Abstract
Staphylococcus saprophyticus surface-associated protein (Ssp) was the first surface protein described for this organism. Ssp-positive strains display a fuzzy layer of surface-associated material in electron micrographs, whereas Ssp-negative strains appear to be smooth. The physiologic function of Ssp, however, has remained elusive. To clone the associated gene, we determined the N-terminal sequence, as well as an internal amino acid sequence, of the purified protein. We derived two degenerate primers from these peptide sequences, which we used to identify the ssp gene from genomic DNA of S. saprophyticus 7108. The gene was cloned by PCR techniques and was found to be homologous to genes encoding staphylococcal lipases. In keeping with this finding, strains 7108 and 9325, which are Ssp positive, showed lipase activity on tributyrylglycerol agar plates, whereas the Ssp-negative strain CCM883 did not. Association of enzyme activity with the cloned DNA was proven by introducing the gene into Staphylococcus carnosus TM300. When wild-type strain 7108 and an isogenic mutant were analyzed by transmission electron microscopy, strain 7108 exhibited the fuzzy surface layer, whereas the mutant appeared to be smooth. Lipase activity and the surface appendages could be restored by reintroduction of the cloned gene into the mutant. Experiments using immobilized collagen type I did not provide evidence for the involvement of Ssp in adherence to this matrix protein. Our experiments thus provided evidence that Ssp is a surface-associated lipase of S. saprophyticus.
Staphylococcus saprophyticus, an important cause of urinary tract infections, binds fibronectin (7) and laminin (35) and hemagglutinates sheep erythrocytes (22). It produces two major surface proteins, the S. saprophyticus surface-associated protein (Ssp) (6) and an autolysin adhesin (Aas) (7, 9, 21).
Ssp was the first described surface-associated protein of S. saprophyticus (7). It is produced by most clinical isolates but is absent in the type strain of S. saprophyticus, strain CCM883. In electron micrographs this protein forms fuzzy surface appendages that fulfill the definition of fibrillae. Participation of these appendages in adherence has been suggested, but this possibility is still being debated because in the experiments the workers used the purified and possibly aggregated protein and cultured tubular epithelial cells; i.e., they studied rather artificial conditions (10). Immobilized Ssp does not bind fibronectin, fibrinogen, collagen, or laminin (7). Functional studies of Ssp have been hampered by the lack of specific mutants and by difficulties in cloning the gene.
Lipases have been implicated as possible virulence determinants in the pathogenesis of a number of localized infections, such as boils or abscesses (19, 20, 36), and studies utilizing in vitro expression technology have also indicated that lipases are produced during infections in a murine abscess model (29).
The contribution of these enzymes to virulence, however, is not clearly understood, although it has been suggested that lipases may be important for the colonization and persistence of resident organisms on the skin, possibly in relation to nutrition or by the release of free fatty acids which may promote adherence (18, 28).
The production of lipases is a common property of staphylococci. Many staphylococcal lipases have been purified and biochemically characterized (24, 46). They have the tendency to form aggregates (23, 24, 26, 46), and they have wide substrate specificity (38, 44, 45). The activity of some enzymes appears to be stimulated by calcium ions and is inhibited in the presence of chelators, such as EDTA (33, 38, 43). Some of them have been characterized as esterases rather than lipases.
The enzymes are produced as preproenzymes, which have molecular masses of approximately 70 kDa. After secretion into the growth medium, proteolytic processing results in mature forms with molecular masses of 40 to 46 kDa (2, 17, 38).
Surface-bound lipases may play a role in adhesion to extracellular matrix proteins, such as collagen (42), or they may enzymatically modify cellular surface molecules (42).
In this report, we describe cloning and characterization of Ssp of S. saprophyticus and provide evidence that Ssp is a surface-associated lipase.
MATERIALS AND METHODS
Bacterial strains and plasmids.
The bacterial strains and plasmids used in this study are listed in Table 1. S. saprophyticus strain 7108, a hemagglutinating and fibronectin-binding clinical isolate, has been described previously (6). For cloning, a lambda-Zap-Express library of this strain kindly provided by W. Hell was used (21). Escherichia coli XL1 Blue MRF′ (Stratagene, La Jolla, CA) was the host used for the phage and the phagemids. E. coli XLOLR (Stratagene) was used for in vivo excision. E. coli DH5α was the host used for expression experiments and the intermediate host used during construction of the plasmids for allelic replacement. For allelic exchange, the shuttle vector pBT2 (4), which contains the temperature-sensitive replicon of pE194, the chloramphenicol resistance site of pC194, and the multiple-cloning site of pUC18, was used. Plasmid pEC4 (4) was used as the ermB source. Also, we used the pCR II TOPO-Vector (Invitrogen, Karlsruhe, Germany). The pPS44 vector (47) was used for cloning experiments involving Staphylococcus carnosus and for complementation experiments.
TABLE 1.
Strains and plasmids used in this study
| Strain or plasmid | Species or vector | Size (kb) | Characteristicsa | Source and/or reference |
|---|---|---|---|---|
| Strains | ||||
| XL1 Blue MRF′ | E. coli | Δ(mrcA)183 Δ(mrcCB-hsdSMR-mrr)173 endA1 supE44 thi-1 recA1 gyrA96 relA1 lac[F′ proAB lacIq ZΔM15 Tn5(Kan′)]c; strain for construction of phage | Stratagene | |
| XLOLR | E. coli | Δ(mrcA)183 Δ(mrcCB-hsdSMR-mrr)173 endA1 supE44 thi-1 recA1 gyrA96 relA1 lac [F′ proAB lacIq ZΔM15 Tn5(Kan′)]cSu− λr: Strain for in vivo excision | Stratagene | |
| DH5a | E. coli | F−(I′) (F80dlacZΔ M15)Δ(IlacZY aargF)U169 genV44 deoR gyrA relA91 endA1 thi-1 hsdR17, cloning host | Grant et al. | |
| TM300 | S. carnosus | Wild-type SK311 | 41 | |
| TM300(pMB1108) | S. carnosus | Cmr, containing pMB1108 and expressed protein Ssp | This study | |
| 9491 | S. epidermidis | Containing GenD, control strain | ATCC (3)b | |
| RN6390 | S. aureus | Wild-type 8325-4 strain, lack of cna gene | 34 | |
| 7108 | S. saprophyticus | Wild-type isolate: hemagglutination positive | 12 | |
| 7108 Δssp | S. saprophyticus | Isogenic ssp knockout mutant of 7108 | This study | |
| 7108 Δssp(pMB1108) | S. saprophyticus | Isogenic ssp knockout mutant of 7108 containing pMB1108 | This study | |
| Plasmids | ||||
| pBT2 | 6.97 | Staphylococcal shuttle vector, temperature-sensitive replicon of pE194, Cmr of pC194, Apr of pUC18 | 4 | |
| pPS44 | 4.38 | Containing replicon and cat gene of pC194 | 47 | |
| pUC18 | 2.69 | Apr | Invitrogen | |
| pCR II-TOPO-Vector | 3.90 | Apr Kmr | Pharmacia | |
| pUC19 | 2.69 | Apr | Strategene | |
| pBK-CMV | 4.51 | Kmr Nmr | This study | |
| pMB1100 | pCR II TOPO- Vector | 4.7 | 800 bp of ssp gene | This study |
| pMB1101 | pCR II TOPO- Vector | 6.9 | 3-kb fragment containing partial ssp gene (amino acids 1 to 661) | This study |
| pMB1102 | pCR II TOPO- Vector | 7.9 | 4-kb fragment containing partial ssp gene (amino acids 186 to 755) | This study |
| pMB1103 | pUC18 | 6.0 | Complete ssp gene (3 kb) | This study |
| pMB1105 | pUC18 | 5.0 | pMB1103 insert from −136 bp to 2,161 bp is replaced with ermB | This study |
| pMB1106 | pBT2 | 9.5 | Containing insert of pMB1105 | This study |
| pEC4 | pBlueScript | 4.41 | Emr Apr, donor of ermB cassette containing ClaI sites on both ends | 4 |
| pMB1108 | Vector part of pPS44 | 5.5 | Complete ssp gene (insert from pMB1103) | This study |
Apr, ampicillin resistance; Kmr, kanamycin resistance; Cmr, chloramphenicol resistance; Nmr, neomycin resistance.
