Abstract
The nickel-containing enzyme urease is an essential colonization factor of the human gastric pathogen Helicobacter pylori which enables the bacteria to survive the low-pH conditions of the stomach. Transcription of the urease genes is positively controlled in response to increasing concentrations of nickel ions and acidic pH. Here we demonstrate that acid-induced transcription of the urease genes is mediated directly by the ArsRS two-component system. Footprint analyses identify binding sites of the phosphorylated ArsR response regulator within the ureA and ureI promoters. Furthermore, deletion of a distal upstream ArsR binding site of the ureA promoter demonstrates its role in acid-dependent activation of the promoter. In addition, acid-induced transcription of the ureA gene is unaltered in a nikR mutant, providing evidence that pH-responsive regulation and nickel-responsive regulation of the ureA promoter are mediated by independent mechanisms involving the ArsR response regulator and the NikR protein.
Helicobacter pylori is the causative agent of chronic type B gastritis and gastric or duodenal ulcers (8, 26). Moreover, infection with H. pylori increases the risk of developing gastric malignancies such as adenocarcinoma or mucosa-associated lymphoid tissue lymphoma (34). The ability of the neutralophilic bacterium H. pylori to thrive in the low-pH conditions encountered in the human stomach relies on the nickel-containing enzyme urease. Urease, a hexameric heterodimer consisting of the subunits UreA and UreB, hydrolyzes urea, leading to the formation of ammonia and carbon dioxide which buffer the cytoplasm and periplasm of the bacteria (28, 30). The enzymatic activity of urease is controlled by the inner membrane pH-gated channel UreI, which regulates the access of the substrate urea to the bacterial cell in response to acidic pH (29, 41). Both urease and the channel protein UreI proved to be essential for colonization in several animal infection models (16, 18, 24, 31). However, additional mechanisms of pH homeostasis contribute to acid adaptation in H. pylori (5, 6).
The urease genes encoding the subunits UreA and UreB, the urea channel UreI, and accessory proteins required for the assembly of nickel into the urease apoenzyme are organized in two transcriptional units comprising ureAB and ureIEFGH, respectively (1) (Fig. 1). Under standard laboratory growth conditions, basal transcription of the ureAB genes is driven by a core promoter consisting of an extended −10 promoter element and a predicted −35 motif of the sequence TTAATC (11). However, transcription of the ureAB genes is increased in the presence of Ni2+ ions (35), and it was demonstrated that nickel-responsive regulation is mediated by the NikR protein (10, 36), which is a global autoregulator controlling the expression of nickel-activated and -repressed genes, including genes involved in nickel and ferric iron uptake and storage, metal metabolism, motility, and stress responses as well as genes encoding outer membrane proteins (10). Interestingly, NikR represses transcription of the fur gene, encoding the iron-responsive repressor protein Fur, which is involved in acid resistance (7, 10, 38). Recently, the binding sites of NikR in the promoters of the fur and ureA genes have been mapped (13). Global transcriptome analysis revealed that transcription of ureAB, ureIEFGH, and several genes encoding components of alternative pathways for the production of ammonia is induced by acidic pH (9, 23, 42). Since low pH is thought to increase the solubility and therefore the intracellular availability of Ni2+ ions, it was speculated that NikR might act as a master regulator of acid adaptation by directly mediating acid-induced transcription of ureAB and by controlling the transcription of other pH-regulated genes via a regulatory cascade involving the Fur repressor (39). However, it was clearly demonstrated that acid induction of transcription of ureA requires the HP166-HP165 two-component system (27), which is composed of the essential OmpR-like response regulator HP166 and the nonessential histidine kinase HP165. Since HP166-HP165 was shown to control the transcription of several H. pylori-specific genes in response to acidic pH (4, 15, 19, 27), the two-component system has recently been renamed ArsRS (acid responsive signaling) (27).
In this study we demonstrate that the ArsRS two-component system directly controls acid-induced transcription from the ureA (PureA) and ureI (PureI) promoters. Through footprint analyses with the phosphorylated ArsR response regulator (ArsR∼P), we identify binding sites of ArsR∼P at the PureA and PureI promoters. Furthermore, we provide evidence that pH-responsive regulation and nickel-responsive regulation of the PureA promoter are mediated by independent mechanisms involving the ArsR response regulator and the NikR protein.
MATERIALS AND METHODS
Bacterial strains and growth conditions.
H. pylori G27 and 26695 are clinical isolates (33, 43). H. pylori strain G27/HP165::km has been described previously (4). H. pylori strains were grown at 37°C under microaerophilic conditions (Oxoid) on Columbia agar plates containing 5% horse blood, 0.2% cyclodextrin, and Dent's or Skirrow's antibiotic supplement. Liquid cultures were grown in brain heart infusion or brucella broth containing Dent's or Skirrow's antibiotic supplement and 10% fetal calf serum (FCS). When required, blood agar plates or liquid broth was supplemented with chloramphenicol or kanamycin at a final concentration of 20 μg/ml. Acid exposure experiments were performed as follows. Bacteria from a liquid culture were harvested at an optical density at 590 nm of 0.8 by centrifugation and were resuspended in brain heart infusion broth containing FCS and antibiotic supplement with the pH adjusted to 5.0 with hydrochloric acid. Incubation at 37°C under microaerophilic conditions was continued for 1 hour. To study the Ni2+-responsive induction of ureA transcription, H. pylori was grown in brucella broth containing Dent's or Skirrow's antibiotic supplement, 10% FCS, and 100 μM NiCl2 to an optical density at 590 nm of 0.8. Escherichia coli DH5α was grown in Luria-Bertani broth. When necessary, antibiotics were added to the following final concentrations: ampicillin, 100 μg/ml; kanamycin, 50 μg/ml; and chloramphenicol, 30 μg/ml.
