Novel SUN5 Mutation Associated with Acephalic Spermatozoa Syndrome: A Cross-sectional Study

Abstract

Background:

The SUN5 gene encodes a testis-specific protein required for sperm head–tail connection during spermiogenesis. The SUN5 gene has an established role in the acephalic spermatozoa syndrome (ASS) defect recognised by headless tails, spermatozoa with disrupted head–tail junction and also a few tailless heads in semen.

Aim:

This study aims to evaluate the genetic variants of all exons of the SUN5 gene and the protein expression in 10 men with ASS.

Settings and Design:

This cross-sectional study was conducted on 10 infertile men with ASS as a case group and 10 men with normal spermogram as a control group referred to the Royan institute between 2015 and 2020.

Materials and Methods:

Polymerase chain reaction and Sanger sequencing were performed on DNA extracted from patients’ peripheral blood. In addition, immunocytochemistry and western blotting were accomplished to evaluate the SUN5 protein expression in the patient carrying a distinct exonic variation.

Statistical Analysis Used:

No statistical analysis was needed to be done in this survey.

Results:

Sequencing outcomes represented one homozygous missense mutation (c.1073G>A [p.Arg358Gln]) in exon 13 of the SUN5 gene in one patient with 98% acephalic spermatozoa in the total sperm population. This mutation did not exist in the control group. SUN5 protein expression was completely undetectable in the patient with c.1073G>A.

Conclusion:

Based on current results, it could be concluded that c.1073G>A detected mutations in the SUN5 gene could alter the SUN5 protein expression and lead to male infertility due to ASS.

INTRODUCTION

Infertility is increasingly recognised as a serious, worldwide public health concern that has a remarkable impact on a couple’s life.[1] The most thorough definition of infertility based on the World Health Organization (WHO) and the International Glossary on Infertility and Fertility Care is “a disease characterised by the failure to establish a clinical pregnancy after 12 months of regular, unprotected sexual intercourse.[2]

According to the latest WHO investigation, approximately 48.5 million couples in the world are involved in this issue.[3] Nearly half of infertility problems are due to male factors.[4] Primary infertility arising from male factors is called male infertility, which is a complicated multifactorial defect with a diverse phenotype.[5] This disorder is comprised abnormal semen parameters such as reduced motility of sperm (asthenozoospermia), reduced count of sperm (oligozoospermia) and sperm with abnormal morphology (teratozoospermia).[2,6] Although genetic factors contributed to nearly 30% to 50% of male infertility cases, many genes remain unknown. Hence, investigation and identification of new genes, which affect male fertility, are obligatory.[7]

One of the major causes of male infertility is associated with abnormal sperm morphology. A spermatozoon, that has an oval head, a normal acrosome, a midpiece between 4.0 and 5.0 µm, and a tail around 50 µm long, is considered morphologically normal.[8] Teratozoospermia demonstrates an extensive range of abnormalities in the head, neck, midpiece and tail of sperm, merely or simultaneously.[9]

Acephalic spermatozoa syndrome (ASS) is a scarce and intense kind of teratozoospermia. For the first time in 1977, Zaneveld and Polakoski termed this kind of spermatozoa as “pinheads” which was then renamed to “decapitated spermatozoa” and “acephalic spermatozoa.”[10] ASS is recognised by headless tails, several spermatozoa with an abnormal head–tail junction and a number of tailless heads in semen.[11,12,13] An intact connecting piece also called head–tail coupling apparatus (HTCA) that connected sperm head and tail is essential for spermatozoa efficiency.[14] A defect in the configuration of the HTCA during spermiogenesis leads to an impaired head–tail connecting piece that causes ASS.[15,16,17]

Genetic factors have a key role in arising this syndrome.[18] Assessment of mouse models identified different genes that are associated with ASS, including Hook1,[19] Oaz3,[20] Odf1,[21] Prss21,[22] Cntrob,[23] Ift88[24] and Spata6[25] genes. Typically, in human, variants of these genes were not led to ASS and the genetic sources of ASS were almost unknown. New investigations have identified various genes implicated in the causation of this phenomenon. For instance, recent surveys on patients with ASS elucidated several pathogenic variants in ACTRT1,[13] PMFBP1[26] and SPATC1 L[27] genes account for ASS phenotypes. Moreover, in 2023, a nonsense mutation in SPATA20 (c.619C>T, p.Arg207*) was first recognised in an ASS patient resulting in SPATA20 degradation and a reduction in SPATA6 expression.[28] Despite these findings, the SUN5 (Sad1 and UNC84 domain containing 5) gene is still the first and fundamental gene involved in ASS in human.[18,29,30]

