Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2025 Jul 30.
Published in final edited form as: Biochim Biophys Acta Bioenerg. 2024 Dec 13;1866(2):149532. doi: 10.1016/j.bbabio.2024.149532

Acute treadmill exercise induces mitochondrial unfolded protein response in skeletal muscle of male rats

Ibrahim Turkel a,*,1, Gokhan Burcin Kubat b,c,**,***,1, Tugba Fatsa d, Ozgu Acet e, Berkay Ozerklig a,f,g, Burak Yazgan h, Gulcin Simsek e, Keshav K Singh i, Sukran Nazan Kosar j
PMCID: PMC12309727  NIHMSID: NIHMS2093413  PMID: 39675514

Abstract

Mitochondria are often referred to as the energy centers of the cell and are recognized as key players in signal transduction, sensing, and responding to internal and external stimuli. Under stress conditions, the mitochondrial unfolded protein response (UPRmt), a conserved mitochondrial quality control mechanism, is activated to maintain mitochondrial and cellular homeostasis. As a physiological stimulus, exercise-induced mitochondrial perturbations trigger UPRmt, coordinating mitochondria-to-nucleus communication and initiating a transcriptional program to restore mitochondrial function. The aim of this study was to evaluate the UPRmt signaling response to acute exercise in skeletal muscle. Male rats were subjected to acute treadmill exercise at 25 m/min for 60 min on a 0 % grade. Plantaris muscles were collected from both sedentary and exercise groups at various times: immediately (0), and at 1, 3, 6, 12, and 24 h post-exercise. Reactive oxygen species (ROS) production was assessed using hydrogen peroxide assay and dihydroethidium staining. Additionally, the mRNA and protein expression of UPRmt markers were measured using ELISA and real-time PCR. Mitochondrial activity was assessed using succinate dehydrogenase (SDH) and cytochrome c oxidase (COX) staining. Our results demonstrated that acute exercise increased ROS production and upregulated UPRmt markers at both gene and protein levels. Moreover, skeletal muscle exhibited an increase in mitochondrial activity in response to exercise, as indicated by SDH and COX staining. These findings suggest that acute treadmill exercise is sufficient to induce ROS production, activate UPRmt signaling, and enhance mitochondrial activity in skeletal muscle, expanding our understanding of mitochondrial adaptations to exercise.

Keywords: Exercise, Mitochondria, Skeletal muscle, Mitochondrial unfolded protein response, UPRmt, Mitochondrial proteostasis

Graphical Abstract:

graphic file with name nihms-2093413-f0001.jpg

1. Introduction

Skeletal muscle is a complex and dynamic tissue involved in the regulation of movement, force production, postural control, thermogenesis, and metabolic health [1,2]. One of the remarkable properties of skeletal muscle is its plasticity, which allows it to adjust its mass and function in response to various stimuli, including substrate availability, loading conditions (microgravity or resistance exercise), and contractile activity (electrical stimulation or endurance exercise) [3,4]. Achieving skeletal muscle plasticity is, in part, dependent on the ability of the mitochondrial network to adapt and remodel in response to physiological and pathophysiological stressors, which can result in either enhanced or impaired skeletal muscle function [5,6]. Since sustained skeletal muscle contraction (e.g., during endurance exercise) requires a continuous supply of adenosine triphosphate (ATP) generated through oxidative phosphorylation [7,8], proper mitochondrial function is essential not only during exercise but also for maintaining skeletal muscle health [9].

Mitochondria are specialized organelles with their own genome and are central to energy production in the cell. In addition to being the powerhouse of the cell, mitochondria play a vital role in other essential biological functions, including the generation of reactive oxygen species (ROS), hormone synthesis, calcium homeostasis, and programmed cell death [10]. While their role in meeting the energy demands of cells is well established, mitochondria also act as signaling hubs, sensing, integrating, and transmitting information to various cellular compartments, thereby forming a bidirectional network that enables adaptation to stress [11,12]. Accordingly, mitochondria are equipped with mitochondrial quality control (MQC) mechanisms, such as mitochondrial biogenesis (synthesis), mitophagy (degradation), and mitochondrial dynamics (fusion and fission), which modulate organelle homeostasis [13,14]. Under both physiological and pathophysiological conditions, these MQC pathways enable mitochondria to undergo functional and structural changes necessary for cell survival, particularly in post-mitotic muscle fibers and neurons with high energy demands [15]. Specifically, perturbations such as protein import failure, oxidative stress, electron transport chain dysfunction, membrane potential disruption, and accumulation of damaged proteins can disturb mitochondrial homeostasis, triggering a mitochondria-specific response known as retrograde signaling [1,9,11,14]. This system forms a complex mitochondrial network that not only protects cells from damage but also highlights the multifaceted role of mitochondria as a signaling center [16].