Construction of H. pylori strains with deletions within the PureA promoter.
Two constructs were generated, pSLΔPureA and pSLparΔPureA, to replace regions within the PureA promoter ranging from position +7 to −176 or −88 to −176, respectively, with a chloramphenicol resistance cassette. Numbering is with respect to the transcriptional start site of the ureA gene (32). To construct suicide plasmid pSLΔPureA, a 520-bp EcoRI-BamHI fragment, comprising 407 bp of the 3′ region of open reading frame (ORF) HP0074 and 124 bp of the intergenic region between HP0074 and ureA, and a 483-bp PstI-SacI fragment, comprising 50 bp of the upstream region of ureA and 433 bp of the 5′ region of ureA, were PCR amplified from chromosomal DNA of H. pylori 26695 with primer pairs hp74-5/hp74-3 and ureA-5/ureA-3 (Table 1), respectively, and were subsequently cloned into pSL1180 vector DNA (Amersham-Pharmacia). The resulting plasmid was linearized by digestion with BamHI and PstI, and a chloramphenicol resistance cassette from Campylobacter coli (40) was inserted in a way that the transcriptional direction of the cat gene is divergent from ureA, yielding plasmid pSLΔPureA. pSLparΔPureA is a derivative of pSLΔPureA in which the 483-bp PstI-SacI fragment was replaced by a 577-bp PstI-SacI fragment comprising 144 bp of the upstream region of ureA and 433 bp of the 5′ region of ureA, which was amplified with primer pair ureA-5p/ureA-3. Natural transformation of the H. pylori strains G27 and G27/HP165::km with the suicide plasmid pSLΔPureA and transformation of G27 with pSLparΔPureA were performed as described previously (3). Chromosomal DNA of the resulting chloramphenicol-resistant transformants was checked for the correct allelic replacement event by PCR with primers flanking the integration site. This resulted in the generation of strains G27/ΔPureA, G27/ΔarsSΔPureA, and G27/parΔPureA, respectively.
TABLE 1.
Name | Sequence (5′ to 3′)a | Siteb | Strand | Positionc |
---|---|---|---|---|
ureAPE | CATAGTGGAGCATCAAC | + | 77911-77927 | |
ureIPE | ACATATAACAATACAAGTCC | + | 75309-75328 | |
Aprom-5 | gcataggaattcTAGAGCACTACCTTGACATGG | EcoRI | − | 78262-78242 |
Aprom-3 | cattttggatccATCAACTTGTCTAACTCTTTTGG | BamHI | + | 77922-77944 |
ureAHyp-5 | CAUCAUCAUGATGAAACTCACCCCAAAAGA | − | 77957-77937 | |
ureAHyp-3 | CUACUACUATTACTCCTTAATTGTTTTTAC | + | 77240-77260 | |
Iprom-5 | agaagaggatccGCTTGAAAGACAAGTGTTGCC | BamHI | − | 75713-75693 |
Iprom-3 | aaaacagaattcACATATAACAATACAAGTCC | EcoRI | + | 75309-75328 |
ureI-5 | ctcttaggatccGAAGTAACTTCTAAACCAGCC | BamHI | − | 75586-75566 |
ureI-3 | ttttacgaattcATAGAAACTAGTCAAATGGTGGCG | EcoRI | + | 75107-75129 |
hp74-5 | ttaatggagctcGGATCAAGCGATTAAATACGC | SacI | − | 78710-78690 |
hp74-3 | taattgctgcagAAAATTGGAGTGATAATGGTGG | PstI | + | 78190-78211 |
ureA-5 | tacatcggatccTGATTTCGTTATGTCTTCAAGG | BamHI | − | 78006-77985 |
ureA-5p | tagcgcggatccGATATAACACTAATTCATTTTAAATA | BamHI | − | 78100-78075 |
ureA-3 | ttcaaggaattcAAGTGTGAGCCGATTTGAACC | EcoRI | + | 77523-77543 |
NKTB-F | attcagggatccCGGTTGTCTAATTCGTC | BamHI | + | 1398691-1398707 |
NKTB-R | cggatgaattcCTCCTTGTCTATGATAAAAC | EcoRI | − | 1399093-1399074 |
Nko-F | attcagggatccGACTAAGGCGTCTAGCTTTG | BamHI | − | 1398360-1398341 |
Nko-R | attcagccatggACTAGCCCTAATCGCGCTAG | NcoI | + | 1397831-1397850 |
16SHyp-5 | GCTAAGAGATCAGCCTATGTCC | − | 1208876-1208855 | |
16SHyp-3 | TGGCAATCAGCGTCAGGTAATG | + | 1208356-1208377 |
Sequences in uppercase letters are derived from the genome sequences of H. pylori 26695 (33). Sequences introduced for cloning purposes are given in lowercase letters, and restriction recognition sequences are underlined.
Restriction recognition site.
Nucleotide positions refer to the genome sequence of H. pylori 26695 (33).
RNA isolation, primer extension, and RNA slot blot analysis.