The SUN domain proteins family are transmembrane proteins, which settle in the inner nuclear membrane.[17,31] In mammals, five SUN domain proteins have been recognized, including SUN1-5.[15] This protein family contains a transmembrane domain in the N-terminus and a conserved SUN domain in the C-terminus. The transmembrane domain of the SUN proteins is located in the nucleoplasm and interacts with nuclear lamin proteins in the nucleoskeleton. The SUN domain that is near to the C-terminus of SUN protein interacts with different proteins in the outer nuclear membrane, such as the Kash (Klarsicht, ANC-1 and Syne homology) protein. As a result, the SUN domain family builds a bridge between the nucleoskeleton and the cytoskeleton through constituting LINC complexes (linker of nucleoskeleton and cytoskeleton).[15,31] Therefore, the link complex has a basic role in nuclear relocation/movement and chromosomal movements in the meiosis stage.[12,32]

The SUN5 gene also called SPAG4 L (sperm-associated antigen 4-like protein) possesses 13 exons and is located on chromosome (20q11.21). It is a testis-specific gene[33] that encodes a testis-specific protein with 43-kDa and 379 amino acids.[34] SUN5 is a transmembrane protein that is located in[17] and consists of a transmembrane domain in the N-terminus, a coiled-coil[2] domain and a SUN domain in the C-terminus.[18] SUN5 protein is settled in the region of the sperm head–tail junction in HTCA, so it has a key role in connecting sperm’s head and tail.[18,31]

In 2016, Zhu et al., identified that the SUN5 gene is implicated in the emergence of ASS. They accomplished whole-exome sequencing (WES) and Sanger sequencing on 17 unrelated infertile men with ASS. First of all, WES was done on 2 men and the SUN5 gene was opted as a candidate. After that Sanger sequencing for the SUN5 gene was done on 15 infertile men. Eventually, 10 homozygous or compound heterozygous mutations were identified in 8 of 17 patients (about 47.06%). These point mutations included two nonsense, one frameshift, two splice sites and five missense mutations. The protein expression was assessed by immunofluorescence and western blotting. In consequence, Zhu et al. found that the observed mutations in the SUN5 gene led to the loss of function of SUN5 protein and ASS.[18] To confirm the previous findings, in 2017, Elkhatib et al. performed Sanger sequencing of the SUN5 gene on three relatives of African men. They detected a deletion-insertion variant in the SUN5 gene, that eliminates 5090 bp, consisting of exon 8. This mutation led to the frameshift and inactivation of the SUN5 gene in three patients.[35]

Considering the previous studies, the target of the current study was to evaluate the genetic variants of all 13 exons of the SUN5 gene and also assess SUN5 protein, in 10 infertile men with ASS who were referred to Royan Institute.

MATERIALS AND METHODS

Population study and clinical information

This cross-sectional study contains 10 infertile men with ASS as a case group and 10 men with normal spermogram as a control group. Participants were recruited from men referred to the Department of Andrology at the Reproductive Biomedicine Research Center at Royan Institute, Tehran, Iran, between 2015 and 2020. Semen analysis and preparation of spermogram were done for all participants. Patients were collected based on the selection criteria including (a) infertile men with more than 50% of acephalic spermatozoa in the total sperm population, (b) normal 46, XY karyotype, and the control group was selected based on normal spermogram with emphasis on normal morphology according to 2010 WHO for semen analysis. This study was conducted in accordance with the Helsinki Declaration and the ethics committee of Royan Institute for Reproductive Biomedicine and each participant was informed about the study and gave written informed consent.

DNA extraction and genotype analysis

DNA samples were collected from the DNA Bank Center of Royan Institute. The salting-out method was applied to extract DNA from peripheral blood samples of participants. Due to our aims, to evaluate the genetic variants of whole exons of the SUN5 gene, 12 pairs of particular primers were designed utilising GeneRunner version 6.5, (developer: Frank Buquicchio) and Perlprimer version 1.1.21, (developer: Owen Marshall) for 13 exons [Table 1].

Table 1.

