MSNs, MSNs@Fe²⁺, MSNs@DOX and MSNs@Fe²⁺@DOX (100 μg/mL) for 24 hours. Supernatant cells were collected into 15 mL centrifuge tubes, while adherent cells were digested with EDTA-free trypsin, collected into corresponding tubes, and washed three times with pre-cooled PBS. Cells were then resuspended in 100 μL of 1×Binding buffer, and 5 μL of Annexin V-FITC was added to each suspension and incubated for 15 minutes. Subsequently, 10 μL of PI Staining Solution was added and incubated for another 5 minutes. Finally, 200 μL of 1×Binding buffer was added to each tube, and samples were analyzed using a flow cytometer.

2.10. Live-dead cell staining assay

The Calcein-AM/PI Living/Dead Cell Double Staining Kit was used for live/dead cell staining experiments. Cells (10⁵ cells) were seeded into 24-well plates and incubated at 37°C for 12 hours. Following this, cells were treated with different nanomaterials (Blank, MSNs, MSNs@Fe²⁺, MSNs@DOX, and MSNs@Fe²⁺@DOX) for 12 hours. Cells were then washed three times with PBS and stained with 200 μL of staining solution containing calcein-AM (1 μM) and PI (1 μM) for 15 minutes at 37 °C in the dark. After washing three times with PBS, cells were ready for imaging.

2.11. ROS staining

10⁵ 4T1, MDA-MB-231, MDA-MB-468 and MCF7 cells were seeded on coverslips in a 12-well plate and treated with various nanomaterials for 12 hours. The cells were washed three times with pre-warmed PBS, fixed with 4% PFA for 30 minutes, washed again three times with PBS, and incubated with PBS containing 0.1% Triton. Subsequently, the cells were blocked with PBS containing 1% BSA for 30 minutes. Nuclei were stained with DAPI for 30 minutes. After washing three times with PBS, cells were stained with DCFH-DA at a final concentration of 10 μM for 30 minutes. The coverslips were then mounted on glass slides with glycerol. Fluorescence imaging was employed to record ROS levels.

2.12. Lipid ROS staining

Intracellular lipid peroxidation was assessed using the BODIPY 581/591 C11 fluorescent probe. 10⁵ 4T1, MDA-MB-231, MDA-MB-468 and MCF7 cells were seeded in 12-well plates with coverslips. After removing the medium, cells were washed with PBS and treated with Blank, MSNs, MSNs@Fe²⁺, MSNs@DOX and MSNs@Fe²⁺@DOX containing medium for 12 hours. Cells were then washed with PBS and stained with 10 μM BODIPY 581/591 C11 dye for 30 minutes. Following this, cells were washed, fixed, broken, blocked, and nuclei stained with DAPI. Fluorescence microscopy was used to collect images, and lipid peroxidation levels were quantified based on fluorescence intensity.

2.13. Detection of intracellular GSH level

Intracellular GSH levels were measured using DTNB, which reacts with the thiol group (-SH) in GSH to produce a yellow product with maximum absorption at 412 nm.³² To prevent natural oxidation of GSH, all experiments were conducted in the dark. 10⁵ 4T1, MDA-MB-231, MDA-MB-468 and MCF7 cells were seeded in 12-well plates and cultured for 24 hours. Cells were treated with various nanomaterials for 6 hours and washed three times with cold PBS. After trypsin digestion, cells were collected and sonicated to obtain cell lysate. DTNB (200 µM) was added to the lysates and incubated for 30 minutes at room temperature. Absorbance at 412 nm was measured using a SpectraMax microplate reader. The relative GSH content was determined by comparing the absorbance ratio between the experimental and control groups.

2.14. Detection of intracellular MDA level

Lipid peroxidation levels were measured using a Lipid Peroxidation MDA Assay Kit. Cells treated with various nanomaterials were collected, and protein samples were prepared by obtaining cell homogenates after sufficient lysis. Protein concentration in each sample was determined using the BCA Protein Assay Reagent. Samples were mixed with 0.1 mL of MDA assay working solution and heated at 100°C for 15 minutes. After cooling to room temperature, samples were centrifuged at 1000 g for 10 minutes. The supernatant (200 μL) was transferred to 96-well plates, and absorbance at 532 nm was measured using a microplate reader. The MDA content per unit protein weight was calculated based on protein concentration.