H. pylori RNA was isolated from bacteria grown to the logarithmic phase in liquid broth by using TRIzol reagent (Invitrogen) according to the manufacturer's protocol. Primer extension analysis was performed essentially as described previously (27), using 0.5 pmol of γ-32P-end-labeled oligonucleotides ureAPE and ureIPE. Plasmid pSL-ureI, which was used as template DNA in the sequencing reactions performed with primer ureIPE, contains a 480-bp BamHI-EcoRI fragment comprising the promoter region and part of the 5′ region of the ureI gene, which was PCR amplified with primers ureI-5/ureI-3. Primer extension experiments were performed three times with independently prepared RNAs. Quantification of the signals from the primer extension products was performed using a Typhoon 9200 variable-mode imager (Amersham Biosciences) and ImageMaster TotalLab software (Amersham Biosciences). RNA slot blot analysis was performed as follows. RNA (20 μg) was denatured in 1× MOPS (morpholinepropanesulfonic acid) buffer containing 50% formamide and 6% formaldehyde. The samples were incubated at 65°C for 5 min and cooled on ice before addition of 1 volume of 20× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate). The denatured samples were filtered through a positively charged nylon membrane (Hybond N+; Amersham), using a Bio-Dot chamber (Bio-Rad). After UV cross-linking, the nylon membrane was prehybridized for 1 h at 42°C in hybridization buffer (ECL gold hybridization buffer; Amersham). The PCR products used as hybridization probes were nonradioactively labeled using the ECL direct nucleic acid labeling system (Amersham) according to the manufacturer's instructions. The labeled probes were added to the hybridization solution, and hybridization was performed for 12 to 16 h at 42°. The membrane was washed two times in prewarmed (42°C) wash solution I (6 M urea, 0.5× SSC, 0.4% sodium dodecyl sulfate) for 20 min at 42°C and two times in wash solution II (250 ml 2× SSC) at room temperature. For signal detection, the ECL detection system (ECL direct nucleic acid labeling and detection system; Amersham) and X-ray films (Konica Minolta) were used.
DNase I footprint analysis.
The recombinant N-terminally His6-tagged response regulator ArsR encoded on plasmid pQE-166 was overexpressed in E. coli M15 and was purified by affinity chromatography on Ni2+-nitrilotriacetic acid agarose essentially as described previously (4). In vitro phosphorylation of His6-ArsR was performed as described by Dietz et al. (15). Plasmids pSL-ureAProm and pSL-ureIProm, used for the generation of end-labeled DNA probes for DNase I footprint experiments, were constructed by cloning a 339-bp EcoRI-BamHI fragment derived from the upstream region of ureA and a 414-bp BamHI-EcoRI fragment derived from the upstream region of ureI, respectively, into pSL1180. The cloned DNA fragments were PCR amplified from chromosomal DNA of H. pylori 26695 with primer pairs Aprom-5/Aprom-3 and Iprom-5/Iprom-3, respectively. The promoter DNA fragments were 5′ end labeled with [γ-32P]ATP and T4 polynucleotide kinase at one extremity and gel purified, and approximately 100,000 cpm of each probe was used for footprint experiments, which were performed essentially as described by Delany et al. (12). The binding reactions were performed for 20 min at room temperature in 50 μl binding buffer (50 mM Tris-HCl, pH 7.9, 40 mM KCl, 10 mM NaCl, 2 mM MgCl2, 0.1 mM CaCl2, 1 mM dithiothreitol).
Construction of H. pylori G27/nikR::km.
G27/nikR::km was constructed through allelic replacement by transformation of the G27 wild-type strain with plasmid pNko::Km, which was generated as follows. An upstream flanking region consisting of a 406-bp BamHI-EcoRI fragment amplified from chromosomal DNA of H. pylori G27 with primers NKTB-F/NKTB-R, including the nikR-exbB intergenic region and 87 bp and 58 bp of the 5′ regions of the respective genes, was cloned into pGemT (Promega), generating the pNKTB plasmid. A downstream flanking region was then amplified from G27 chromosomal DNA with primers Nko-F/Nko-R, generating a 529-bp NcoI-BamHI fragment, including 30 bp of the 3′ end of the nikR gene, and cloned into the pNKTB plasmid. A kanamycin cassette of C. coli (21) was then cloned between the flanking regions, generating the pNko:Km suicide plasmid. Chromosomal DNA of the transformants was checked by PCR with primers external and internal to the replacement site to verify the desired double-crossover event. A transformant with the correct double-crossover PCR profile was analyzed by Western blotting with a polyclonal mouse antiserum raised against the purified recombinant NikR protein (13), which confirmed the lack of expression of the NikR protein.
RESULTS
Acid-induced transcription from the PureI promoter requires the ArsRS two-component system.
We have reported recently that the increase of ureAB transcription observed at acidic pH is largely dependent on the presence of the histidine kinase ArsS (27). To test whether acid-induced transcription of ureI and its downstream genes, which was observed in the global transcriptome studies performed by Merrell et al. (23) and Wen et al. (42), is also controlled by the ArsRS two-component system, we investigated the expression of ureI in the H. pylori G27 wild-type strain and the isogenic arsS deletion mutant G27/HP165::km which had been exposed to pH 5.0 for 1 hour. As shown in Fig. 2A, two major elongated primer products could be detected when a primer extension experiment with a ureI-specific primer was performed on RNA which was extracted from H. pylori G27. The shorter product (band 1) is derived from a transcript starting at position −65 with respect to the translational start codon of ureI. The nucleotide sequence upstream revealed a −10 promoter element (TATGAT). This is in agreement with the PureI promoter proposed by Akada et al. (1). The longer product (band 2) corresponds to a ureI-specific transcript starting at position −119 with respect to the start codon of ureI. This putative transcriptional start site is not preceded by a reasonable −10 promoter element. Both ureI-specific transcripts were synthesized to a greater extent when H. pylori G27 was cultivated at low pH, indicating acid induction, which was estimated as approximately 2.5-fold for the shorter transcript. However, acid exposure did not increase the synthesis of these transcripts in G27/HP165::km, indicating a role of the ArsRS two-component system in the pH regulation of ureIEFGH, as was observed for ureAB.