A component of the MQC system, the mitochondrial unfolded protein response (UPRmt), is an adaptive stress response aimed at alleviating proteotoxic stress in the mitochondria and the cytosolic compartment of the cell [17–20]. Despite having their own genome, mitochondria encode only 13 proteins involved in oxidative phosphorylation through mitochondrial DNA (mtDNA). In contrast, 99 % of mitochondrial proteins are encoded by nuclear DNA [21]. Therefore, maintaining mitochondrial protein homeostasis—which involves the synthesis, import, folding, and degradation of proteins—is an essential process for ensuring the optimal functionality of mitochondria. The UPRmt operates through several steps, including the detection of mitochondrial stress, activation of transcription factors, and transcriptional regulation of chaperones and proteases to refold or degrade misfolded or unfolded proteins [22–24]. ATF5 is a key transcription factor involved in the activation of UPRmt [25], while ATF4 and CHOP also contribute to UPRmt signaling [26,27]. However, these three transcription factors are essential components of the ISR, where their selective translation is regulated through eIF2α kinase [28]. The ISR triggers a reduction in global protein translation during stress, but simultaneously promotes the uORF-regulated translation of specific genes, including those encoding stress-related transcription factors [29,30]. This suggests that the ISR and UPRmt may function as complementary pathways, working together to mitigate mitochondrial stress and ensure cellular survival.

Under normal conditions, transcription factors related to the mitochondrial stress response, such as ATF5, CHOP, C/EBP-β, and ATF4, are localized in the mitochondria or cytosol, where they are either degraded by mitochondrial proteases or remain inactive in the cytoplasm [20,31–33]. However, when mitochondrial function is disrupted, these transcription factors translocate to the nucleus, bind to specific gene promoters, and induce the expression of genes such as mtHsp70, Hsp70, Hsp60, and Hsp10, which are involved in folding newly imported or misfolded proteins [25,33]. Additionally, Lonp1 and ClpP are induced to degrade misfolded proteins [25]. A defective UPRmt has been implicated in various conditions, including aging, cardiovascular disease, neurodegenerative diseases, and fatty liver disease [18,33,34]. Studies have shown that inducing the UPRmt through pharmacological or lifestyle interventions can improve cardiac function and skeletal muscle health in rodent models of disease [35,36], suggesting that activating the UPRmt could be a key cellular mechanism for combating metabolic diseases and highlighting its potential importance in maintaining skeletal muscle health.

Exercise acts as a physiological stressor for the organism, with increased metabolic demands during contractile activity placing a significant burden on the mitochondria, thereby disrupting mitochondrial homeostasis [2,37,38]. Mitochondrial proteostasis is often challenged by various cellular stressors and requires a sophisticated system to maintain protein quality control [17,39]. For instance, exercise-induced ROS production can disrupt proteostasis, leading to the aggregation of damaged and misfolded proteins [40,41]. Despite the extensive research on well-established exercise-induced mitochondrial adaptations, little is known about the role and regulation of UPRmt in skeletal muscle, particularly in response to exercise [42–48]. One of the earliest studies investigating exercise-induced UPRmt demonstrated that contraction of the rat tibialis anterior muscle led to increased levels of Hsp60 and mtHsp70 compared to non-contracted muscle, suggesting that muscle contraction may enhance protein folding capacity [47]. More recently, Slavin et al. performed a mechanistic study using mice with a whole-body knockout of ATF5 to explore the role of UPRmt both at rest and in response to exercise [48]. The ATF5 knockout mice exhibited reduced mitochondrial function, increased mitochondrial content, and impaired mitophagic degradation at rest and after acute exercise, along with attenuated UPRmt. This highlights the importance of ATF5 signaling in maintaining mitochondrial homeostasis in skeletal muscle [48]. However, a broader understanding of the mechanisms modulating UPRmt in response to exercise in skeletal muscle is lacking. Given the limited data on UPRmt, this study aims to characterize UPRmt signaling in skeletal muscle to gain a better understanding of its role to exercise.

2. Material and methods

2.1. Ethics approval statement

Animal experiments were approved by Hacettepe University Local Ethics Committee for Animal Experiments (protocol number: 2021/06–03).

2.2. Animals

A total of 42 male Sprague Dawley rats (9–12 weeks old, weighing between 280 and 300 g) were obtained from Kobay A.S. (Ankara, Turkey). The animals were housed in groups of two per cage at the Animal Facility Laboratory, Faculty of Sport Sciences, Hacettepe University. They were maintained at a temperature of 20–24 °C and on a 12-h light-dark cycle (lights on: 20:00–08:00, lights off: 08:00–20:00), with unrestricted access to food (Bilyem, Ankara) and water throughout the experimental period. Following a seven-day acclimation period, the rats were randomly divided into one of seven groups: a sedentary group (SED, n = 6) and six exercise groups (n = 36). Following the acute exercise session, the rats were euthanized at six distinct time points, immediately (0 h, n = 6), 1 (n = 6), 3 (n = 6), 6 (n = 6), 12 (n = 6), and 24 h (n = 6) post-exercise. The animals in the SED group were maintained under standard cage conditions. The experimental protocol is summarized in Fig. 1.