2.15. RT-qPCR experiment

4T1, MDA-MB-231, MDA-MB-468 and MCF7 cells were seeded in 12-well plates at a density of 5×10⁵ cells/well and cultured for 12 hours. After treatment with various nanomaterials for 24 hours, cell precipitates were collected. Total cellular RNA was extracted using TRIzol reagent and reverse transcribed into cDNA using the RevertAid First Strand cDNA Synthesis Kit from Thermo Fisher Scientific (Grand Island, NY, USA). Real-time quantitative PCR analysis was performed using the Mini Option system and ChamQ SYBR qPCR Master Mix (Vazyme, Nanjing, China). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal control. Gene expression was quantified using the comparative CT method. Sequence information for the primers was as follows:

GAPDH-F: CAACGGATTTGGTCGTATTGG,

GAPDH-R: TGACGGTGCCATGGAATTT.

PTGS2-F: CTGATGATTGCCCGACTCCC,

PTGS2-R: TCGTAGTCGAGGTCATAGTTC.

ACSL4-F: TGGAAGTCCATATCGCTCTGT,

ACSL4-R: CCACAGCAAACCGTAGATGC.

GPX4-F: GCCTTCCCGTGTAACCAGT,

GPX4-R: GCGAACTCTTTGATCTCTTCGT.

SLC7A11-F: ATGCAGTGGCAGTGACCTTT,

SLC7A11-R: GGCAACAAAGATCGGAACTG.

2.16. Western Blot experiment

4T1, MDA-MB-231, MDA-MB-468 and MCF7 cells were seeded in 6-well plates at a density of 1×10⁶ cells/well and cultured for 12 hours. Following a 48-hour treatment with various nanomaterials, cell precipitates were collected. Proteins were extracted using RIPA lysis buffer, and their concentrations were quantified using the BCA Protein Assay Reagent. Equal protein amounts were loaded into sample wells and separated via 10% SDS-PAGE. The proteins were then transferred onto PVDF membranes, which were blocked with 10% skimmed milk in PBST at room temperature for 2 hours. Subsequently, the membranes were incubated overnight at 4°C with primary antibodies against COX2, ACSL4, GPX4, SLC7A11 (rabbit), and GAPDH (mouse). The following day, after washing, the membranes were incubated with horseradish peroxidase-conjugated secondary antibodies, and protein expression was detected using enhanced chemiluminescence. GAPDH served as the internal control.

2.17. Subcutaneous tumorigenesis assay in nude mice

To evaluate the in vivo efficacy of different nanomaterials, a subcutaneous breast cancer model was established in nude mice using 4T1 cells. Twenty-five 4-week-old male BALB/c nude mice (16 ± 2 g) were obtained from the Experimental Animal Center of Hunan Cancer Hospital and maintained in a specific pathogen-free (SPF) barrier facility. After a week of acclimatization, mice were inoculated subcutaneously in the right hind flank with 4×10⁶ 4T1 cells to establish tumors. One-week post-inoculation, mice were randomized into five groups for intratumoral injection with 200 μL of saline (control), MSNs, MSNs@Fe²⁺, MSNs@DOX, and MSNs@Fe²⁺@DOX (100 µg/mL each). Body weight and tumor size were recorded every 3 days. After two weeks, mice were euthanized via deep anesthesia. Tumors and major organs (heart, liver, spleen, lung, and kidney) were harvested for further analysis. All animal experiments were conducted in accordance with the Regional Ethics Committee for Animal Experiments and approved by the Institutional Animal Care and Use Committees of Hunan Cancer Hospital (Number: DWLL-2021–525).

2.18. H&E staining

Major organs were labelled, washed, and fixed with 4% paraformaldehyde (PFA). Tissues were dehydrated through gradient alcohols and embedded in paraffin. Sections approximately 4 µm thick were cut using a microtome, mounted on slides, and dried. Following dehydration in pure alcohol and clearing in xylene, sections were sealed with a mounting medium and stored at 4°C for subsequent histological examination and imaging.