To investigate whether band 2 corresponds to a transcript whose synthesis is driven by an alternative promoter of ureIEFGH or represents a specific cleavage product of a readthrough transcript directed from the PureA promoter, the H. pylori strains G27/ΔPureA and G27/ΔarsSΔPureA were constructed. In these strains, which are derived from the G27 wild-type strain and the isogenic arsS deletion mutant G27/HP165::km, respectively, the intergenic region between ureA and the upstream ORF HP0074 comprising the PureA promoter was largely replaced by a chloramphenicol resistance cassette which is transcribed in the opposite direction to ureA. Integration of the chloramphenicol cassette resulted in the deletion of the region ranging from position +7 to −176 with respect to the transcriptional start site of ureA (32). When primer extension experiments with a ureI-specific oligonucleotide were performed on RNAs extracted from G27/ΔPureA and G27/ΔarsSΔPureA, product 2 could no longer be detected, indicating that the corresponding mRNA is dependent on PureA and may represent a processing product of the full-length ureABIEFGH readthrough transcript (Fig. 2B). In strain G27/ΔPureA, acid-induced transcription from PureI was estimated to be increased about fivefold compared to that in the G27 wild-type strain grown at pH 5.0, while pH-dependent transcription of ureI was not observed in strain G27/ΔarsSΔPureA, demonstrating again that the histidine kinase ArsS is required for the pH regulation of PureI. In conclusion, the ArsRS two-component system controls acid-induced transcription from the PureI promoter as well as from the PureA promoter (27).
ArsR binds to the PureA and PureI promoters.
To investigate whether the ArsRS two-component system participates directly or indirectly in the pH-dependent regulation of the urease genes, DNase I footprint experiments with the purified response regulator protein ArsR were performed. Figure 3 shows the results of footprint experiments carried out with a 339-bp radioactively labeled PureA promoter probe. In the presence of 1.5 μM ArsR which was phosphorylated in vitro with acetylphosphate (ArsR∼P), a region of 54 bp spanning from position −21 to −74 with respect to the transcriptional start site of ureA was protected from DNase I digestion. At higher concentrations of ArsR∼P (4.5 μM), a second protected region appeared, spanning from position −105 to −139, and bands with enhanced DNase I sensitivity centered around position −91 became visible. When the same experiments were performed with unphosphorylated ArsR, no binding of the response regulator to the PureA promoter probe could be detected (data not shown). Therefore, ArsR binds to the PureA promoter at two distinct sites exclusively in its phosphorylated state.
Footprint analysis with ArsR∼P on a 414-bp DNA probe containing the PureI promoter was also performed, and the results are shown in Fig. 4. When 3.0 μM in vitro-phosphorylated ArsR∼P was added to the probe, a region spanning from position −3 to −50 with respect to the transcriptional start site of ureI was protected from DNase I digestion. At higher protein concentrations (>6.0 μM), the protected region extended up to position +9. Again no protection was observed when unphosphorylated ArsR was included in the reaction mixture (data not shown). Therefore, ArsR∼P binds directly to the PureI promoter, which was clearly shown to be positively regulated by ArsS in a pH-dependent manner (Fig. 2).
From the results of the footprint experiments, we conclude that pH regulation of the urease genes is mediated by the ArsRS two-component system through direct binding of ArsR∼P to the PureA and PureI promoter regions.
Deletion of the upstream binding site of ArsR in the PureA promoter abrogates pH regulation of ureA transcription.
In the promoters of pH-responsive target genes of ArsR which have been characterized so far, the binding site of ArsR consists of a 26-bp sequence motif located at a distance of 9 bp upstream of the −10 promoter element (15). In the footprint experiments shown in Fig. 3, we have identified two ArsR binding sites within the PureA promoter overlapping and upstream of the core promoter element, respectively. To confirm the role of the distal upstream binding site of ArsR∼P in acid regulation of PureA, we generated a mutant strain (G27/parΔPureA) harboring a deletion in the PureA promoter ranging from position −89 to −176 and analyzed transcription of ureA in this strain, which retains the downstream ArsR binding site as well as the recently mapped NikR operator of PureA (13) (Fig. 3B). As shown in Fig. 5, no increase in transcription of ureA was observed when the mutant G27/parΔPureA was exposed to pH 5. This demonstrates that removal of the upstream distal ArsR binding site abrogates acid induction of PureA, verifying the role of the in vitro-identified ArsR binding sites. Furthermore, as the NikR operator is retained in this promoter mutant, regulation of transcription in response to acidity appears to be dependent only on the ArsRS two-component system.
Acid-induced transcription of ureA is independent of the metal-responsive regulator NikR.