Fig. 1.

Fig. 1.

Summary of the experimental protocol. Figure was created with BioRender.com.

2.3. Exercise protocol

The animals in the experimental groups underwent a six-day acclimation period on a motorized rodent treadmill. During this time, the treadmill speed was gradually increased from 10 to 20 m/min, and the duration was extended from 10 to 30 min with a 0 % grade (Table 1). Following acclimation to the treadmill, the animals were permitted a two-day period of rest before engaging in a single session of acute treadmill exercise. This session lasted for 60 min at a speed of 25 m/min with a 0 % grade [49,50], which is classified as moderate-to-high intensity exercise (Table 1) [51,52]. Since rats are nocturnal, exercise sessions were conducted during their active phase, corresponding to the dark cycle (approximately 10:00 to 15:00), to minimize the potential impact of stress on their physiological and molecular responses [53]. Following completion of each exercise session, animals were returned to their cages and provided with unrestricted access to food and water.

Table 1.

Summary of treadmill acclimation and acute treadmill exercise protocol.

Days Speed (m/min) Duration (min) Grade (%) Timeline

1 10 10 0 Adaptation to treadmill
2 10 15 0
3 12 20 0
4 15 25 0
5 17 30 0
6 20 30 0
7 0 0 0 Rest
8 0 0 0
9 25 60 0 Acute exercise session

2.4. Isolation of plantaris muscle

Upon completion of the experimental period, the animals were euthanized under anesthesia using an intraperitoneal (i.p.) injection of a ketamine-xylazine mixture (90 mg/kg ketamine and 10 mg/kg xylazine). Plantaris muscles, composed of mixed type fiber types (~8 % type I, ~21 % type IIA, ~45 % type IIX, ~17 % type IIB) [54], were dissected, rapidly frozen in liquid nitrogen, and stored at −80 °C. The left plantaris muscle was used for histological analysis, while the right plantaris was used for real-time PCR, hydrogen peroxide (H2O2) assay, and ELISA analysis.

2.5. Determination of H2O2 levels in skeletal muscle

The levels of H₂O₂ were determined according to the manufacturer’s instructions (catalog no: E-BC-K102-M, Elabscience). A 20 mg of muscle tissue was weighed and homogenized in ice-cold phosphate-buffered saline (PBS) using an Ultraturrax T25 homogenizer (IKA, Germany). The homogenate was then centrifuged at 10,000 ×g for 10 min at 4 °C to obtain the supernatant. 100 μL of buffer solution was added to the wells of a microplate, which were preheated at 37 °C for 10 min. Standards and samples (15 μL) were then added to the respective wells. Subsequently, 100 μL of ammonium molybdate reagent was added to each well, and the solution was mixed thoroughly. After a 5-second mixing using a microplate reader, the wells were permitted to remain at room temperature for a period of 10 min. Finally, the optical density values of each well were measured at 405 nm using a microplate reader (BioTek Synergy HTX, Agilent), and the results were expressed as mmol/gprot. The concentration of H₂O₂ was calculated by determining the protein concentration in the supernatant using a BCA protein assay kit (23225, Thermo Scientific), following the manufacturer’s instructions.

2.6. ELISA analysis

Protein levels of ATF5 (catalog No: E3382Ra, Btlab), CHOP (catalog No: E2610Ra, Btlab), and C/EBP-β (catalog No: E0040Ra, Btlab) were measured by ELISA, following the manufacturer’s instructions. Briefly, approximately 50 mg of muscle tissue was homogenized in cold PBS using an Ultraturrax T25 homogenizer (IKA, Germany). The homogenate was then centrifuged at 12,000 ×g for 15 min at 4 °C, and the supernatant was collected in a clean tube. Standards (50 μL) and samples (40 μL) were added to the appropriate wells of a microplate, and 10 μL of the antibody was added to each well containing samples. Next, 50 μL of streptavidin-HRP solution was added to each well. The microplate was then sealed and incubated for 60 min at 4 °C. After incubation, the liquid in the wells was discarded, and the wells were washed five times with wash buffer. Subsequently, 50 μL of solution A and 50 μL of solution B were added to each well, and the microplate was covered with a new sealer and incubated for 10 min at 37 °C in the dark. Following the addition of 50 μL of stop solution to each well, the microplate was analyzed using a microplate reader (BioTek Synergy HTX, Agilent) at a wavelength of 450 nm. The results were expressed relative to the total protein concentration, determined using a BCA protein assay kit, and calculated as ng/mg protein for ATF5 and CHOP, and μg/mg protein for C/EBP-β.