ATCC, American Type Culture Collection.
Bacterial growth media and antibiotics.
E. coli strains harboring plasmids were grown in Luria broth or on L agar. S. saprophyticus strain 7108 was grown in peptone yeast extract broth or on agar plates (6). Bacteria were usually incubated at 37°C, but in some experiments 30°C and 42°C were also used. Ampicillin (100 μg/ml) was used for selection of plasmids in E. coli. For selection of plasmids or chromosomal markers in S. saprophyticus, 10 μg/ml chloramphenicol and 5 μg/ml erythromycin were used.
DNA techniques. (i) DNA manipulation.
Restriction and ligation were performed by standard techniques (39). All restriction enzymes and T4 ligase were obtained from Roche (Mannheim, Germany). E. coli was transformed by the CaCl2 method, and S. saprophyticus and S. carnosus were transformed by protoplast transformation (14, 15, 21).
(ii) DNA preparation.
Plasmid DNA was isolated using plasmid miniprep or midiprep isolation kits (QIAGEN, Hilden, Germany). In some experiments we also used plasmid DNA prepared by cesium chloride density gradient ultracentrifugation (21, 39). Chromosomal DNA of S. saprophyticus strain 7108 was prepared by the QIAGEN method.
(iii) DNA (Southern blot) hybridization.
Southern blot hybridization was performed as described previously (39). Chromosomal DNA was digested with the appropriate restriction enzyme, resolved on 0.8% Tris-borate-EDTA gels, and transferred onto positively charged nylon membranes (Roche). For dot blot hybridization 300 ng cellular DNA was spotted onto positively charged nylon membranes (Roche). Digoxigenin-labeled probes were prepared using a PCR labeling kit (Roche). For construction of the ermB probe, primers ermB4R and ermB4/PstI (Table 2) were used, and the cat probe was generated with primers CATpBT2seq and CATpBT2rev. Also, a 1.4-kb fragment of the ssp gene was labeled with primers prot12rev and prot2seq and used as a probe for dot blotting. Hybridization and washing were carried out under stringent conditions (5× SSC, 0.1% sodium dodecyl sulfate [SDS], 50% formamide at 42°C; three washes for 20 min with 2× SSC, 0.1% SDS at 68°C [1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate]). For detection of the hybridized DNA a Dig luminescent detection kit (Roche) was used. The membrane was subjected to autoradiography with Amersham Hyperfilm MP (Amersham, Freiburg, Germany).
TABLE 2.
Cloning and PCR primers used in this study
| Primer | Sequence (5′-3′)a | Use (location [bp]) |
|---|---|---|
| Prot1rev/HindIII | CGCAAGCTTGC(AG)AC(AGCT)GT(AG)TT(AG)TT(AG)GCGAGCAT | Cloning (1009 to 1023) |
| Prot1seq/BamHI | CGCGGATCCAC(AGCT)GA(AG)AC(AGCT)CA(CT)CA(AG)AA(AG)GT | Cloning (112 to 140) |
| Prot2seq | CGCGGATCCTCAGTTAATGATGTAGAGGT | Cloning (310 to 327) |
| Prot2rev | CGCAAGCTTCTGACTGCGATGTAGAGGT | Cloning (235 to 253) |
| Prot4seq | CGCGGATCCCAACTGCAAATGTAAATCCC | Cloning (554 to 573) |
| Prot6seq | AAGAACTTTCAGTAACACC | Cloning (595 to 614) |
| Prot7rev | CGCAAGCTTACCAGTATCAGGTAA | Cloning |
| Ssaprot14SstI | CGCGAGCTCAAATTCAGAGAATTAGTAGCC | Cloning (−671 to −650) |
| Ssaprot14Xbal | CGCTCTAGAATGAAGAGTTACGTTCACAC | Cloning (2474 to 2493) |
| Ssaprot16ClaI | CGCATCGATAGATACAAAACGTACACG | Cloning (2163 to 2180) |
| Ssaprot12rev | ATTTGACGAACAATGGCC | Cloning (1641 to 1658) |
| catpBT2seq | GTTACAGTAATATTGACT | PCR, digoxigenin probe synthesis (183 to 201) |
| catpBT2rev | CATAAACAATCCTGCATG | PCR, digoxigenin probe synthesis (872 to 890) |
| ermB4R | TCTAGAACTAGTGGATCCC | PCR, digoxigenin probe synthesis |
| ermB/PstI | TATTGTCTGCAGCCGAGAGTGATTGGTCTT | PCR, digoxigenin probe synthesis |
| pPS44rev/SstI | ATAGAGCTGGTGACCACTTGTGATAACG | PCR, cloning |
| pPS44seq/XbaI | TGCTCTAGAACTCGTGTGCATAATTCACGC | PCR, cloning |
Restriction sites in the 5′ extensions of primers are underlined.
(iv) DNA sequencing.
Both strands of the cloned DNA were automatically sequenced (LI-COR DNA sequencer 4000; LI-COR, Bad Homburg, Germany). For initial sequencing, the standard pUC/M13 primers (labeled with IRD800; MWG, Ebersberg, Germany) were used. Extension of DNA sequences was accomplished by primer walking.