To investigate the possible role of NikR in acid response regulation of PureA, hypothesized by van Vliet and coworkers (39), we constructed a nikR deletion mutant of H. pylori G27 and analyzed the pH- and metal-dependent regulation of the urease genes. The growth of the parent strain G27 in liquid culture was unaffected by the presence of Ni2+ at concentrations ranging from 100 to 500 μM. In contrast, strain G27/nikR::km showed reduced growth in the presence of 100 μM Ni2+, and no growth was observed when the broth was supplemented with Ni2+ at concentrations of 250 μM or higher. As expected, in strain G27/nikR::km expression of urease was no longer induced in response to supplementation of the culture broth with 100 μM Ni2+ (Fig. 6A), as had been observed with similar mutants of H. pylori 26695 and SS1 (10, 36). Importantly, an increase of transcription was observed in G27/nikR::km exposed to pH 5.0 (Fig. 6B, lane 4 versus lane 2), which was comparable to the increase observed in the wild-type strain (lane 3 versus lane 1). This demonstrates that acid-induced transcription of PureA is independent of NikR. To delineate the role of ArsRS in nickel-dependent regulation of ureA, we investigated transcription of ureA in the G27 wild-type strain and G27/HP165::km when the strains were cultivated in the presence of 100 μM Ni2+. As shown in Fig. 6C, Ni2+ induction could be detected in the arsS deletion mutant. From these results, we conclude that pH- and Ni2+-dependent transcription of ureA represent different and independent regulatory mechanisms mediated by the ArsRS two-component system and the NikR protein, respectively.
DISCUSSION
Due to the rather high basal level of urease expression at pH 7.0, resulting in urease concentrations approaching 10% of the total cellular protein content (2), it was initially assumed that transcription of the urease genes is constitutive. However, it is well established now that transcription of ureABIEFGH is positively regulated in response to acidic pH (9, 23, 27, 42) and that transcription of ureAB is induced in the presence of elevated concentrations of Ni2+ ions (35). As recently reported for the pH-dependent regulation of ureAB (27), we show here that acid-induced transcription of ureIEFGH is mediated by the ArsRS two-component system. The ureIEFGH operon is transcribed by the PureI promoter located in the short intergenic region between ureB and ureI (1) (Fig. 2). However, we reproducibly detected significant amounts of an additional ureI-specific transcript whose synthesis is directed by the PureA promoter (Fig, 2). Therefore, two promoters, PureA and PureI, control the expression of the ureIEFGH genes at the transcriptional level, and both are controlled by ArsRS in response to acidic pH. The presence of a ureABIEFGH readthrough transcript which is mostly endonucleolytically cleaved to give rise to a ureABI mRNA of 3.4 kbp was already observed by Akada et al. (1). Those authors also detected three short ureI-specific mRNAs ranging in size from 0.8 to 1.1 kbp which were expected to be derived from a ureIEFGH transcript by endonucleolytic cleavage within the region encoding UreE. Since the 5′ end of the ureI-specific mRNA detected in our primer extension experiments is located only 54 bp upstream of the transcriptional initiation site of the ureI gene, it is likely that this transcript represents one of the mRNA molecules observed in the Northern hybridizations performed by Akada et al. (1). Therefore, we hypothesize that an additional endonucleolytic cleavage site involved in the processing of the ureABIEFGH mRNA is located in the intergenic region between ureB and ureI.
DNase I footprint analysis demonstrated that the ArsRS two-component system mediates pH-dependent regulation of PureA and PureI, directly through binding of the phosphorylated response regulator ArsR∼P to the respective promoter regions (Fig. 3 and 4). At neutral pH the basal level of transcription of PureI, as in the case of PureA (27), is largely unaffected in the absence of ArsS and, consequently, ArsR∼P (data not shown). Furthermore, removal of the distal upstream ArsR binding site of PureA had no effect on the basal level of transcription at neutral pH. Consequently, the ArsRS two-component system is required for activation of transcription only under acidic conditions. Acid-induced transcription from PureI is more pronounced when the PureA promoter is deleted (Fig. 2B). Currently this observation remains unexplained, but it might reflect a titration effect caused by the competition of response regulator binding sites of different affinity for a limited pool of ArsR∼P molecules, or it might be due to changes in DNA topology of the ureI promoter region favoring transcription from PureI which are caused by the deletion of the intergenic region between ureA and ORF HP0074.
The binding sites mapped for ArsR in the PureA and PureI promoters show certain peculiarities with respect to ArsR binding sites which were identified in the promoters of other pH-regulated genes. In the promoters of ORFs HP01408 and HP0119, the binding sites of ArsR consist of a well-conserved 26-bp motif located at a distance of 9 bp upstream of the −10 promoter element (15). Furthermore, a 20-bp ArsR binding site mapping downstream of the ParsR promoter, where ArsR∼P is likely to act as a repressor, showed some conservation of this motif (15). In both the PureA and the PureI promoters, extended ArsR binding sites were mapped which do not exhibit clear similarity either with the 26-bp ArsR binding motif identified previously or with each other. Nonetheless, deletion of the upstream binding site of ArsR within PureA abrogated pH-dependent regulation of the ureAB genes, indicating a role for this binding site in the acid response activation of transcription in vivo. While the ArsR binding site in other positively pH-regulated promoters overlaps the −35 promoter region, the binding site mapped in the PureI promoter also covers the −10 promoter element. Despite this atypical position of the binding site, ArsR clearly acts as an activator of transcription of ureI (Fig. 2B), suggesting that ArsR∼P is repositioned by the binding of RNA polymerase. The observation that the binding site of a transcriptional activator overlaps with the −10 promoter element in in vitro DNA binding experiments is not unprecedented, since, for example, Kinnear et al. (20) reported a similar pattern for the binding of the response regulator BvgA to the promoter of the pertactin gene. Interestingly, no binding of the unphosphorylated ArsR protein to the PureA and PureI promoters could be observed in the footprint experiments, while it bound to the P1408 and P119 promoters at elevated concentrations (>4.5 mM) (15), suggesting a lower affinity of the urease promoters for ArsR. This difference in affinity might be reflected in a different kinetics of acid induction, since Merrell et al. (23) observed by global transcriptome analysis that transcription from the P119 promoter is strongly induced after 30 min of acid exposure and declines at later time points, while the amount of ureAB transcript is maximal 90 min after the shift to low pH.