2.19. Statistical Analysis

All experiments were performed in triplicate. Statistical analysis was conducted using GraphPad Prism 7.0. Significant differences between datasets were determined using the Student’s t-test. Unless otherwise specified, data are presented as mean ± standard deviation (Mean ± SD). Statistical significance was set at p < 0.05.

3. Results and Discussion

3.1. Preparation and characterization of MSNs@Fe²⁺@DOX

Several methods were employed to characterize the morphological and structural attributes of the synthesized MSNs@Fe²⁺@DOX nanoparticles. Initially, the size and morphology of the distinct nanoparticles were examined using TEM. As depicted in Figure 1A, the results revealed that silica nanoparticles of varying compositions exhibited a spherical morphology, with a consistent particle size of approximately 100 nm. Moreover, as illustrated in Figure 1B, all nanoparticles were evenly dispersed, with the successful synthesis indicated by a color change. The particle size was also determined using DLS (Figure 1C), yielding an average size of around 140 nm for the various modified MSNs. The size measured via DLS was slightly larger than that obtained through TEM, attributed to variances in the hydration and drying conditions of the nanomaterials. The Zeta potential data is presented in Figure 1D. The Zeta potential of MSNs was measured at −21.17 ± 0.87 mV, and post-modification with Fe²⁺ or DOX, the Zeta potential tended towards neutrality, reaching −6.28 ± 0.1 mV, aligning with expectations. Figure 1E showcases the UV-vis absorption spectra of DOX, MSNs, MSNs@Fe²⁺, MSNs@DOX, and MSNs@Fe²⁺@DOX. It is evident that MSNs@DOX and MSNs@Fe²⁺@DOX exhibit the characteristic UV-vis absorption peak of DOX at 480 nm, signifying successful DOX loading onto MSNs. The fluorescence emission spectra of MSNs@DOX and MSNs@Fe²⁺@DOX are depicted in Figure 1F, both demonstrating an emission peak at 591 nm, consistent with the specific fluorescence spectra of DOX, indicating excellent fluorescence properties. FTIR and XRD results are shown in Figure S1, which also confirms the successful synthesis of the nanoparticles. To further assess the stability of the nanoparticles, a dispersion of 200 μg/mL of MSNs@Fe²⁺@DOX was prepared in various mediums including water, PBS, 1640, and DMEM, with the state of the nanomaterials observed at different time points (0, 1, 3, 6, 9, 12, 15 days). Figure 1G illustrates that even after 15 days, the MSNs@Fe²⁺@DOX nanomaterials remained unaggregated, underscoring their robust stability. These findings affirm the successful synthesis of our nanomaterials, their uniform size distribution, and exceptional stability, highlighting their promising applications.

Figure 1.

Characterization of MSNs@Fe²⁺@DOX. (A) TEM depiction of MSNs, MSNs@Fe²⁺, MSNs@DOX, MSNs@Fe²⁺@DOX; Scale bar = 50 nm. (B) Comparative imaging of DOX(a), MSNs (b), MSNs@Fe²⁺(c), MSNs@DOX(d), MSNs@Fe²⁺@DOX(e); (C) Analysis of size distribution for MSNs, MSNs@Fe²⁺, MSNs@DOX, MSNs@Fe²⁺@DOX; (D) Zeta potentials corresponding to MSNs, MSN@Fe²⁺, MSNs@DOX, MSNs@Fe²⁺@DOX. (E) UV-visible spectrum comparisons of DOX, MSNs, MSNs@Fe²⁺, MSNs@DOX, MSNs@Fe²⁺@DOX; (F) Fluorescence spectrum of DOX, MSNs@DOX, MSNs@Fe²⁺@DOX; (G) Visual representations of MSNs@Fe²⁺@DOX over varying durations of 0, 1, 3, 6, 9, 12, and 15 days in water, PBS, RPMI-1640 and DMEM medium.