(v) Construction and isolation of an insertion mutant.
The ssp gene was interrupted by insertion of the ermB resistance gene, and pBT2 was used as the replacement vector. The whole ssp gene was cloned in pUC19 using the XbaI and SstI sites of the multiple-cloning site. The resulting plasmid, pMB1103, served as the template for an inverse PCR with primers Ssaprot16seqClaI and Ssaprot6rev; the Ssaprot16seqClaI primer contains a ClaI site. As the cloned gene downstream of the Ssaprot16seqClaI primer also contains this restriction site, the PCR product could be digested with ClaI, yielding two fragments. The appropriate fragment was eluted from a gel and ligated with the ermB cassette, which had been excised from pEC4 with ClaI. The resulting plasmid, containing the interrupted gene in pUC19, was designated pMB1105. XbaI and SstI were used to excise the interrupted ssp gene and clone it into the XbaI- and SstI-treated vector pBT2, yielding pM1106.
Plasmid pMB1106 was purified from E. coli DH5 by cesium chloride density ultracentrifugation and transformed into S. saprophyticus strain 7108 by protoplast transformation (21). Chloramphenicol- and erythromycin-resistant clones were grown in the presence of erythromycin (5 μg/ml, 30°C, 24 h), and 5 ml was used to inoculate 1,000 ml of prewarmed (42°C) broth containing erythromycin (5 μg/ml). After overnight incubation, appropriate dilutions were plated onto P-agar containing erythromycin (5 μg/ml). Clones that grew on erythromycin but not on chloramphenicol had lost the plasmid and were checked for Ssp expression.
(vi) Complementation.
The vector part of pPS44 was amplified with primers containing an SstI site and an XbaI site (pPS44rev/SstI and pPS44seq/XbaI, respectively) (Table 2). The ssp gene was excised from pMB1103 with SstI and XbaI and cloned into this plasmid. The resulting plasmid (pMB1108) was transformed into S. carnosus TM300, purified from this strain, and introduced into the ssp-negative mutant by protoplast transformation.
SDS-PAGE.
Purified proteins were subjected to SDS-polyacrylamide gel electrophoresis (PAGE) with 11% acrylamide resolving gels and stained with Coomassie blue R250 (Sigma) for protein detection (39).
Preparation and purification of Ssp.
S. saprophyticus was grown overnight on dialysis membranes that had been placed on brain heart infusion (Oxoid, Wesel, Germany) agar plates (7). The plates did or did not contain EDTA (200 μM) to avoid proteolytic processing (10). The cells were washed once in phosphate-buffered saline (PBS), and the proteins were released from the cell wall by vortexing for 5 min and were purified by gel chromatography as described previously (6, 10).
N-terminal sequencing and partial proteolytic digestion of purified native Ssp.
The purified native protein was used to determine its N-terminal amino acid sequence. We used the serine endoproteinase V8 (sequencing grade; Roche). The assay was performed as described by the manufacturer. To obtain fragments of suitable sizes, we tested different incubation times ranging from 30 min to overnight (25°C). We used 2 μg Ssp per sample and several dilutions of the protease (5, 2, 0.2, and 0.02 μg). The reaction products were separated by SDS-PAGE and electroblotted onto polyvinylidene difluoride (PVDF) membranes (Immobilon-PSQ; Millipore Corporation, Bedford, MA). Proteins on the PVDF membranes were visualized by staining with 0.2% Coomassie brilliant blue in 50% (vol/vol) methanol. A band at 40 kDa was excised, and its N-terminal sequence was determined. N-terminal sequencing was performed by the TOPLAB laboratory (Toplab, Martinsried, Germany).
Lipase activity assay.
Lipase activity was determined by an agar plate assay with Ca2+-containing tributyrylglycerol basic agar or 1% agarose containing 1% (vol/vol)Tween 20, as described by Nikoleit et al. (33).
Activity staining.
Proteins were separated by SDS-PAGE under nonreducing conditions. After electrophoresis, the gels were washed for 2 min in 20% isopropanol and then twice for 5 min in 20 mM Tris-HCl, pH 8.0. The gels were then laid on top of agar plates containing tributyrylglycerol or Tween 20 as the substrate, and the plates were incubated until clearing zones or white precipitation zones appeared (18 h, 37°C).
Binding of bacteria to immobilized collagen.
Microtiter plates (Immulon 4; Dynex Technologies, Chantilly, VA) were coated with 1 μg of collagen I (Vitrogen; Cohesion, Palo Alto, CA) in 100 μl of PBS (140 mM NaCl, 0.27 mM KCl, 0.43 mM Na2HPO4, 0.147 mM KH2PO4, 0.02% NaN3; pH 7.4) per well overnight at 4°C. The wells were then washed three times with PBS and blocked with 1% bovine serum albumin in PBS for 1 h before addition of bacteria. Bacteria were grown in 25 ml PY broth to the mid-logarithmic or stationary phase, pelleted, and washed with PBS, and the OD600 was adjusted to 6.0. Bacterial suspensions were added to the wells (100 μl cells/well), and the plates were incubated for 2 h at room temperature. The bacterial suspensions were carefully aspirated, and the wells were washed twice with 200 μl PBS. Adherent cells were fixed with 100 μl of 25% aqueous formaldehyde and incubated at room temperature for 30 min. Wells were gently washed two times with 200 μl PBS, stained with carbol fuchsin for 5 min, washed again with PBS, and read with an enzyme-linked immunosorbent assay plate reader at 550 nm. Staphylococcus epidermidis 9491, which is known to express a collagen-binding lipase, and Staphylococcus aureus Cowan I served as positive controls, and S. carnosus TM300 and S. aureus RN6390 were used as negative controls.
Electron microscopy.
For electron microscopy, S. saprophyticus cells that had been grown on dialysis membranes were fixed for 2 h in 2.5% glutaraldehyde in phosphate buffer (pH 7.2). After postfixation in osmium tetroxide and block contrasting with uranyl acetate, the preparations were dehydrated with increasing alcohol concentrations and embedded in Epon 812. Thin sections were cut using a Reichert Om U3 ultramicrotome (Wien, Austria), stained with methylene blue for 2 min, and evaluated by light microscopy. Ultrathin sections of selected cell areas were stained with lead citrate and examined by transmission electron microscopy (EM 900; Zeiss, Germany) (32).
Computer analysis.
DNA sequence analyses were performed with the BLAST program (1). Database and homology searches were carried out using the NIH BLAST program (1).
Nucleotide sequence accession number.
The nucleotide sequence determined has been deposited in GenBank under accession number AY551101.