2.7. Total RNA isolation and reverse transcription

Approximately 25 mg of muscle tissue was homogenized using a homogenizer (Ultraturrax T25, IKA, Germany). Total RNA was isolated using the Total RNA Mini Kit (catalog no: W72070, Wizbiosolutions, Seongnam, Korea) in accordance with the manufacturer’s instructions. The concentration of total RNA was determined using a microplate reader (Thermo-Multiskan GO, USA). The cDNA was synthesized using the iScript™ cDNA Synthesis Kit (catalog number: 1708891, Bio-Rad) in accordance with the manufacturer’s instructions. Briefly, the reaction was set up in a 96-well plate with a total volume of 20 μL, containing 4 μL of 5× iScript reaction mix, 1 μL of iScript reverse transcriptase, 10 μL of total RNA template (1 μg), and 5 μL of nuclease-free water. Samples were incubated in a thermocycler (T100, Bio-Rad) using the following program: 25 °C for 5 min, 46 °C for 20 min, 95 °C for 1 min, and then 4 °C for 15 min. The cDNA was stored at −20 °C until further use in real-time PCR experiments.

2.8. Gene expression analysis using real-time PCR

Gene expressions of ATF5, CHOP, C/EBP-β, ATF4, mtHsp70, Hsp70, Hsp60, Hsp10, ClpP, Lonp1, and GAPDH were measured using iTaq Universal SYBR Green (Cat. No. 1725122, Bio-Rad) on an ABI 7500 PCR machine (Applied Biosystems). The reaction mix for each sample included 5 μL iTaq Universal SYBR Green Supermix (2×), 0.8 μL forward and reverse primers (500 nM each), 1 μL of cDNA template, and 2.4 μL of nuclease-free water, making a total reaction volume of 10 μL. Gene names, product sizes, primer sequences, and accession numbers are provided in Table 2.

Table 2.

Product size, primer sequence and accession number of target genes.

Gene Product size (bp) Direction Primer sequence (5′–>3′) Accession number

ATF5 188 Forward CCCCTATCCTAGTCCTGCCA NM_172336.4
Reverse TCTCCCGTTCCACTGACTCT
CHOP 94 Forward ACGTCGATCATACCATGTTGAAG NM_001109986.1
Reverse CACTTCCTTCTGGAACACTCTCT
C/EBP-β 126 Forward CAAGATGCGCAACCTGGAGA NM_024125.5
Reverse AGCTGCTTGAACAAGTTCCG
ATF4 193 Forward CGGCAAGGAGGATGCCTTTT NM_024403.2
Reverse TGTCTGAGGGGGCTCCTTAT
mtHsp70 186 Forward ACAAGCTGTCACCAACCCAA NM_001100658.2
Reverse AACGCTCCAATCTGACTCGG
Hsp70 175 Forward GTGCCTTCTGATGGTGACAAG NM_153629.1
Reverse CACCCCGAGATCCCCTAAAA
Hsp60 146 Forward GAAGGCTGGCTGATCACTGT NM_022229.2
Reverse TTGCACCCAGCATCAGGAAT
Hsp10 165 Forward GCGCTGTCTTTTCACGTGTC NM_012966.1
Reverse TTCAGCGGCACTCCTTTCAA
ClpP 151 Forward ATCTGCACATGGTGCGTTGG NM_001399287
Reverse TAGCGATGTCTGTGGCTTGG
Lonp1 120 Forward CGGGAGTGACCTGCATCATT NM_133404.1
Reverse TTCGGAAGATGTCGCGGTAG
GAPDH 262 Forward GCATCTTCTTGTGCAGTGCC NM_017008.4
Reverse GATGGTGATGGGTTTCCCGT

Bp, base pair; ATF5, activating transcription factor 5; CHOP, C/EBP homologous protein; C/EBP-β, CCAAT/enhancer-binding protein beta; ATF4, activating transcription factor 4; mtHsp70, mitochondrial heat shock protein 70; Hsp70, heat shock protein 70; Hsp60, heat shock protein 60; Hsp10, heat shock protein 10; ClpP, caseinolytic peptidase P; Lonp1, Lon Peptidase 1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

The real-time PCR parameters were as follows: initial denaturation at 95 °C for 30 s, followed by 40 cycles of amplification with 95 °C for 15 s and 60 °C for 60 s. The reaction was terminated with a melting curve analysis, which served to confirm the presence of a single product. The relative gene expression levels were calculated by normalizing each gene to GAPDH using the 2−ΔΔCT method [55].