3.2. Loading and release of DOX

The efficient loading and controlled release of drugs from nanomaterials form the foundation for their utilization in Drug Delivery Systems (DDS). To assess the loading and release efficiency of DOX in MSNs@DOX / MSNs@Fe²⁺@DOX, we conducted measurements of the fluorescence and absorption spectra of DOX (2 μg/mL) in PBS buffers with varying pH levels. The fluorescence spectra of DOX exhibited stability within the pH range of 2–8, demonstrating no pH-dependent variations (Figure 2A), and displayed its most intense emission peak at 591 nm. Conversely, the absorption peak decreased as the pH increased (Figure S2), indicating that quantifying the loading efficiency using the fluorescence intensity of DOX was more advantageous. Subsequently, we measured the fluorescence spectra of different concentrations of DOX in a pH 7.4 PBS buffer (Figure 2B). By constructing a calibration curve of the fluorescence intensity at 591 nm for various DOX concentrations, we established a means for converting between fluorescence intensity and DOX concentration (Figure 2C). The fluorescence spectra of DOX in the initial pure DOX solution and the supernatant of MSNs@DOX and MSNs@Fe²⁺DOX post-loading was examined to calculate the loading efficiency of DOX (Figure 2D). The loading capacities of DOX in MSNs were determined to be 21.5 mg DOX/g MSNs and 20.6 mg DOX/g MSNs@Fe²⁺ with corresponding loading efficiencies of 86.1% and 82.5%, respectively (Figure 2E).

Figure 2.

Loading and release kinetics of DOX. (A) Fluorescence spectra of DOX (2 μg/mL) in 10 mM PBS at different pH levels. (B) Fluorescence spectra of DOX in 10 mM pH 7.4 PBS buffer with varying DOX concentrations ranging from 2 to 8 μg/mL. (C) Construction of a calibration curve of DOX in 10 mM pH 7.4 PBS buffer. (D) Fluorescence spectra comparing the initial pure DOX solution with the supernatant post-centrifugation of MSNs@DOX and MSNs@Fe²⁺@DOX. Excitation: 480 nm, Emission: 591 nm (E) Assessment of loading efficiency and amount of DOX in MSNs@DOX and MSNs@Fe²⁺@DOX nanocarriers. (F) Cumulative release profiles of DOX from the MSNs@DOX (200 μg/mL) in different pH buffers. (G) Cumulative release patterns of DOX from MSNs@Fe²⁺@DOX (200 μg/mL) across different pH buffers.

To evaluate the release efficiency of DOX under varying pH conditions, release curves were generated by plotting the amount of DOX (based on the standard curve depicted in Figure 2C) against time and pH. The observed decrease in DOX release efficiency with increasing pH values suggested that an acidic environment is more conducive to the efficient release of DOX. This indicates that DOX, as the active ingredient within nanomaterials, may be released within the mildly acidic Tumor Microenvironment (TME), thereby exerting anti-tumor effects.

3.3. Fenton reaction induced by MSNs@Fe²⁺ and MSNs@Fe²⁺@DOX

Iron is a critical element for the Fenton reaction. Under the catalytic effect of Fe²⁺ or Fe³⁺, H₂O₂ rapidly reacts to produce ·OH, mediating the lipid peroxidation reaction to achieve a cytotoxic effect. To verify the catalytic performance of iron-based nanomaterials in vitro, TMB was used due to its color change upon interaction with ·OH. The absorption spectra of TMB at 652 nm were examined after reacting with H₂O₂ and MSNs@Fe²⁺ (Figure 3A) or MSNs@Fe²⁺DOX (Figure 3B) under different pH conditions. Results indicated that under acidic conditions (pH=5.3 or pH=6.3), both MSNs@Fe²⁺ and MSNs@Fe²⁺DOX catalyzed H₂O₂, with the generated ·OH promoting the color development reaction of TMB. Conversely, in a neutral environment (pH=7.4), the Fenton reaction could not be triggered. Furthermore, the generation of ·OH was assessed using the ROS fluorescence probe HPF, which selectively reacts with ·OH and peroxynitrite to produce intense fluorescence with a maximum emission peak at 515 nm. As shown in Figure 3C, both MSNs@Fe²⁺ and MSNs@Fe²⁺DOX induced changes in HPF fluorescence intensity, indicating high Fenton reaction capability (Figure 3D).