RESULTS
Cloning of Ssp.
Native Ssp was purified from S. saprophyticus strain 7108 and used to derive the N-terminal amino acid sequence TETHQKVGTSE.
For cloning, purified native Ssp was partially digested with S. aureus V8 protease, the peptides were separated and electroblotted onto a PVDF membrane (Fig. 1), and the N-terminal amino acid sequence of a 40-kDa fragment was determined (MLANNTVATTNNTSQ). The degenerate primers Prot1seq/BamHI and Prot1rev/HindIII were constructed from the amino acid sequences and used to amplify an 800-bp fragment of the gene using chromosomal DNA from strain 7108 as the template (pMB1100). Sequencing of this fragment revealed one incomplete open reading frame that did not show any homology in a BLAST search.
FIG. 1.

Partial proteolytic digestion of Ssp with V8 protease: Western blot on PVDF membrane. Ssp was purified, and 2 μg protein was digested with 5 μg (lane A), 2 μg (lane B), 0.2 μg (lane C), and 0.02 μg (lane D) of V8 protease at 25°C for 18 h. Lane M contained a molecular weight marker (Sigma, United States). The N-terminal amino acid sequence of the 40-kDa fragment (arrow) was determined.
In an attempt to complete the gene encoding the Ssp protein of S. saprophyticus, BclI-digested chromosomal DNA was religated and used as the template for inverse PCR with primers Prot2seq and Prot2rev (Table 2), which were derived from the 800-bp sequence. The resulting 3-kb PCR fragment was subcloned into the pCR II TOPO-Vector, yielding pMB1101, and sequenced. The sequence contained the N-terminal part of an open reading frame.
With this technique it was not possible to clone the C terminus of the ssp gene. Therefore, because we expected a surface protein, we derived a primer (Prot7rev) from the LPXTG motif. PCR was performed with a specific forward primer in the known sequence (Prot4seq) and the Prot7rev reverse primer using genomic DNA of S. saprophyticus 7108 as the template. The thermal profile included a first denaturation step at 95°C for 5 min, followed by 30 cycles of denaturation at 95°C for 30 s, primer annealing at 32°C for 2 min, and extension at 72°C for 10 min. Only one 4-kb amplificate was obtained in repeated experiments; it was cloned (pMB1102) and sequenced, and it contained one N-terminally incomplete open reading frame. In addition, 435 bp of the sequence obtained in the first PCR in which the primers derived from the peptides were used were present in this clone.
To show that the assembled sequence was contiguous within the chromosome, we derived one primer (Ssaprot14SstI) from the region upstream of the putative promoter and a second primer (Ssaprot14XbaI) from the sequence downstream of the putative stop codon of the whole sequence. These primers were used to amplify the whole ssp gene with its own promoter, using chromosomal DNA from S. saprophyticus 7108 as the template. A 3-kb amplificate was obtained, and it was cloned into the vector pUC18, yielding a plasmid designated pMB1103. The sequence of the insert was identical to the sequence assembled from the three PCRs. Also, we tested the Ssp-negative strain CCM883 and the Ssp-positive strain 9325 with this PCR. Strain CCM883 did not show an amplificate of the expected size, whereas 9325 did (data not shown).
Sequence analysis of the Ssp protein.
The deduced amino acid sequence of the S. saprophyticus Ssp protein predicts a polypeptide consisting of 755 amino acids (Fig. 2). The calculated molecular mass of the primary translation product is 83,495 Da. The amino acid sequence exhibits levels of homology ranging from 50% to 79% to the mature lipases of several staphylococcal species (Fig. 3). The primary amino acid sequence organization of the deduced S. saprophyticus Ssp protein is similar to that of the lipase protein family (Fig. 3).
FIG. 2.
Nucleotide sequence of the ssp gene and its promoter. The amino acid sequences obtained by sequencing the N terminus of native and proteolytically digested Ssp are underlined. The putative Shine-Dalgarno sequence (S.D.) and the −10 and −35 promoter regions are indicated. The conserved serine, aspartic acid, and histidine residues, predicted to be important in the lipase active site, are indicated by boldface type. The P-loop motif is indicated by a dashed line. The putative amino acids for the calcium ligand are double underlined. Amino acid and nucleic acid numbers are shown on the left.
FIG. 3.
Relationships between Ssp of S. saprophyticus and other lipase proteins. The signal peptide (SP), propeptide (PP), and mature lipase (ML) domains are indicated, and their lengths (in amino acid residues) are also indicated. Ssp of S. saprophyticus, GehM (37) of Staphylococcus xylosus DSM20266, GehC (5) and GehD (28) of S. epidermidis, Geh (27) of S. aureus PS54, and ShyL (16) of S. hyicus were used for the comparison. The start points of the mature Ssp, Geh, GehM, and GehD lipases were deduced from homology comparisons. The amino acids proposed to form the catalytic active site triad (serine, aspartic acid, and histidine) and the first amino acids of the P-loop motif are indicated and are numbered relative to the start of the mature lipase domain to allow direct comparison of the proteins. The Ca2+-binding sites are indicated by asterisks based on a homology comparison to S. hyicus Shyl. The percentages of identical amino acid residues in the mature lipase domain of Ssp and other lipase domains are indicated on the right.
The ATG start codon is preceded by a potential Shine-Dalgarno sequence (AGAGGTG) at position −7 and typical −10 and −35 sites (Fig. 2). The first 37 amino acids comprise a typical signal peptide that contains the conserved residues Ser, IIe, Arg, and Lys, which is known as the SIRK motif (16, 31). The propeptide, which starts with the amino acid sequence obtained from the N terminus of the native protein, is 329 amino acids long and is followed by the mature lipase protein consisting of 389 amino acids. The mature protein contains the conserved serine (Ser482 [amino acid 116 of the mature peptide]), aspartic acid (Asp673 [amino acid 307]), and histidine (His712 [amino acid 346]) residues that form the catalytic triad of the lipase active site. As in other lipases, in the vicinity of the serine residue there are two glycines (Gly-X-Ser-Met-Gly). Also, a P-loop consensus sequence (-[AG]-X4-G-K-[ST]-) and the Asp residues that may be involved in Ca2+ binding were found. The length of the propeptide and the positions of the Asp residues were deduced from homologies with Staphylococcus hyicus lipase (43).