2.9. SDH and COX staining

After mounting cryosections (5 μm thick) on positively charged slides with a cryostat (Thermo Shandon Cryotome E, USA), they were allowed to dry for 30 min at room temperature. For succinate dehydrogenase (SDH) activity, sections were incubated in SDH medium containing 0.2 M sodium succinate (catalog No. S2378, Sigma) and 1 mg/mL nitro blue tetrazolium (catalog No. N5514, Sigma) in 0.2 M PBS at 37 °C for 180 min. Following incubation, sections were rinsed in PBS (2 × 1 min) and covered with a coverslip using glycerol. For cytochrome c oxidase (COX) activity, sections were incubated in COX medium containing 0.1 % cytochrome c, 3.5 mM diaminobenzidine tetrahydrochloride, 0.2 % catalase, and 250 mM sucrose in 0.2 M PBS at room temperature for 60 min. After incubation, sections were rinsed in PBS (3 × 1 min), dehydrated in 95 and 100 % ethanol solution for 5 min, and treated with a graded series of xylene solution for 5 min before being covered with a coverslip using glycerol. For both SDH and COX activity staining, sections were imaged using a microscope (Nikon Eclipse 80i, Nikon) and analyzed manually with fixed thresholds using ImageJ software (NIH, Bethesda, Maryland, USA, https://imagej.nih.gov/ij/).

2.10. DHE staining

To detect the presence of ROS (superoxide anion) in skeletal muscle, dihydroethidium (DHE) staining was performed. 5 μm-thick sections were mounted on positively charged slides using a cryostat (ThermoShandon Cryotome E, USA) and left to dry at room temperature for 30 min prior to further processing. The sections were then rinsed in PBS for 30 s and incubated with 5 μm DHE (catalog no: 12013, Cayman Chemical) in PBS at 37 °C for 30 min. After incubation, the sections were washed twice in PBS for 1 min and covered with a mounting media (Dako, Denmark). Finally, the slides were imaged using a fluorescent microscope (Nikon Eclipse 80i) with a red excitation filter, and the fluorescence intensity was assessed using ImageJ (NIH, Bethesda, Maryland, USA, https://imagej.nih.gov/ij/).

2.11. Statistical analysis

Data are presented as mean ± standard error of the mean (SEM). All statistical analyses were performed using GraphPad Prism version 8.0 (GraphPad Software, USA). Differences between groups were assessed using one-way analysis of variance (ANOVA), followed by Fisher’s least significant difference (LSD) test for multiple comparisons. A p-value of <0.05 was considered statistically significant for all analyses.

3. Results

3.1. Acute exercise increases H2O2 levels in skeletal muscle

To determine the effects of acute treadmill exercise on ROS production, H₂O₂ levels in skeletal muscle were assessed. Compared to the SED, H2O2 levels significantly increased at 0 (p = 0.0021), 1 (p = 0.0152), 3 (p = 0.0023), and 6 h (p = 0.0218) post-exercise and then returned to SED levels at 12 and 24 h post-exercise (Table 3), suggesting that acute treadmill exercise is a potent stimulus for H2O2 production in skeletal muscle in a time-dependent manner.

Table 3.

Time-course H2O2 levels following acute treadmill exercise in rat skeletal muscle.

Variables SED 0 1 3 6 12 24

H2O2 (mmol/gprot) 0.60 ± 0.07 1.31 ± 0.15* 1.15 ± 0.11* 1.31 ± 0.12* 1.11 ± 0.22* 0.82 ± 0.21 0.49 ± 0.09
% change (relative to SED) – 118 % 90 % 117 % 85 % 36 % −19 %
p value (compared to SED) – 0.0021 0.0152 0.0023 0.0218 0.3125 0.5824

Data are presented as mean ± SEM (n = 5).

The asterisk (*) indicates a significant difference from SED (p < 0.05).

SED, sedentary; H2O2, hydrogen peroxide.

3.2. Acute exercise increases the protein expression of transcriptional factors related to UPRmt

To better understand the effects of acute exercise on transcription factors related to UPRmt markers, we measured the protein expression of ATF5, CHOP, and C/EBP-β using ELISA, as shown at Table 4. ATF5 protein expression significantly increased at 3 (p = 0.0004), 6 (p < 0.0001), 12 (p = 0,0001), and 24 h (p < 0,0001) post-exercise compared to the SED. A similar effect of acute exercise was observed in the protein expression of CHOP, as protein levels are increased at 6 (p = 0.033), 12 (p = 0.0348), and 24 h (p = 0.0002) post-exercise compared to the SED. Additionally, we observed a significant increase in C/EBP-β protein expression at 6 (p = 0.0462), 12 (p = 0.0167), and 24 h (p = 0.0013) post-exercise compared to the SED. These results suggest that transcription factors involved in UPRmt are sensitive to acute exercise, and the increase in ATF5, CHOP, and C/EBP-β protein expression during recovery after acute exercise may result from cumulative increases in the gene expression of these transcription factors. Additionally, this increase in transcript levels may provide key information for the synthesis of these proteins, which play a key role in maintaining mitochondrial homeostasis [7,56].

Table 4.

Time-course protein expression of ATF5, CHOP, and C/EBP-β following acute treadmill exercise in rat skeletal muscle.