Figure 3.

Fenton reaction induced by MSNs@Fe²⁺ and MSNs@Fe²⁺@DOX. (A) UV-visible spectra of MSNs@DOX (50 μg/mL) exposed to TMB (0.1 mM) in the presence or absence of H₂O₂ for 30 minutes under different pH conditions. (B) UV-visible spectra of MSNs@Fe²⁺@DOX (50 μg/mL) treated with TMB in the presence or absence of H₂O₂ for 30 minutes at varying pH levels. (C) Fluorescence spectra illustrating the interaction of HPF with MSNs@Fe²⁺/MSNs@Fe²⁺@DOX (50 μg/mL). (D) Relative fluorescence intensity of HPF upon interaction with MSNs@Fe²⁺/MSNs@Fe²⁺@DOX, F₀: fluorescence intensity of HPF + MSNs@Fe²⁺.

3.4. Cytotoxicity and cell imaging of MSNs@Fe²⁺@DOX

Biocompatibility is essential for clinical applications of bio-nanomaterials. The cytotoxicity of MSNs and MSNs@Fe²⁺@DOX was analyzed using CCK-8 assays on C2C12, CaSki and 4T1 cell lines. As shown in Figure 4A, no significant change in cell viability was observed after incubating with various concentrations of MSNs for 24 hours, indicating that MSNs are non-toxic and biocompatible. In contrast, MSNs@Fe²⁺@DOX exhibited cytotoxicity on C2C12, CaSki, and 4T1 cells (Figure 4B), with cell viability decreasing as MSNs@Fe²⁺@DOX concentration increased. Although DOX is cytotoxic to both normal and tumor cells, its effect on tumor cells, particularly 4T1, was more substantial. Given the weakly acidic TME in breast cancer cells, the Fenton reaction catalyzed by iron-loaded nanomaterials was enhanced, producing more ·OH to induce cell death. At 100 μg/mL, MSNs@Fe²⁺@DOX reduced 4T1 cell viability to 48.77%, indicating its therapeutic potential and establishing this concentration for subsequent experiments.

Figure 4.

Assessment of cytotoxicity and cellular Uptake of MSNs@Fe²⁺@DOX. (A) Evaluation of relative cell viability in C2C12, GaSki, 4T1 cells following treatment with different concentrations of MSNs (ranging from 0 to 120 μg/mL) for 24 hours. (B) Cell viability analysis of C2C12, GaSki, 4T1 cells exposed to various concentrations of MSNs@Fe²⁺@DOX (ranging from 0 to 120 μg/mL) for 24 hours. (C) Fluorescence imaging capturing 4T1 cell uptake following co-incubation with 100 μg/mL MSNs@Fe²⁺@DOX for 0, 2, 4, 6, 8, or 12 hours. (D) Fluorescence images depicting MDA-MB-231 cell uptake after co-incubation with 100 μg/mL MSNs@Fe²⁺@DOX for 0, 2, 4, 6, 8, or 12 hours. Blue: DAPI; red: DOX; Scale bar = 100 μm.

Successful cellular uptake of nanomaterials is crucial for their application in tumor therapy. The uptake of MSNs@Fe²⁺@DOX by different breast cancer cells was analyzed via cell imaging. Figure 4C shows that after incubating MSNs@Fe²⁺@DOX with 4T1 cells for 0, 2, 4, 6, 8, and 12 hours, the uptake by 4T1 cells was identified by immunofluorescence assay. A small amount of MSNs@Fe²⁺@DOX was observed in the cells after 4 hours of incubation, with fluorescence intensity increasing over time and becoming prominent at 8 hours. By 12 hours, MSNs@Fe²⁺@DOX had completely entered the 4T1 cells. Similar results were obtained for MDA-MB-231, MDA-MB-468, and MCF7 cells (Figure 4D, Figure S3A, Figure S3B), confirming that MSNs@Fe²⁺@DOX nanoparticles are effectively taken up by breast cancer cells.