S. saprophyticus shows lipase activity.
S. saprophyticus strain 7108, therefore, should show lipolytic activity. In order to verify this hypothesis, the bacteria were cultured on agar plates containing tributyrin or Tween 20 as a substrate. Lipolytic activity was indicated by a zone of clearing around the colonies on tributyrin agar plates and by a white precipitate on agar plates containing Tween 20 as the substrate. In addition, CCM883, which does not produce Ssp, was lipase negative, and strain 9325, which does produce Ssp, was positive. Clinical isolates (76 human strains from clinically relevant urinary tract infections and eight isolates from animal carcasses) were checked for the presence of the ssp gene by dot blot hybridization with a digoxigenin-labeled DNA probe obtained from a 1.4-kb fragment of the cloned ssp gene. Only 6 of the 84 isolates were ssp negative. All eight animal isolates were ssp positive. None of the ssp-negative isolates expressed lipase activity, whereas all of the ssp-positive isolates did express this activity.
Lipase protein undergoes proteolytic processing.
Many staphylococcal lipases are secreted as proproteins (2, 38). We therefore checked whether Ssp was processed. A crude preparation of strain 7108 that had been grown in the absence of EDTA was loaded onto an activity gel, and several lipolytic bands at 46, 55, 70, and 110 kDa were found (Fig. 4).
FIG. 4.

Processing of Ssp: lipolytic activity staining. The gels were loaded with crude preparations of staphylococcal proteins. The bacteria were grown on dialysis membranes on brain heart infusion agar without EDTA. For activity staining the sample was loaded on a nonreducing PAGE gel. The gel was then laid on top of an agar plate containing tributyrylglycerol as the substrate and incubated overnight at 37°C. Lane M contained molecular weight markers (All Blue; Bio-Rad, California). Lane A contained S. saprophyticus 7108.
ssp codes for a lipase.
To prove that lipase activity is associated with the ssp gene, we excised the whole gene containing the putative promoter from pMB1103 using the SstI and XbaI sites, ligated it into the plasmid vector pPS44, and transformed the lipase-negative strain S. carnosus TM300 with the ligation mixture. Chloramphenicol-resistant colonies were checked for lipase activity on tributyrylglycerol agar plates, and several positive clones were found. One of the transformants was selected for further study, and its plasmid was designated pMB1103. The expression of Ssp in S. carnosus TM300(pMB1103) was verified by SDS-PAGE in activity gels (Fig. 5, lanes D and E). For these experiments the strains were grown and the proteins were prepared in the presence of EDTA to avoid proteolytic processing. In addition, the expressed protein was recognized by the anti-Ssp antibody in a Western blot (data not shown).
FIG. 5.
Ssp shows lipolytic activity. The gels were loaded with crude preparations of staphylococcal proteins. (a) SDS-PAGE gel stained with Coomassie brilliant blue. (b) Lipolytic activity staining. For activity staining the samples were loaded onto a nonreducing PAGE gel. The gel was then laid on top of an agar plate containing tributyrylglycerol as the substrate and incubated overnight at 37°C. Lane M contained molecular weight markers (All Blue; Bio-Rad, California); the sizes of the markers (in kDa) are indicated on the left. Lane A, wild-type S. saprophyticus 7108; lane B, S. saprophyticus ssp knockout mutant 7108 Δssp; lane C, S. saprophyticus ssp knockout mutant 7108 Δssp containing lipase plasmid pMB1108; lane D, S. carnosus TM300; lane E, S. carnosus TM300(pMB1108).
Construction of an isogenic mutant and its complementation.
To show that lipase activity of S. saprophyticus is associated with Ssp, a Ssp knockout mutant was constructed.
The plasmid construct pMB1106 was transformed into S. saprophyticus strain 7108, cells were cured of the plasmid by cultivation at 42°C, and insertion mutants were selected with erythromycin. Insertion of ermB and loss of the cat gene were verified by Southern hybridization (Fig. 6) and PCR.
FIG. 6.

Southern hybridization of the knockout mutant and wild-type strain 7108 with ermB and cat sequences. Lane M contained molecular weight marker II (labeled with digoxigenin; Roche, Mannheim, Germany). Lanes A and D, chromosomal DNA of S. saprophyticus strain 7108 (digested with EcoRI); lanes B and E, chromosomal DNA of ssp knockout mutant digested with EcoRI; lane C, ermB cassette of pEC1 (positive control); lane F, EcoRI-digested pBT2 (positive control). Blot a was hybridized with the ermB probe, and blot b was hybridized with the cat probe.
The loss of Ssp expression in the knockout mutant was verified by SDS-PAGE and in activity gels (Fig. 5, lanes A and B). In contrast to the wild type, the knockout mutant did not express lipase activity. We constructed a plasmid that contained the gene under control of its own promoter (pMB1108) and transformed this plasmid into the mutant to prove that the ssp gene is responsible for lipase activity in S. saprophyticus (Fig. 5, lanes C).
Ssp is not responsible for binding to collagen type I.
Since binding to collagen has been described for one of the lipases of S. epidermidis 9491 (GehD) (3), we analyzed attachment of S. saprophyticus strain 7108, the lipase-negative mutant, and S. carnosus containing the lipase plasmid (pMB1108) to collagen-coated microtiter wells (Fig. 7). S. epidermidis 9491 served as the positive control. S. carnosus TM300 with or without the plasmid showed no binding to collagen, the S. saprophyticus strains did not differ in their binding to collagen, and the positive controls (S. epidermidis 9491 and S. aureus Cowan I) showed the expected binding to the matrix protein. The negative controls S. aureus RN6390 (13) and S. carnosus TM300 did not bind to collagen-coated wells. In addition, S. saprophyticus strains known to express (strain 9325) (6) or not express (CCM883) (6) Ssp were included as controls. These control strains of S. saprophyticus did not bind to immobilized collagen regardless of their capacity to produce Ssp.
FIG. 7.
Ssp is not involved in binding to collagen. Wild-type strain 7108, mutant 7108 Δssp, and the mutant containing the lipase plasmid, mutant 7108 Δssp(pMB1108), were incubated in collagen-coated microtiter wells. The controls were S. carnosus TM300, S. carnosus TM300(pMB1108), S. saprophyticus 9325 (Ssp positive) (6), S. saprophyticus CCM883 (Ssp negative) (6), S. epidermidis 9491 (GehD positive) (3), S. aureus Cowan I (Cna positive) (13), and S. aureus RN6390 (Cna negative) (13). S. saprophyticus strains did or did not bind to collagen regardless of expression of the lipase Ssp. Also, S. carnosus expressing the lipase did not bind to collagen. BSA, adherence of bacteria to bovine serum albumin-coated wells. The values represent the means and standard deviations of at least three independent experiments. OD, optical density.
Electron microscopy.
When ultrathin sections of strain S. saprophyticus 7108 (Ssp positive) and the ssp knockout mutant were examined by transmission electron microscopy, S. saprophyticus strain 7108 exhibited hairlike or tuftlike surface material (Fig. 8) that was especially prominent between adjacent cells, whereas the ssp mutant had a rather smooth surface without any fuzzy appendages. The mutant containing the lipase plasmid pMB1108 had a rough surface and appendages (Fig. 8).