Variables SED 0 1 3 6 12 24

ATF5 (ng/mg protein) 50.38 ± 1.48 58.66 ± 2.12 58.21 ± 4.16 69.91 ± 4.96* 74.36 ± 5.31* 72.04 ± 2.41* 75.04 ± 2.54*
% change (relative to SED) – 16 % 16 % 39 % 48 % 43 % 49 %
p value (compared to SED) – 0.1092 0.1293 0.0004 < 0.0001 0.0001 < 0.0001
CHOP (ng/mg protein) 51.34 ± 3.56 56.74 ± 2.85 53.63 ± 3.42 56.78 ± 3.47 60.86 ± 2.73* 60.76 ± 1.91* 69.23 ± 2.98*
% change (relative to SED) – 11 % 4 % 11 % 19 % 18 % 35 %
p value (compared to SED) – 0.2166 0.5959 0.2131 0.033 0.0348 0.0002
C/EBP-β (μg/mg protein) 9.36 ± 0.72 10.66 ± 0.79 10.27 ± 0.49 11.09 ± 0.92 11.59 ± 0.83* 12.07 ± 0.78* 13.13 ± 0.74*
% change (relative to SED) – 14 % 10 % 18 % 24 % 29 % 40 %
p value (compared to SED) – 0.2354 0.4041 0.1175 0.0462 0.0167 0.0013

Data are presented as mean ± SEM (n = 6).

The asterisk (*) indicates a significant difference from SED (p < 0.05).

SED, sedentary; ATF5, activating transcription factor 5; CHOP, C/EBP homologous protein; C/EBP-β, CCAAT/enhancer-binding protein beta.

3.3. Acute exercise increases the gene expression of transcriptional factors related to UPRmt

Next, we sought to determine whether acute exercise is sufficient to alter the gene expression of UPRmt markers in rat skeletal muscle. Our results demonstrated that the mRNA expression of ATF5 considerably increased at 1 (p = 0.0126), 3 (p = 0.0189), and 6 h (p = 0.0023) post-exercise compared to the SED (Fig. 2A, Table 5). Similarly, the mRNA expression of CHOP significantly increased at 3 (p = 0.0019) and 6 h (p = 0.0156) post-exercise compared to the SED (Fig. 2B, Table 5). Additionally, the mRNA expression of C/EBP-β significantly increased at 3 (p = 0.0108) and 6 h (p = 0.0144) post-exercise compared to the SED (Fig. 2C, Table 5). Finally, the mRNA expression of ATF4 significantly increased at 0 (p = 0.0142), 1 (p = 0.0136), and 3 h (p = 0.0217) post-exercise compared to the SED (Fig. 2D, Table 5). An essential first step in the UPRmt pathway is the exercise-induced alteration in mRNA expression of transcription factors such as ATF5, CHOP, C/EBP-β, and ATF4. Specifically, changes in the mRNA levels of these genes during the early post-exercise period (0–6 h) may be linked to increased protein levels at later time points (12–24 h), suggesting a connection between exercise- induced shifts in mRNA expression of transcription factors and the corresponding protein abundance they encode.

Fig. 2.

Fig. 2.

Time-course of ATF5 (A), CHOP (B), C/EBP-β (C), and ATF4 (D) mRNA expression in response to acute exercise in rat skeletal muscle. Each symbol (°) represents the individual value of each animal. Data are presented as mean ± SEM (n = 5). (*) p < 0.05 vs. sedentary (SED). ATF5, activating transcription factor 5; CHOP, C/EBP homologous protein; C/EBP-β, CCAAT/enhancer-binding protein beta; ATF4, activating transcription factor 4.

Table 5.

Fold change in mRNA expression levels of UPRmt markers in skeletal muscle.

Gene SED Post-exercise (h)
0 1 3 6 12 24

Transcription factors
ATF5 1,00 ± 0,05 1,31 ± 0,03 1,71 ± 0,26 1,66 ± 0,30 1,89 ± 0,26 1,10 ± 0,13 0,81 ± 0,06
CHOP 1,02 ± 0,10 0,89 ± 0,12 0,71 ± 0,12 1,81 ± 0,19 1,61 ± 0,23 0,84 ± 0,16 1,34 ± 0,17
C/EBP-β 1,01 ± 0,06 0,86 ± 0,12 0,96 ± 0,13 1,94 ± 0,24 1,90 ± 0,41 1,59 ± 0,38 1,58 ± 0,05
ATF4 1,01 ± 0,06 1,66 ± 0,15 1,66 ± 0,18 1,61 ± 0,13 1,20 ± 0,21 1,25 ± 0,23 0,88 ± 0,21
Chaperones
mtHsp70 1,01 ± 0,07 1,51 ± 0,08 1,18 ± 0,07 2,12 ± 0,29 2,22 ± 0,27 2,24 ± 0,45 1,78 ± 0,18
Hsp70 1,01 ± 0,08 1,36 ± 0,13 1,42 ± 0,12 1,21 ± 0,07 1,26 ± 0,14 1,36 ± 0,14 2,01 ± 0,28
Hsp60 1,00 ± 0,02 1,47 ± 0,13 1,03 ± 0,17 1,74 ± 0,31 2,01 ± 0,28 1,36 ± 0,17 1,32 ± 0,12
Hsp10 1,00 ± 0,03 1,29 ± 0,04 2,01 ± 0,23 1,74 ± 0,03 2,03 ± 0,11 1,86 ± 0,22 1,87 ± 0,22
Proteases
ClpP 1,01 ± 0,07 1,10 ± 0,08 1,16 ± 0,02 1,97 ± 0,12 2,22 ± 0,36 1,76 ± 0,22 1,90 ± 0,08
Lonp1 1,02 ± 0,11 0,98 ± 0,07 1,22 ± 0,06 2,27 ± 0,27 1,82 ± 0,11 1,78 ± 0,22 1,80 ± 0,08