In addition to pH-dependent regulation, transcription of ureAB is also positively regulated in response to increasing concentrations of Ni2+ ions (35), while Ni2+-dependent regulation of ureIEFGH has not been reported. The transcriptional response of ureAB to Ni2+ is mediated by the NikR protein. In contrast to the orthologous repressor protein from E. coli, NikR from H. pylori has been reported to be a pleiotropic regulator (10, 14, 35). Recently, a high-affinity binding site of NikR was mapped in the PureA promoter, and it partially overlaps with the downstream binding site of ArsR identified in this study (13). van Vliet and colleagues inferred that NikR might act as a master regulator of acid adaptation, responding to the increased bioavailability of Ni2+ ions under acidic conditions (39). This was based on the observations that (i) the ferric uptake regulator protein Fur is involved in urease-independent mechanisms of acid resistance in H. pylori, including expression of the amidase AmiE (7, 17, 37); (ii) the Fur and NikR regulons partially overlap, with NikR acting as a repressor of Fur transcription (10, 13, 38); and (iii) urease transcription is positively controlled by NikR (36). We show here that acid induction of ureAB transcription is independent of the NikR protein and relies instead on the ArsS two-component pH sensor. In fact, the nikR deletion mutant showed a pH-responsive ureA transcription profile identical to that of the G27 wild-type strain (Fig. 6B), while deletion of arsS abrogates pH regulation of ureA and ureI almost completely (27). This implication is also corroborated by the observation that the acid-induced increase in urease activity does not differ significantly between H. pylori 26695 and an isogenic nikR deletion mutant (10, 38). Although pH-induced transcription of ureA was identical in the wild type and the nikR mutant, the slight increase in ureA transcription observed when the arsS mutant was exposed to pH 5.0 (27) might be attributed to the NikR protein being activated by the higher availability of Ni2+ at low pH, since in the arsS knockout strain NikR does not have to compete with ArsR∼P for binding to the PureA promoter. Otherwise, an additional transcriptional activator is likely to interact with the PureA promoter at low pH. Ni2+-dependent transcription of ureA at pH 7.0 was virtually unaltered in the arsS deletion mutant (Fig. 6C), demonstrating that ArsRS is not involved in the basal expression of NikR and supporting the conclusion that pH-dependent transcription and Ni2+-dependent transcription of ureA are mediated by independent regulatory mechanisms involving transcriptional activators competing for the interaction with partially overlapping binding sites and responding to different environmental stimuli.
van Vliet et al. reported acid-induced transcription of the nikR gene (38), which was, however, not detected in transcriptome analyses studying the global pH response (9, 23, 42). Therefore, it is tempting to speculate that pH control of nikR transcription might be mediated by the ArsRS two-component system, which is currently being tested in our laboratory. It is well established now that the acid-adaptive response of H. pylori is controlled in an intricate way involving at least the transcriptional regulators ArsR, NikR, and Fur (9, 27, 38). However, based on the observation that an H. pylori mutant lacking the arsS gene is completely unable to establish an infection in the mouse stomach (25), while mutants deficient in either NikR, Fur, or both metal-dependent regulators are still able to colonize mice (albeit with a clearly reduced efficiency compared to the wild-type strain) (9), it can be hypothesized that the ArsRS two-component system is the prominent player in the control of acid resistance genes during infection.
Acknowledgments
We thank Roy Gross for critically reading the manuscript. Maria-Antonieta Jiménez-Pearson is acknowledged for the gift of plasmid pSL-ureAProm. We also thank Alice Soragni for experimental help.
This work was supported by the Competence Network Pathogenomics of the German Federal Ministry of Education and Research.
Editor: V. J. DiRita
REFERENCES
- 1.Akada, J. K., M. Shirai, H. Takeuchi, M. Tsuda, and T. Nakazawa. 2000. Identification of the urease operon in Helicobacter pylori and its control by mRNA decay in response to pH. Mol. Microbiol. 36:1071-1084. [DOI] [PubMed] [Google Scholar]
- 2.Bauerfeind, P., R. Garner, B. E. Dunn, and H. L. Mobley. 1997. Synthesis and activity of Helicobacter pylori urease and catalase at low pH. Gut 40:25-30. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Beier, D., G. Spohn, R. Rappuoli, and V. Scarlato. 1997. Identification and characterization of an operon of Helicobacter pylori that is involved in motility and stress adaptation. J. Bacteriol. 179:4676-4683. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Beier, D., and R. Frank. 2000. Molecular characterization of two-component systems of Helicobacter pylori. J. Bacteriol. 182:2068-2076. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Bijlsma, J. J. E., M. M. Gerrits, R. Imamdi, C. M. J. E. Vandenbroucke-Grauls, and J. G. Kusters. 1998. Urease-positive, acid-sensitive mutants of Helicobacter pylori: urease-independent acid resistance involved in growth at low pH. FEMS Microbiol. Lett. 167:309-313. [DOI] [PubMed] [Google Scholar]