FIG. 8.
Transmission electron micrographs of wild-type strain 7108 and an ssp knockout mutant. Bacteria were grown on dialysis membranes, fixed with 2.5% glutaraldehyde, and analyzed by electron microscopy. The Ssp knockout mutant (b) had a smooth surface with no indication of fuzzy surface material, while the wild-type strain S. saprophyticus 7108 (a) and the Ssp knockout mutant containing lipase plasmid pMB1108 (c) were covered with a dense layer of fibrillar surface material. Bars = 100 nm.
DISCUSSION
In previous experiments it has been shown that the urease of S. saprophyticus acts as an important virulence factor by contributing mainly to pathogenicity in the bladder (11). Hemagglutination of sheep erythrocytes (22) and adherence to uroepithelial cells (31) and to fibronectin (7) are mediated by one protein (21), the autolysin adhesin of S. saprophyticus, Aas, which has been described in detail previously. An additional protein, the S. saprophyticus surface-associated protein Ssp, is a 95-kDa protein that is produced in large quantities by most strains of S. saprophyticus and forms a fibrillar surface layer on the bacteria (6). Although it has been suggested that this protein has a function in adhesion (10), the studies have been inconclusive because of problems in dissolving the protein in aqueous solutions. To analyze the structure and function of Ssp, we therefore tried to clone and characterize its gene. Previous experiments in which workers screened a Lambda-ZAP-Express library of the hemagglutinating and fibronectin-binding strain 7108 with a polyclonal antiserum directed toward Ssp or used a digoxigenin-labeled primer derived from the N-terminal amino acid sequence of purified native Ssp were unsuccessful. In the present study we therefore derived an internal amino acid sequence by partial proteolytic digestion of purified native Ssp. With V8 protease we obtained two fragments of appropriate sizes and determined the N-terminal amino acid sequence of the 40-kDa fragment. With two degenerate primers, one derived from the N terminus of the native protein and the other derived from the internal sequence, we amplified an 800-bp fragment from the genomic DNA of S. saprophyticus 7108. This sequence did not show any homology to known proteins in a BLAST search. We then used inverse PCR to obtain the N-terminal sequence of the ssp gene. Since it was not possible to clone the C-terminal part by this strategy, we used a primer derived from the C-terminal LPXTG motif present in many surface proteins of gram-positive bacteria. This was done because it was assumed that as a surface protein, Ssp would contain this motif. Although we had to use very-low-stringency conditions, a PCR performed with this primer and a specific primer in the known sequence consistently yielded only one fragment, a 4-kb fragment. The sequence of this fragment completed the Ssp sequence at its C terminus. PCRs performed with primers from both parts of the sequence were used to verify that the N-terminal sequence and the C-terminal part were contiguous in the chromosome. The fragment amplified from the chromosome contained DNA coding for both the N-terminal and internal peptide sequences. The same primers were also used to prove the presence of the gene in other Ssp-positive clinical isolates of S. saprophyticus.
The ssp sequence comprises 2,265 bp and codes for a 755-amino-acid polypeptide with a deduced molecular mass of 83,495 Da. It contains a typical signal sequence consisting of 37 amino acids. The protein does not have other features characteristic of gram-positive surface proteins. It does not contain the LPXTG motif, suggesting that the second primer used for completion of the sequence bound nonspecifically to the chromosomal DNA. The lack of a covalent link to the peptidoglycan may explain the finding that the protein can be prepared from the cell wall by just mild shearing (6). In its C-terminal half, the ssp gene showed homology to staphylococcal lipase genes. In keeping with this homology is the presence of residues that could make up the catalytic triad of lipases (serine, aspartic acid, and histidine) (38), as well as the P-loop consensus sequence (40) that is found at position 455 (position 89 of the mature peptide [Fig. 3]). The P-loop motif, which commonly occurs in ATP- or GTP-binding proteins, is known to be present in other staphylococcal lipases (38), and in Sal1, a lipase of S. aureus NCTC 8530, the presence of ATP or GTP decreases lipase activity by about one-third, indicating that the motif is functional in this protein (38).
Since there were few data on the lipase activity of S. saprophyticus, we tested a number of Ssp-positive and Ssp-negative strains for this property. S. saprophyticus 9325 and 7108, two well-characterized clinical isolates known to produce Ssp, showed lipolytic activity on agar plates containing tributyrin or Tween 20. In contrast, the Ssp-negative type strain CCM883 did not show such activity. An activity gel showed that similar to other staphylococcal lipases, Ssp is processed after secretion. Four bands with lipolytic activity were found; the size of the smallest, the 46-kDa fragment, is in agreement with the calculated size of the proposed mature enzyme (44,251 Da).
The association of lipase activity with the DNA sequence identified was proven by transforming the whole ssp gene cloned in a Staphylococcus vector into the lipase-negative organism S. carnosus TM300 and by complementation of a lipase-negative knockout mutant.
Previous studies showed that Ssp is the major surface-associated protein of S. saprophyticus and is present in most clinical isolates (6). In electron micrographs it is observed as a fuzzy fibrillar surface layer on Ssp-positive cells. To prove that the lipase gene identified codes for this surface protein, we constructed a lipase-negative knockout mutant by inserting an ermB cassette into the ssp gene. The resultant isogenic mutant did not express the protein, as observed on SDS gels, nor did it show lipase activity on tributyryl or Tween 20 agar plates. When the wild-type and the mutant were subjected to transmission electron microscopy, the expected results, namely, a fuzzy surface layer on the wild-type cells and a smooth surface in the mutant, were seen. A plasmid coding for the lipase complemented the mutant. From these results we concluded that the major surface protein of S. saprophyticus, Ssp, is a lipase produced in abundant quantities. It has been shown that in other staphylococci lipases may be surface associated (3). GehD of S. epidermidis is a surface-associated protein that binds to collagen and acts as an adhesin in this organism (3). In our experiments using immobilized collagen type I, no increased binding of S. saprophyticus strains expressing the lipase was found. The binding of the mutant and the complemented mutant did not differ from that of the parent, and S. carnosus TM300 containing the lipase plasmid did not show binding to the matrix protein. Although in previous experiments purified Ssp did not bind fibronectin, fibrinogen, laminin, or vitronectin (7, 9), the Ssp-negative strain CCM883 adheres avidly to Hep2 cells or to human uroepithelial cells, whereas the Ssp-positive strain 9325 does not show such adherence (12). These findings suggest that Ssp does not function as an adhesin in S. saprophyticus. Lipases may contribute to persistence of the microorganism by providing a source of energy or by facilitating adherence (18). It has also been suggested that lipase lowers the concentration of lipids that inhibit another staphylococcal enzyme, the fatty acid-modifying enzyme (25). In a recent publication the authors raised the possibility that the surface-bound lipase of Streptococcus mutans, GbpD, modifies the surface of the same or competing organisms (42). All these mechanisms may play a role in S. saprophyticus. The function of this enzyme in the bladder, however, is elusive. We are not aware of any urinary pathogen for which a role of a lipase has been suggested. Expression of S. saprophyticus lipase is regulated by environmental conditions (12, 30), and bacteria grown under conditions that suppress production of the protein still induce generation of antibodies toward the lipase when they are used in experimental infections (12). This observation suggests that the enzyme is expressed in vivo and has a function in growth or pathogenesis. Interestingly, the urease, which clearly functions as a virulence factor (8), causes alkalinization of the urine, which, in analogy to other lipases, may enhance the activity of the lipase.