Data are presented as mean ± SEM (n = 5). Values in bold are statistically significant compared to SED (p < 0.05). UPRmt, mitochondrial unfolded protein response; SED, sedentary; ATF5, activating transcription factor 5; CHOP, C/EBP homologous protein; C/EBP-β, CCAAT/enhancer-binding protein beta; ATF4, activating transcription factor 4; mtHsp70, mitochondrial heat shock protein 70; Hsp70, heat shock protein 70; Hsp60, heat shock protein 60; Hsp10, heat shock protein 10; ClpP, caseinolytic peptidase P; Lonp1, Lon Peptidase.

3.4. Acute exercise increases the gene expression of chaperones and proteases related to UPRmt

To investigate the effect of exercise on downstream components of UPRmt, we first assessed the gene expression of chaperones in skeletal muscle following acute treadmill exercise. A significant increase in the mRNA expression of mtHsp70 was observed at 3 (p = 0.0029), 6 (p = 0.0014), 12 (p = 0.0012), and 24 h (p = 0.0328) post-exercise compared to the SED (Fig. 3A, Table 5). In contrast, the mRNA expression of Hsp70 was significantly increased only at 24 h (p < 0.0001) post-exercise compared to SED (Fig. 3B, Table 5). Additionally, the mRNA expression of Hsp60 significantly increased at 3 (p = 0.0115) and 6 h (p = 0.0009) post-exercise compared to the SED (Fig. 3C, Table 5). Finally, the mRNA expression of Hsp10 was significantly increased at 1 (p < 0.0001), 3 (p = 0.0021), 6 (p < 0.0001), 12 (p = 0.0005), and 24 h (p = 0.0004) post-exercise compared to the SED (Fig. 3D, Table 5). Since these transcription factors coordinate mitochondrial stress by activating chaperone proteins that fold newly synthesized proteins and aid in degrading protein aggregates [57], increased transcriptional activation of these chaperones may reduce proteotoxicity caused by exercise-induced oxidative stress in skeletal muscle.

Fig. 3.

Fig. 3.

Time-course of mtHsp70 (A), Hsp70 (B), Hsp60 (C), and Hsp10 (D) mRNA expression in response to acute exercise in rat skeletal muscle. Each symbol (°) represents the individual value of each animal. Data are presented as mean ± SEM (n = 5). (*) p < 0.05 vs. sedentary (SED). mtHsp70, mitochondrial heat shock protein 70; Hsp70, heat shock protein 70; Hsp60, heat shock protein 60; Hsp10, heat shock protein 10.

Acute exercise altered the gene expression of downstream proteases in skeletal muscle, as shown at Fig. 4and Table 5. There was a significant increase in the mRNA expression of ClpP at 3 (p = 0.0005), 6 (p < 0.0001), 12 (p = 0.0052), and 24 h (p = 0.0012) post-exercise compared to the SED (Fig. 4A, Table 5). A similar response was observed in Lonp1 levels, with mRNA expression of Lonp1 significantly increased at 3 (p < 0.0001), 6 (p = 0.0010), 12 (p = 0.0017), and 24 h (p = 0.0013) post-exercise compared to the SED (Fig. 4B, Table 5). Similar to other downstream molecules in the UPRmt, ClpP and Lonp1 play central roles in mitochondrial homeostasis by mediating the degradation of damaged proteins [58]. Collectively, these data demonstrate that mitochondrial perturbations in response to acute exercise may trigger the final step of UPRmt signaling in skeletal muscle to maintain mitochondrial homeostasis.

Fig. 4.

Fig. 4.

Time-course of ClpP (A) and Lonp1 (B) mRNA expression in response to acute exercise in rat skeletal muscle. Each symbol (°) represents the individual value of each animal. Data are presented as mean ± SEM (n = 5). (*) p < 0.05 vs. sedentary (SED). ClpP, caseinolytic peptidase P; Lonp1, Lon Peptidase.