Twelve pairs primers that designed for thirteen exons of the SUN5 gene

Primer name		Primer sequence (5’→3’)		Product size (bp)		Temperature (°C)
SUN5 – Forward 1		TGTCCAGCTTCTGAGACC		559		55.82
SUN5 – Reverse 1		CTGCTTCACCACTTCCTG		559		55.27
SUN5 – Forward 2 and 3		GGGAAACCTTCTCTGTACCT		620		56.15
SUN5 – Reverse 2 and 3		ACTTTGGCAGGAATGATACC		620		55.39
SUN5 – Forward 4		AACCAGTGCCCACCTGTAG		391		59.24
SUN5 – Reverse 4		GGATAGCTTTTCTGGTCTGGC		391		58.71
SUN5 – Forward 5		AAGGGATAGGGCAAACAG		526		53.72
SUN5 – Forward 5		CTCCAAAGCCAGTATATGTC		526		53.18
SUN5 – Forward 6		CGCCTTCTTCTCTTTGCCAG		483		59.20
SUN5 – Reverse 6		TGGATCTGGGTCAAGTCAGG		483		58.72
SUN5 – Forward 7		ATGGATAAGGGAGGGTGG		631		54.76
SUN5 – Reverse 7		CATCAGGTGGTGTCTTGG		631		54.92
SUN5 – Forward 8		TTTAACCAAGACACCACCTG		608		56.4
SUN5 – Reverse 8		CCAGCCAAACTATCAACCA		608		55.2
SUN5 – Forward 9		GTTAGGGAGAGGACAGCGT		299		59.5
SUN5 – Reverse 9		ATGAACTTCCCAGCGGCA		299		56.1
SUN5 – Forward 10		ATAGTCAGGGCCCATCAGTG		481		60.5
SUN5 – Reverse 10		CAAAGCAAGCTGTCCCTCTG		481		60.5
SUN5 – Forward 11		GCATGGGTAGTCAGGAGAG		621		59
SUN5 – Reverse 11		CAAAGCAAGCTGTCCCTCTG		621		58
SUN5 – Forward 12		TGTCTCGGTGAAATAAGGTC		610		58
SUN5 – Reverse 12		AAGAAACACAGCAAGAGGG		610		55
SUN5 – Forward 13		ATATCGACTTGCTGTGAGG		540		55.2
SUN5 – Reverse 13		CTGCCATTTGTTGTCTGTC		540		55.2

Polymerase chain reaction, sequencing and Sanger sequencing

Polymerase chain reaction (PCR) was performed in a volume of 30 µL reaction mixture including 17 µlddH2O, 1 µL genomic DNA, 1 µL from each primer (10 pmol/µL) and 10 µL Taq 2x master mix (AMPLIQON). The PCR assay was containing one cycle of an initial DNA denaturation at 95°C for 3 min, followed by 31 cycles of DNA denaturation at 95°C for 30 s, an annealing phase at melting temperature (TM) between 58.5°C and 63°C for 30 s, extension phase at 72°C for 1 min and a final extension cycle at 72°C for 5 min. Afterward, Sanger sequencing was performed, and achieved results were analysed with Finch TV software version 1.4, (developed by Geospiza, Inc.) and the nucleotide BLAST bioinformatics Software.

Protein assessment

In our study, immunofluorescence staining and western blotting were performed on four individuals; the affected individual carrying c.1073G>A variant (P2), two affected individuals with no observed mutation in all thirteen exons of the SUN5 gene (P1 and P3) and one control (C).

Immunofluorescence staining

Semen samples were washed with phosphate-buffered saline (PBS) and smeared on slides. The dried slides were fixed with 4% paraformaldehyde in PBS for 20 min and then permeabilized with 0.5% Triton X-100 in PBS. The blocking step was done using a blocking solution containing goat serum for 1 h at room temperature. Subsequently, the blocked slides were incubated with the primary anti-SUN5 antibody (dilution 1:50, 17495-1-AP, Proteintech, United States) at 4°C overnight. Alexa Fluor‐488 goat anti‐rabbit immunoglobulin G (dilution 1:500, A27034, Invitrogen) was applied as the secondary antibody for 1 h at room temperature, and DAPI (4,6‐diamidino‐2‐phenylindole) counterstained the nuclei.