In conclusion, we identified, cloned, and sequenced the lipase of S. saprophyticus and proved that this enzyme is the previously identified surface-associated protein of this organism. Future work should assess the role of the enzyme in uropathogenesis.
Acknowledgments
Parts of this work were supported by the Deutsche Forschungsgemeinschaft (grants DFG Ga 352/5-1 and Ga 352/5-2) and by the Ruhr-Universität-Bochum (FoRUM F2 11/00)
The excellent technical assistance of S. Ortmann and S. Friedrich is gratefully acknowledged. We are also indebted to B. Kleine for conducting the adhesion experiments, and we thank Bernhard Krismer for helpful discussions.
Editor: V. J. DiRita
REFERENCES
- 1.Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410. [DOI] [PubMed] [Google Scholar]
- 2.Ayora, S., P. E. Lingren, and F. Götz. 1994. Biochemical properties of a novel metalloprotease from Staphylococcus hyicus subsp. hyicus involved in extracellular lipase processing. J. Bacteriol. 176:3218-3223. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Bowden, M. G., L. Visai, C. M. Longshaw, K. T. Holland, P. Speziale, and M. Höök. 2002. Is the GehD lipase from Staphylococcus epidermidis a collagen binding adhesin. J. Biol. Chem. 277:43017-43023. [DOI] [PubMed] [Google Scholar]
- 4.Brückner, R. 1997. Gene replacement in Staphylococcus carnosus and Staphylococcus xylosus. FEMS Microbiol. Lett. 151:1-8. [DOI] [PubMed] [Google Scholar]
- 5.Farrell, A. M., T. J. Foster, and K. T. Holland. 1993. Molecular analysis and expression of the lipase of Staphylococcus epidermidis. J. Gen. Microbiol. 139:267-277. [DOI] [PubMed] [Google Scholar]
- 6.Gatermann, S., B. Kreft, R. Marre, and G. Wanner. 1992. Identification and characterization of a surface-associated protein (Ssp) of Staphylococcus saprophyticus. Infect. Immun. 60:1055-1060. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Gatermann, S., and H. G. Meyer. 1994. Staphylococcus saprophyticus hemagglutinin binds fibronectin. Infect. Immun. 62:4556-4563. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Gatermann, S., and R. Marre. 1989. Cloning and expression of Staphylococcus saprophyticus urease gene sequences in Staphylococcus carnosus and contribution of the enzyme to virulence. Infect. Immun. 57:2998-3002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Gatermann, S., H. G. Meyer, and G. Wanner. 1992. Staphylococcus saprophyticus hemagglutinin is a 160-kilodalton surface polypeptide. Infect. Immun. 60:4127-4132. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Gatermann, S., H. G. Meyer, R. Marre, and G. Wanner. 1993. Identification and characterization of surface proteins from Staphylococcus saprophyticus. Zentbl. Bakteriol. 278:258-274. [DOI] [PubMed] [Google Scholar]
- 11.Gatermann, S., J. John, and R. Marre. 1989. Staphylococcus saprophyticus urease: characterization and contribution to uropathogenicity in unobstructed urinary tract infection of rats. Infect. Immun. 57:110-116. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Gatermann, S., R. Marre, J. Hessemann, and W. Henkel. 1988. Hemagglutinating and adherence properties of Staphylococcus saprophyticus: epidemiology and virulence in experimental urinary tract infection of rats. FEMS Microbiol. Immunol. 47:179-186. [DOI] [PubMed] [Google Scholar]
- 13.Gillaspy, A. F., C. Y. Lee, S. Sau, A. L. Cheung, and M. S. Smeltzer. 1998. Factors affecting the collagen binding capacity of Staphylococcus aureus. Infect. Immun. 66:3170-3178. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Götz, F., and B. Schumacher. 1987. Improvements of protoplast transformation in Staphylococcus carnosus. FEMS Microbiol. Lett. 40:285-288. [Google Scholar]
- 15.Götz, F. 1990. Staphylococcus carnosus. A new host for gene cloning and protein production. J. Appl. Bacteriol. Symp. Suppl. 69:49-53. [DOI] [PubMed] [Google Scholar]
- 16.Götz, F., F. Popp, E. Korn, and K. H. Schleifer. 1985. Complete nucleotide sequence of the lipase gene from Staphylococcus hyicus cloned in Staphylococcus carnosus. Nucleic Acids Res. 13:5895-5906. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Götz, F., H. M. Verheij, and R. Rosenstein. 1998. Staphylococcal lipases: molecular characterisation, secretion, and processing. Chem. Phys. Lipids 93:15-25. [DOI] [PubMed] [Google Scholar]
- 18.Gribbon, E. M., W. J. Cunliffe, and K. T. Holland. 1993. Interaction of Propionibacterium acnes with skin lipids in vitro. J. Gen. Microbiol. 139:1745-1751. [DOI] [PubMed] [Google Scholar]
- 19.Hedström, S. Ä. 1975. Lipolytic activity of Staphylococcus aureus strains from cases of human chronic osteomyelitis and other infections. Acta Pathol. Microbiol. Scand. Sect. B 83:283-292. [DOI] [PubMed] [Google Scholar]
- 20.Hedström, S. Ä., and P. Nilsson-Ehle. 1983. Triacylglycerol lipolysis by Staphylococcus aureus strains from furunculosis, pyomyosititis, impetigo and osteomyelitis. Acta Pathol. Microbiol. Scand. Sect. B 91:69-173. [DOI] [PubMed] [Google Scholar]
- 21.Hell, W., H. G. Meyer, and S. G. Gatermann. 1998. Cloning of aas, a gene encoding a Staphylococcus saprophyticus surface protein with adhesive and autolytic properties. Mol. Microbiol. 29:871-881. [DOI] [PubMed] [Google Scholar]
- 22.Hovelius, B., and P. A. Mardh. 1979. Haemagglutination by Staphylococcus saprophyticus and other staphylococcal species. Acta Pathol. Microbiol. Scand. Sect. B 87:45-50. [DOI] [PubMed] [Google Scholar]