3.5. Evaluation of the efficacy of MSNs@Fe²⁺@DOX synergistic CDT and chemotherapy for anti-breast cancer treatment in vitro

To further investigate therapeutic efficacy, the anti-tumor effects were evaluated by incubating 100 μg/mL of various nanomaterials (Blank, MSNs, MSNs@Fe²⁺, MSNs@DOX and MSNs@Fe²⁺@DOX) with 4T1, MDA-MB-231, MDA-MB-468 and MCF7 cells for 24 hours. CCK-8 assay results (Figure 5A) indicated that MSNs or Blank treatments showed no significant cytotoxicity, whereas MSNs@Fe²⁺ and MSNs@DOX reduced cell viability to below 80%. MSNs@Fe²⁺@DOX further decreased viability to less than 50% in all breast cancer cell lines, demonstrating its excellent synergistic anti-tumor effect.

Figure 5.

Assessment of the anti-tumor efficacy of Combined CDT and Chemotherapy of MSNs@Fe²⁺@DOX in vitro. (A) Cell viability assay conducted on 4T1, MDA-MB-231, MDA-MB-468, and MCF7 cells post-incubation with saline (Blank), 100 μg/mL MSNs, MSNs@Fe²⁺, MSNs@DOX, and MSNs@Fe²⁺@DOX for 24 hours. (B) Flow cytometry analysis of apoptosis in different breast cancer cells (4T1, MDA-MB-231, MDA-MB-468 or MCF7) treated with blank solution, MSNs, MSNs@Fe²⁺, MSNs@DOX and MSNs@Fe²⁺@DOX for 24 hours, represented graphically as the percentage of apoptotic cells. (C) Fluorescence images displaying live/dead cell staining in 4T1 and MDA-MB-231 cells treated with various nanomaterials (blank, MSNs, MSNs@Fe²⁺, MSNs@DOX and MSNs@Fe²⁺@DOX) using Calcein AM (green) and PI (red) staining; Scale bar = 200 μm. (D) Fluorescence images indicating ROS levels in 4T1 and MDA-MB-231 cells post-treatment with different nanoparticles, utilizing DCFH-DA as a probe, Scale bar = 200 μm.

DOX, a clinically used anti-tumor chemotherapeutic drug, induces apoptosis by binding to DNA bases and damaging DNA structure. Flow cytometry examined DOX’s effect on apoptosis in different nanomaterials (Figure S4A). The statistical analysis in Figure 5B revealed that MSNs had no significant impact on apoptosis across all four breast cancer cell lines. MSNs@Fe²⁺ had minimal effect on 4T1 and MDA-MB-468 cells but promoted apoptosis in MDA-MB-231 and MCF7 cells. Both MSNs@DOX and MSNs@Fe²⁺@DOX significantly induced apoptosis in the four breast cancer cell lines, with MSNs@Fe²⁺@DOX exhibiting a more pronounced pro-apoptotic effect.

The cytotoxic effects of different nanomaterials were further analyzed using live/dead cell staining. Calcein-AM, a highly lipophilic and cell membrane permeable vital dye, stains living cells with strong green fluorescence.³³ In contrast, PI can pass through the membrane and reach the nucleus of dead cells, bind to the DNA double helix to emit red fluorescence.³⁴ As shown in Figure 5C and Figure S4B, the Blank and MSNs groups showed almost no cell death, whereas the MSNs@Fe²⁺ and MSNs@DOX groups showed minimal cell death. However, MSNs@Fe²⁺@DOX treatment resulted in substantial red fluorescence, indicating its excellent synergistic anti-tumor killing effect.

DCFH-DA, a ROS indicator, crosses the cell membrane and is hydrolyzed by intracellular esterases to produce DCFH. ROS oxidizes non-fluorescent DCFH to produce DCF with green fluorescence, proportional to intracellular ROS levels.³⁵ Figure 5D and Figure S4C show almost no green fluorescence in the Blank and MSNs groups, indicating no ROS production. In contrast, weak green fluorescence was observed in the MSNs@Fe²⁺ and MSNs@DOX groups, resulting from ·OH produced by the Fe²⁺-induced Fenton reaction or ROS production by DOX. Strong green fluorescence in cells treated with MSNs@ Fe²⁺@DOX indicates that Fe²⁺ and DOX synergistically promote intracellular ROS accumulation.