Western blotting

Semen samples were washed twice in PBS through centrifugation at 3000 rpm for 5 min. After that 300 µl lysis buffer mixture was added and centrifuged was done at 12,000 g in 15 min, then the concentration of proteins extracted was determined by bicinchoninic acid assay. A certain amount of water and 2 µL sample buffer that included (312.5 mM Tris-HCl, 10% sodium dodecyl sulfate [SDS], 50% glycerol, 28.75% b-mercaptoethanol, 0.25% bromophenol blue) was added to protein samples to loading samples on 12% SDS-polyacrylamide gel electrophoresis. Thereafter, proteins were transferred to a polyvinylidene difluoride membrane overnight. Blocking with 1% dry milk for 1 h, incubating with specific firstly SPAG4 L rabbit antibody with 1:500 concentration at 4°C overnight and adding anti-rabbit secondary antibody at a dilution of 1:20,000 was performed sequentially on the blot. Eventually, to reveal specific bands of the protein, the substrates (Luminol Solution Amersham ECL Select and Peroxide Solution ECL Select) were augmented to the blot. Then, Gel-doc device took a picture from the blot.

RESULTS

Genotyping results

The Sanger sequencing results indicated a novel homozygous mutation in one of our patients with 98% of acephalic spermatozoa in the total sperm population. This variant (c.1073G>A [p.Arg358Gln]) with rs1412396592 was recognised in exon 13 of the SUN5 gene and the related amino acid located in the SUN-domain region of SUN5 protein. This missense mutation caused nucleotide G to A substitution that changed codon CGA to CAA [Figure 1a] and leaded to the replacement of arginine to glutamine in SUN5 protein. This genetic variant was not recognised in the control group [Figure 1b] and also has not been reported before in association with ASS in former manuscripts.

Figure 1.

SUN5 point mutation. (a) Sequencing results demonstrated a homozygous genetic mutation (c.1073G>A [p.Arg358Gln]) in exon 13 of the SUN5 gene. (Nucleotide G to A substitution is shown with arrow) (b) Sequencing outcome in the control group revealed no mutation in the specified region. In this diagram, one random sample from the control group is shown

ClinVar (https://www.ncbi.nlm.nih.gov/clinvar/) datasets were applied to assess the relationship between c.1073G>A variation and asserted conditions. Unfortunately, no data were available about this SNP on the ClinVar database. Hence, we performed a very brief bioinformatics prediction using I-mutant (https://folding.biofold.org/i-mutant/i-mutant2.0.html) and polymorphism phenotyping v2 (PolyPhen-2) (http://genetics.bwh.harvard.edu/pph2/) tools. Protein sequence was submitted to the I-Mutant server to calculate ΔΔG and the reliability index (RI). Based on the I-Mutant score, the R358Q amino acid replacement was predicted to decrease the stability of the SUN5 protein with a ΔΔG of −1.68 and an RI of 9, respectively. Moreover, the polyPhen-2 server predicted the mutation as “probably damaging: with a score of 1.000.

Immunofluorescence results

Immunofluorescence staining represented no expression of the SUN5 protein in the affected individual (P2) carrying c.1073G>A (p.Arg358Gln) variant [Figure 2], this is while the sharp signal of SUN5 protein confined to the head–tail junction of spermatozoa in control individual and P1. In an acephalic patient (P3) with no detected genetic variants in the SUN5 gene exons, a reduction in the SUN5 expression was observed; however, the localization pattern and protein distribution were completely similar to intact spermatozoa [Figure 2].

Figure 2.

Immunofluorescence staining results of the SUN5 protein in the patient with distinct genetic mutation compared to the control individual. (a and b) Sharp signals of SUN5 protein were observable in the head–tail junction of the spermatozoa in the control individual and P1 patient respectively. (c) Complete loss of SUN5 signals was detected in P2 patients with acephalic syndrome carrying c.1073G>A mutation. (d) Reduction of the SUN5 protein expression in P3 individuals represented no mutation in the SUN5 gene

Western blotting results

Western blotting technique was performed on the same four individuals as the immunofluorescence (P1-P3, and C). Expression of SUN5 protein was not detected in P2, whereas a 43 kDa band of SUN5 protein was observed in P1 and control individuals. Besides, the amounts of expression of the SUN5 protein band were remarkably lower in P3 than in the control [Figure 3].

Figure 3.