- 23.Ingham, E., K. T. Holland, G. Gowland., and W. J. Cunliffe. 1981. Partial purification and characterization of lipase (EC 3.1.1.3) from Propionibacterium acnes. J. Gen. Microbiol. 124:393-401. [DOI] [PubMed] [Google Scholar]
- 24.Jürgens, D., H. Huser, and F. J. Fehrenbach. 1981. Purification and characterisation of Staphylococcus aureus lipase. FEMS Microbiol. Lett. 12:195-199. [Google Scholar]
- 25.Kapral, F. A. S. Smith, and D. Lal. 1992. The esterification of fatty acids by Staphylococcus aureus fatty acid modifying enzyme (FAME) and its inhibition by glycerides. J. Med. Microbiol. 37:235-237. [DOI] [PubMed] [Google Scholar]
- 26.Kimura, H., T. Kitamura, and M. Tsuji. 1972. Studies on human pancreatic lipase. I. Interconversion between low and high molecular weight forms of human pancreatic lipase. Biochim. Biophys. Acta 270:307-316. [PubMed] [Google Scholar]
- 27.Lee, C. Y., and J. J. Iandolo. 1985. Lysogenic conversion of staphylococcal lipase is caused by insertion of the bacteriophage L54a genome into the lipase structural gene. J. Bacteriol. 166:385-391. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Longshaw, C. M., A. M. Farrell, J. D. Wright, and K. T. Holland. 2000. Identification of a second lipase gene, gehD, in Staphylococcus epidermidis: comparison of sequence with those of other staphylococcal lipases. Microbiology 146:1419-1427. [DOI] [PubMed] [Google Scholar]
- 29.Lowe, A. M., D. T. Beattie, and R. L. Deresiewicz. 1998. Identification of novel staphylococcal virulence genes by in vivo expression technology. Mol. Microbiol. 27:967-976. [DOI] [PubMed] [Google Scholar]
- 30.Meyer, H.-G. W., and S. G. Gatermann. 1994. Surface properties of Staphylococcus saprophyticus: hydrophobicity, haemagglitination and Staphylococcus saprophyticus surface-associated protein (Ssp) represent distinct entities. APMIS 102:538-544. [PubMed] [Google Scholar]
- 31.Meyer, H.-G. W., U. Wengler-Becker, and S. G. Gatermann. 1996. The hemagglutinin of S. saprophyticus is a major adhesin for uroepithelial cells. Infect. Immun. 64:3893-3896. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Morgenroth, K., and U. Hoerstebrock. 1978. Transmission and scanning electron microscopic investigation of the structure of so-called Clara cells of the bronchial. Arzneimittelforschung 28:911-917. [PubMed] [Google Scholar]
- 33.Nikoleit, K., R. Rosenstein, H. M. Verheij, and F. Götz. 1995. Comparative biochemical and molecular analysis of the Staphylococcus hyicus, Staphylococcus aureus and a hybrid lipase: indication for a C-terminal phospholipase domain. Eur. J. Biochem. 228:732-738. [PubMed] [Google Scholar]
- 34.Novick, R., P. H. F. Ross, S. J. Projan, J. Kornblum, B. Kreiswirth, and S. Moghazeh. 1993. Synthesis of staphylococcal virulence factors is controlled by a regulatory RNA molecule. EMBO J. 12:3967-3975. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Paulsson, M., A. Ljungh, and T. Wadström. 1992. Rapid identification of fibronectin, vitronectin, laminin, and collagen cell surface binding-proteins on coagulase-negative staphylococci by particle agglutination assays. J. Clin. Microbiol. 30:2006-2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Rollof, J., S. Ä. Hedström, and P. Nilsson-Ehle. 1987. Lipolytic activity of Staphylococcus aureus strains from disseminated and localized infections. Acta Pathol. Microbiol. Immunol. Scand. Sect. B 95:109-113. [DOI] [PubMed] [Google Scholar]
- 37.Rosenstein, R., and F. Götz. 1999. GenBank accession no. AF208229.
- 38.Rosenstein, R., and F. Götz. 2000. Staphylococcal lipases: biochemical and molecular characterization. Biochimie 82:1005-1014. [DOI] [PubMed] [Google Scholar]
- 39.Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
- 40.Saraste, M., P. R., Sibbald, and A. Wittinghofer. 1990. The P-loop—a common motif in ATP- and GTP-binding proteins. Trends Biochem. Sci. 15:430-434. [DOI] [PubMed] [Google Scholar]
- 41.Schleifer, K. H., and U. Fischer. 1982. Description of a new species of the genus Staphylococcus: Staphylococcus carnosus. Int. J. Syst. Bacteriol. 32:153-156. [Google Scholar]
- 42.Shah, D. S. H., and R. R. B. Russell. 2004. A novel glucan-binding protein with lipase activity from the oral pathogen Streptococcus mutants. Microbiology 150:1947-1956. [DOI] [PubMed] [Google Scholar]
- 43.Simons, J. W. F. A., M. D. van Kampen, I. Ubarretxena-Belandia, R. C. Cox, C. M. Alves dos Santos, M. R. Egmond, and H. M. Verheij. 1999. Identification of a calcium binding site in Staphylococcus hyicus lipase: generation of calcium-independent variants. Biochemistry 38:2-10. [DOI] [PubMed] [Google Scholar]
- 44.Simons, J. W. F. A., M. D. van Kampen, S. Riel, F. Götz, M. R. Egmond, and H. M. Verheij. 1998. Cloning, purification and characterisation of the lipase from Staphylococcus epidermidis. Comparison of the substrate selectivity with those of other microbial lipases. Eur.J. Biochem. 253:675-683. [DOI] [PubMed] [Google Scholar]
- 45.Tyski, S., W. Hryniewicz, and J. Jeljaszewicz. 1983. Purification and some properties of the staphylococcal extracellular lipase. Biochim. Biophys. Acta 749:312-317. [DOI] [PubMed] [Google Scholar]
- 46.Vadehra, D. V. 1974. Staphylococcal lipases. Lipids. 9:158-165. [DOI] [PubMed] [Google Scholar]
- 47.Wieland, B. 1993. Der Xyl-Promotor aus Staphylococcus xylosus als Grundlage der transtriptionale Regulation von Genen in Staphylococcus carnosus. Ph.D. thesis. Universität Tübingen, Tübingen, Germany.