3.6. MSNs@Fe²⁺@DOX induces ferroptosis in breast cancer cells

In addition to apoptosis induction, MSNs@Fe²⁺@DOX elicits ferroptosis in breast cancer cells. To investigate this, the effects of various nanomaterials on the mRNA expression levels of ferroptosis markers (acsl4, ptgs2, gpx4, and slc7a11 mRNA) across different cell lines were assessed via RT-qPCR assay. As shown in Figures 6A and 6B, MSNs exhibited no discernible impact on acsl4 and ptgs2 mRNA expression in diverse breast cancer cells. However, MSNs@Fe²⁺ and MSNs@DOX moderately upregulated the expression of acsl4 and ptgs2, whereas MSNs@Fe²⁺@DOX demonstrated the most significant upregulation. Similarly, MSNs had negligible effects on gpx4 and slc7a11 mRNA expression, while MSNs@Fe²⁺ and MSNs@DOX suppressed their expression. Remarkably, MSNs@Fe²⁺@DOX exhibited the most pronounced inhibition (Figures 6C and 6D). Western Blot assays corroborated these findings, indicating consistent protein expression patterns (Figure 6E), affirming the ability of MSNs@Fe²⁺@DOX to induce ferroptosis in breast cancer cells.

Figure 6.

Induction of Ferroptosis by MSNs@Fe²⁺@DOX. Evaluation of ferroptosis-related mRNA and proteins, as well as GSH and lipid peroxidation levels in 4T1, MDA-MB-231, MDA-MB-468, or MCF7 cells post-varied treatments. RT-qPCR results showcasing the expression of acsl4 (A), ptgs2 (B), gpx4 (C), slc7a11 (D) mRNA levels, and Western blot analysis of ACSL4, COX2, SLC7A11 and GPX4 protein expressions (E), with GAPDH used as an internal control. (F) GSH level detection using DTNB as a probe. (G) Measurement of lipid peroxidation levels using the MDA kit.

Furthermore, ferroptosis was characterized biochemically by glutathione depletion and lipid peroxide accumulation.³⁶ DTNB was employed to assess intracellular GSH levels. Figure 6F illustrates a significant reduction in GSH levels across the four breast cancer cell lines following MSNs@Fe²⁺@DOX treatment, underscoring its potent ferroptotic induction. MDA is one of the products of membrane lipid peroxidation, which could show the intracellular ferroptosis level.³⁷ The MDA assay also demonstrated significant intracellular MDA accumulation, indicative of increased ferroptosis upon MSNs@Fe²⁺@DOX treatment (Figure 6G). Additionally, C11-BODIPY 581/591, a lipid-soluble fluorescent probe, was used to measure lipid peroxidation. Red fluorescence indicates non-oxidized states, while green fluorescence (oxidized state) indicates lipid peroxidation. As shown in Figure S5, both MSNs@Fe²⁺ and MSNs@DOX induced lipid peroxide production, with MSNs@Fe²⁺@DOX treatment resulting in the strongest green fluorescence, signifying a superior synergistic effect in inducing cellular ferroptosis.

3.7. In vivo synergistic anti-tumor effect of MSNs@Fe²⁺@DOX

Animal experiments were conducted to validate the in vivo efficacy of the synthesized nanomaterials. Figure 7A outlines the animal model construction process. Nude mice were intratumorally injected with saline, MSNs, MSNs@Fe²⁺, MSNs@DOX, or MSNs@Fe²⁺@DOX post-tumor formation. Two weeks post-injection, mice were euthanized for further analysis. Figures 7B and 7C depict rapid tumor proliferation in saline and MSNs-treated mice, while MSNs@Fe²⁺ and MSNs@DOX-treated mice exhibited slower tumor growth. Notably, MSNs@Fe²⁺@DOX displayed the most effective tumor growth inhibition. Figure 7D visually depicts the final tumor tissue formation in nude mice. CDT has the advantages of higher tumor specificity and selectivity and lower systemic toxicity than conventional treatments.³⁸ Evaluation of mice’s biocompatibility via weight change curves (Figure 7E) revealed a steady increase in body weight, indicative of minimal toxicity. Histopathological analysis of major organs (heart, liver, spleen, lungs, and kidneys) from different treatment groups (Figure 7F) demonstrated no significant pathological damage, underscoring the long-term biosafety of CDT and the nanomaterials. Collectively, these results demonstrate that MSNs@Fe²⁺@DOX exhibits excellent synergistic anti-tumor effects and biocompatibility in vivo, with no significant damage to normal tissues.