Western blotting result. Western blotting demonstrated the expression of SUN5 protein in spermatozoa. SUN5 (Proteintech antibodies, 17495-1-AP) represented a full 43kDa band in control and P1 individuals. SUN5 protein was undetectable in P2 which had (c.1073G>A [p.Arg358Gln]) mutation in the SUN5 gene whereas, there was a sharp reduction in its expression in P3 patient. Beta-actin was used as a control for the accuracy of the experiment

DISCUSSION

Male infertility is a major health disorder that impresses millions of couples in the world,[36] which occurs for different reasons and one of these most important reasons is genetic defects,[7,37] despite all investigations on genetic factors in male infertility, many genes are unidentified. ASS is a scarce kind of teratozoospermia that leads to male infertility and has a strong genetic basis.[38] The SUN5 gene is one of the most principal genes associated with ASS; the SUN5 protein is an essential and functional protein required for the normal assembly of head and tail conjunction in spermatozoa.[18,29,35] Pursuant to the former findings, in the present study, the SUN5 gene was investigated in 10 infertile men with ASS.

In this research, the novel variant was detected in one patient, this variant has not been previously reported in connection with ASS. Because of the low positivity of this mutation among the study population, no statistical analysis was necessary to be performed in this research. The observed homozygous missense mutation was (c.1073G>A [p.Arg358Gln]) with (rs1412396592) which is located in exon 13 of the SUN5 gene. This mutation alters codon CGA to CAA due to substituting nucleotide G with A. Consequently, the positively charged amino acid, arginine, is converted to the amino acid glutamine which is polar noncharged that could reform the protein structure. Furthermore, obtained results of western blotting and immunocytochemistry did not reveal any expression of the SUN5 protein in the patient with c.1073G>A mutation.

This mutation is located within the SUN domain of SUN5 protein and might disturb the interaction of SUN5 with the KASH or LINK complex as a result of folding alterations. The disruption of this well-organized structure could lead to dissociation between the nucleoskeleton and cytoskeleton, subsequently making the junction fragile enough to cause head–tail detachment. In addition, Zhu et al. 2016, speculated that some mutations in the SUN5 gene might perturb the dynamic distribution of this protein at the final stage of spermatozoa differentiation, hence, SUN5 would be more susceptible to be discarded by the residual body.[18]

Regarding the reduction of the SUN5 expression in P3 individual, it should be mentioned that many molecular factors can decrease the expression of a specific protein even if there is no mutation in the gene. It is possible some changes in the post-translational modifications of SUN5 would decrease its stability, or the expression level of SUN5 regulatory microRNAs might increase the SUN5 mRNA degradation. It is also probable that some genetic variations in the SUN5 gene interacting partners lead to the mislocalization of SUN5 and its export from the cell by residual bodies. Hence, molecular defects responsible for this phenomenon remain to be defined.

Previous studies revealed that patients with ASS having SUN5 mutations have a good pregnancy outcome after intracytoplasmic sperm injection treatment.[30,32] In this regard, we closely investigated the medical records of the patient with the mentioned mutation, 98% of spermatozoa were acephalic in the total sperm population. Moreover, spermatozoa had very low concentration in the ejaculate sample and represented poor motility; we also assessed whether this couple used any assisted reproductive technology (ART) or not, unfortunately, they ceased their treatment process and did not undergo ART.

Eventually, it is supposed that the observed mutation (c.1073G>A) could alter the SUN5 protein structure and disrupt interactions between proteins in the head–tail sperm junction. In addition, as the results of our protein assessment, a complete absence of SUN5 protein was observed in spermatozoa of patients with (c.1073G>A). Hence, according to the essential function of the SUN5 protein in the junction of the sperm head and flagellum, we presume that the detected mutation (c.1073G>A) in the SUN5 gene most likely leads to ASS.

CONCLUSIONS

Because of the c.1073G>A effect on the SUN5 expression and its probable impact on SUN5 stability, c.1073G>A can be considered one of the mutations which could lead to ASS in a subset of acephalic patients. However, because of our small sample size, doing an investigation using a larger sample size deserves to prove this claim in the future.

Author contributions

M.S. developed the concept. S.A., F.E.C. and A.R. performed the experiments and drafted the manuscript. S.H.H., A.J. and M.S.G. provided general support.

Conflicts of interest

There are no conflicts of interest.

Data availability statement

The data that support the findings of this study are available from the corresponding author, upon reasonable request.

Funding Statement

This work was supported by the Royan Institute. Royan Institute for Reproductive Biomedicine, ACECR, Tehran, Iran.