- 6.Bijlsma, J. J. E., A. L. M. Lie, I. C. Nootenboom, C. M. Vandenbroucke-Grauls, and J. G. Kusters. 2000. Identification of loci essential for the growth of Helicobacter pylori under acidic conditions. J. Infect. Dis. 182:1566-1569. [DOI] [PubMed] [Google Scholar]
- 7.Bijlsma, J. J. E., B. Waidner, A. H. M. van Vliet, N. J. Hughes, S. Häg, S. Bereswill, D. J. Kelly, C. M. J. E. Vandenbroucke-Grauls, M. Kist, and J. G. Kusters. 2002. The Helicobacter pylori homologue of the ferric uptake regulator is involved in acid resistance. Infect. Immun. 70:606-611. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Blaser, M. J. 1992. Helicobacter pylori: its role in disease. Clin. Infect. Dis. 15:386-391. [DOI] [PubMed] [Google Scholar]
- 9.Bury-Moné, S., J.-M. Thiberge, M. Contreras, A. Maitournam, A. Labigne, and H. de Reuse. 2004. Responsiveness to acidity via metal ion regulators mediates virulence in the gastric pathogen Helicobacter pylori. Mol. Microbiol. 53:623-638. [DOI] [PubMed] [Google Scholar]
- 10.Contreras, M., J.-M. Thiberge, M.-A. Mandrand-Berthelot, and A. Labigne. 2003. Characterization of the roles of NikR, a nickel-responsive pleiotropic autoregulator of Helicobacter pylori. Mol. Microbiol. 49:947-963. [DOI] [PubMed] [Google Scholar]
- 11.Davies, B. J., N. de Vries, S. G. Rijpkema, A. H. M. van Vliet, and C. W. Penn. 2002. Transcriptional and mutational analysis of the Helicobacter pylori urease promoter. FEMS Microbiol. Lett. 213:27-32. [DOI] [PubMed] [Google Scholar]
- 12.Delany, I., G. Spohn, R. Rappuoli, and V. Scarlato. 2001. The Fur repressor controls transcription of iron-activated and -repressed genes in Helicobacter pylori. Mol. Microbiol. 42:1297-1309. [DOI] [PubMed] [Google Scholar]
- 13.Delany, I., R. Ieva, A. Soragni, M. Hilleringman, R. Rappuoli, and V. Scarlato. In vitro analysis of protein-operator interactions of the NikR and Fur metal-responsive regulators in overlapping sets of genes in Helicobacter pylori. Submitted for publication. [DOI] [PMC free article] [PubMed]
- 14.dePina, K., V. Desjardin, M. A. Mandrand-Berthelot, G. Giordano, and L. F. Wu. 1999. Isolation and characterization of the nikR gene encoding a nickel-responsive regulator in Escherichia coli. J. Bacteriol. 181:670-674. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Dietz, P., G. Gerlach, and D. Beier. 2002. Identification of target genes regulated by the two-component system HP166-HP165 of Helicobacter pylori. J. Bacteriol. 184:350-362. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Eaton, K. A., and S. Krakowka. 1994. Effect of gastric pH on urease-dependent colonization of gnotobiotic piglets by Helicobacter pylori. Infect. Immun. 62:3604-3607. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Ernst, F. D., S. Bereswill, B. Waidner, J. Stoof, U. Mäder, J. G. Kusters, E. J. Kuipers, M. Kist, A. H. M. van Vliet, and G. Homuth. 2005. Transcriptional profiling of Helicobacter pylori Fur- and iron-regulated gene expression. Microbiology 151:533-546. [DOI] [PubMed] [Google Scholar]
- 18.Ferrero, R. L., V. Cussac, P. Courcoux, and A. Labigne. 1992. Construction of isogenic urease-negative mutants of Helicobacter pylori by allelic exchange. J. Bacteriol. 174:4212-4217. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Forsyth, M. H., P. Cao, P. P. Garcia, J. D. Hall, and T. L. Cover. 2002. Genome-wide transcriptional profiling in a histidine kinase mutant of Helicobacter pylori identifies members of a regulon. J. Bacteriol. 184:4630-4635. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Kinnear, S. M., P. E. Boucher, S. Stibitz, and N. H. Carbonetti. 1999. Analysis of BvgA activation of the pertactin gene promoter in Bordetella pertussis. J. Bacteriol. 181:5234-5241. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Labigne-Roussel, A., P. Courcoux, and L. Tompkins. 1988. Gene disruption and replacement as feasible approach for mutagenesis of Campylobacter jejuni. J. Bacteriol. 170:1704-1708. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Maxam, A. M., and W. Gilbert. 1977. A new method for sequencing DNA. Proc. Natl. Acad. Sci. USA 74:560-564. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Merrell, D. S., M. L. Goodrich, G. Otto, L. S. Tompkins, and S. Falkow. 2003. pH-regulated gene expression of the gastric pathogen Helicobacter pylori. Infect. Immun. 71:3529-3539. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Mollenhauer-Rektorschek, M., G. Hanauer, G. Sachs, and K. Melchers. 2002. Expression of UreI is required for intragastric transit and colonization of gerbil gastric mucosa by Helicobacter pylori. Res. Microbiol. 153:659-666. [DOI] [PubMed] [Google Scholar]