Figure 7.

Evaluation of the anti-tumor efficacy of combined CDT and Chemotherapy using MSNs@Fe²⁺@DOX in vivo. (A) Timeline schematic for assessing the efficacy of MSNs@Fe²⁺@DOX nanomaterials in situ for breast cancer treatment. (B) Tumor weights in situ of 4T1 tumor-bearing mice following treatment with different nanomaterials over a 14-day period. (C) Time-dependent tumor volume curve in 4T1 tumor-bearing mice treated with various nanomaterials. (D) Macroscopic images of tumors extracted from 4T1 tumor-bearing mice post-treatment. (E) Monitoring of nude mice body weight throughout tumor development and nanomaterial treatment duration. (F) H&E staining of heart, liver, spleen, lung, and kidney sections from nude mice post-treatment; Scale bar = 100 μm.

However, despite many advantages, the clinical application of CDT is limited.³⁹ CDT relies on H₂O₂ as a substrate; the low endogenous levels of H₂O₂ in tumors restrict catalytic efficiency. Zhang et al. demonstrated that iron nanocrystals (FeNCs) release Fe²⁺ more readily in acidic tumor microenvironments compared to traditional magnetic nanomaterials like Fe₃O₄, thereby enhancing CDT efficacy.⁴⁰ It is indicated that we can develop novel CDT reagents with higher electron transfer rates in subsequent studies. The Fenton reaction requires optimal pH conditions (pH 4–5), whereas the weak acidity of solid tumors (pH 6–7) limits its activation. Notably, our synthesized MSNs@Fe²⁺@DOX exhibited a higher DOX release rate at pH 5.3 than at pH 6.4, indicating that maintaining a mildly acidic tumor environment could enhance therapeutic outcomes by modulating cellular acid-base balance. For instance, combining CDT-inducing agents with monocarboxylic acid transporter (MCT) inhibitors can reduce intracellular lactate/H⁺ efflux, inducing acidosis and increasing CDT efficacy.⁴¹ Additionally, the overexpression of GSH in the tumor microenvironment mitigates ·OH production, thus diminishing the therapeutic effect of CDT. Modifying synthesized nanomaterials, such as incorporating disulfide bond into MSNs, may further deplete GSH and augment CDT in tumors.⁴² Addressing these challenges will not only enhance the clinical feasibility of CDT but also inspire innovative strategies for future cancer therapies.

4. Conclusions

In summary, we have engineered an innovative multifunctional nanoplatform aimed at enhancing the therapeutic efficacy of combined CDT and chemotherapy in breast cancer. This nanoplatform catalyzes the in-situ decomposition of overexpressed H₂O₂ in tumor cells to produce ·OH via the Fenton reaction, augmenting intracellular ROS and lipid peroxidation levels, thereby inducing ferroptosis in breast cancer cells. Simultaneously, the encapsulated DOX promotes apoptosis by inhibiting DNA and RNA synthesis, while also facilitating ferroptosis synergistically with Fe²⁺, thereby amplifying the effectiveness of both CDT and chemotherapy. Notably, our nanoplatform is characterized by straightforward synthesis, biocompatibility, cost-effectiveness, and operational efficiency, addressing several limitations associated with conventional tumor therapies. Future enhancements may further augment the potency and targeting precision of these nanoparticles through surface modifications or the addition of functional components. This advancement holds promise as a strategic approach for improving the therapeutic outcomes in breast cancer and other malignant tumors in clinical practice, potentially paving the way for more sophisticated oncological treatment modalities and advancing the field of integrated cancer therapy.

Data Availability Statement

Data will be made available on request.