- 25.Panthel, K., P. Dietz, R. Haas, and D. Beier. 2003. Two-component systems of Helicobacter pylori contribute to virulence in a mouse infection model. Infect. Immun. 71:5381-5385. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Peterson, W. L. 1991. Helicobacter pylori and peptic ulcer disease. N. Engl. J. Med. 324:1043-1048. [DOI] [PubMed] [Google Scholar]
- 27.Pflock, M., P. Dietz, J. Schär, and D. Beier. 2004. Genetic evidence for histidine kinase HP165 being an acid sensor of Helicobacter pylori. FEMS Microbiol. Lett. 234:51-61. [DOI] [PubMed] [Google Scholar]
- 28.Rektorschek, M., D. Weeks, G. Sachs, and K. Melchers. 1998. Influence of pH on metabolism and urease activity of Helicobacter pylori. Gastroenterology 115:628-641. [DOI] [PubMed] [Google Scholar]
- 29.Scott, D. R., E. A. Marcus, D. L. Weeks, A. Lee, K. Melchers, and G. Sachs. 2000. Expression of the Helicobacter pylori ureI gene is required for acidic pH activation of cytoplasmic urease. Infect. Immun. 68:470-477. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Scott, D. R., E. A. Marcus, D. L. Weeks, and G. Sachs. 2002. Mechanisms of acid resistance due to the urease system of Helicobacter pylori. Gastroenterology 123:187-195. [DOI] [PubMed] [Google Scholar]
- 31.Skouloubris, S., J.-M. Thiberge, A. Labigne, and H. De Reuse. 1998. The Helicobacter pylori UreI protein is not involved in urease activity but is essential for bacterial survival in vivo. Infect. Immun. 66:4517-4521. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Spohn, G., and V. Scarlato. 1999. Motility of Helicobacter pylori is coordinately regulated by the transcriptional activator FlgR, an NtrC homolog. J. Bacteriol. 181:593-599. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Tomb, J.-F., O. White, A. R. Kerlavage, R. Clayton, G. G. Sutton, R. D. Fleischmann, K. A. Ketchum, H. P. Klenk, S. Gill, B.A. Dougherty, K. Nelson, J. Quackenbush, L. Zhou, E. F. Kirkness, S. Peterson, B. Loftus, D. Richardson, R. Dodson, H. G. Khalak, A. Glodek, K. McKenney, L. M. Fitzegerald, N. Lee, M. D. Adams, E. K. Hickey, D. E. Berg, J. D. Gocayne, T. R. Utterback, J. D. Peterson, J. M. Kelley, M. D. Cotton, J. M. Weidman, C. Fujii, C. Bowman, L. Watthey, E. Wallin, W. S. Hayes, M. Borodovsky, P. D. Karp, H. O. Smith, C. M. Fraser, and J. C. Venter. 1997. The complete genome sequence of the gastric pathogen Helicobacter pylori. Nature 388:539-547. [DOI] [PubMed] [Google Scholar]
- 34.Uemura, N. S., S. Okamoto, S. Yamamoto, N. Matsumura, S. Yamaguchi, M. Yamakido, K. Taniyama, N. Sasaki, and R. J. Schlemper. 2001. Helicobacter pylori infection and the development of gastric cancer. N. Engl. J. Med. 345:784-789. [DOI] [PubMed] [Google Scholar]
- 35.van Vliet, A. H. M., E. J. Kuipers, B. Waidner, B. J. Davies, N. de Vries, C. W. Penn, C. M. J. E. Vandenbroucke-Grauls, M. Kist, S. Bereswill, and J. G. Kusters. 2001. Nickel-responsive induction of urease expression in Helicobacter pylori is mediated at the transcriptional level. Infect. Immun. 69:4891-4897. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.van Vliet, A. H. M., S. W. Poppelaars, B. J. Davies, J. Stoof, S. Bereswill, M. Kist, C. W. Penn, E. J. Kuipers, and J. G. Kusters. 2002. NikR mediates nickel-responsive transcriptional induction of urease expression in Helicobacter pylori. Infect. Immun. 70:2846-2852. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.van Vliet, A. H. M., J. Stoof, S. W. Poppelaars, S. Bereswill, G. Homuth, M. Kist, E. J. Kuipers, and J. G. Kusters. 2003. Differential regulation of amidase- and formamidase-mediated ammonia production by the Helicobacter pylori Fur repressor. J. Biol. Chem. 278:9052-9057. [DOI] [PubMed] [Google Scholar]
- 38.van Vliet, A. H. M., E. J. Kuipers, J. Stoof, S. W. Poppelaars, and J. G. Kusters. 2004. Acid-responsive gene induction of ammonia-producing enzymes in Helicobacter pylori is mediated via a metal-responsive repressor cascade. Infect. Immun. 72:766-773. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.van Vliet, A. H. M., F. D. Ernst, and J. G. Kusters. 2004. NikR-mediated regulation of Helicobacter pylori acid adaptation. Trends Microbiol. 12:489-494. [DOI] [PubMed] [Google Scholar]
- 40.Wang, Y., and D. E. Taylor. 1990. Chloramphenicol resistance in Campylobacter coli: nucleotide sequence, expression, and cloning vector construction. Gene 94:23-28. [DOI] [PubMed] [Google Scholar]
- 41.Weeks, D. L., S. Eskandari, D. R. Scott, and G. Sachs. 2000. A H+ gated urea channel: the link between Helicobacter pylori urease and gastric colonization. Science 287:482-485. [DOI] [PubMed] [Google Scholar]
- 42.Wen, Y., E. A. Marcus, U. Matrubutham, M. A. Gleeson, D. R. Scott, and G. Sachs. 2003. Acid-adaptive genes of Helicobacter pylori. Infect. Immun. 71:5921-5939. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Xiang, Z., S. Censini, P. F. Bayeli, J. L. Telford, N. Figura, R. Rappuoli, and A. Covacci. 1995. Analysis of expression of CagA and VacA virulence factors in 43 strains of Helicobacter pylori reveals that clinical isolates can be divided into two major types and that CagA is not necessary for expression of the vacuolating cytotoxin. Infect. Immun. 63:94-98. [DOI] [PMC free article] [PubMed] [Google Scholar]