3.5. Exercise-induced changes in the staining of mitochondrial activity markers and DHE

Electron transport chain complex II (SDH) and IV (COX) activities were determined by histologic staining to evaluate whether mitochondrial activity is affected by acute exercise in rat skeletal muscle. Compared to the SED, SDH staining area significantly decreased at 0 h (p = 0.0288) following acute exercise and significantly increased at 24 h (p = 0.0223) post-exercise (Fig. 5A and B). Moreover, COX staining area was significantly increased at 6 (p = 0.0007), 12 (p < 0.0001) and 24 h (p = 0.0010) post-exercise compared to the SED (Fig. 5A and C). These results suggest that acute exercise induces a transient pattern of mitochondrial function, as measured by SDH and COX staining, implying a possible link between exercise-induced UPRmt and mitochondrial activity. Finally, ROS levels were assessed by DHE staining, which detects the presence of superoxide radical. We observed increased fluorescence intensity at 0 h (p < 0.0001) following acute exercise compared to the SED (Fig. 5A and D). These findings are consistent with the increase in H₂O₂ levels in skeletal muscle after an acute bout of exercise. However, the primary source of ROS during muscle contraction and the dominant ROS species generated during exercise remain unknown.

Fig. 5.

Fig. 5.

Comparison of SDH (A and B), COX (A and C), and DHE (A and D) staining at 0, 1, 3, 6, 12, and 24 h following acute exercise in rat skeletal muscle compared to the SED. Each symbol (blue, orange, and red circles) represents the individual value of each animal. Data are presented as mean ± SEM (n = 5). (*) p < 0.05 vs. SED. SDH, succinate dehydrogenase; COX, cytochrome c oxidase; DHE, dihydroethidium; SED, sedentary; a.u., arbitrary unit.

4. Discussion

4.1. Overview of general findings

Mitochondria have developed various defense mechanisms to protect themselves from potential disruptions that could lead to dysfunction. One such mechanism is the UPRmt, which detects mitochondrial perturbations and transmits signals from the mitochondria to the nucleus to initiate a transcriptional response, activating chaperones and proteases to alleviate mitochondrial proteotoxic stress [59,60]. Skeletal muscle has been identified as a key focus of mitochondrial adaptation studies due to its unique and complex mitochondrial network, which is finely tuned to cellular demands during exercise, and its bidirectional communication with the nucleus [60,61]. However, the molecular mechanism of UPRmt in response to exercise in skeletal muscle is not yet fully understood. Our findings demonstrate that: (1) acute treadmill exercise increases ROS production in the skeletal muscle of rats; (2) UPRmt markers are elevated following acute exercise; and (3) mitochondrial activity is restored or enhanced in response to acute exercise. Collectively, these results suggest that acute exercise increases ROS production, activates UPRmt markers, and enhances mitochondrial activity in skeletal muscle.

4.2. Acute exercise-induced ROS production

A large body of evidence has shown that various cellular compartments, including peroxisomes, endoplasmic reticulum, and mitochondria, as well as cytosolic enzymes like NADPH oxidases and phospholipases, contribute to ROS production and are recognized as key players in redox signaling pathways in response to different types of exercise [40,62,63]. During a single exercise session, the demand for ATP in contracting skeletal muscle can increase up to 100-fold compared to the resting state [38,39]. While excess or uncontrolled (i.e., supraphysiological) ROS production is generally considered detrimental to cells, physiological levels of ROS can trigger the adaptive response of skeletal muscles to exercise [64]. Specifically, muscle contraction during exercise increases protein oxidation and activates signaling pathways that contribute to mitochondrial adaptation in skeletal muscle [60]. Early experiments by Dillard et al. demonstrated that endurance exercise performed at 50 % of VO2max for 60 min increases oxidative stress [65], subsequently leading to the discovery that ROS are produced by contracting skeletal muscle [66]. To date, both rodent and human studies have expanded our understanding of exercise-induced ROS production and the redox-sensitive targets in muscle cells [40,41]. Our findings corroborate those of previous studies, indicating that acute exercise stimulates the production of H2O2 and superoxide anion levels in a time-dependent manner in the skeletal muscle of rats. Especially, superoxide production, as determined by DHE staining, responded rapidly to acute exercise, while H2O2 levels increased immediately after exercise and remained elevated for up to 6 h post-exercise. A possible explanation for the sustained generation of H2O2 in skeletal muscle following exercise is that H2O2 has a longer half-life compared to other ROS types. This result is in line with other studies showing that muscle contraction (gastrocnemius) in mice led to a two-fold increase in superoxide release, which began to decline to control levels within 15 min [67]. In contrast, acute exercise resulted in increased H2O2 production 90 min post-exercise, remaining elevated for up to 150 min compared to sedentary controls [68].

Although this study cannot determine the exact source of ROS in skeletal muscle after acute exercise, previous research has primarily focused on mitochondria and the cytosol as the major sources of ROS [62,69]. In a mouse study, mitochondrial ROS production was monitored using the MitoTimer probe, which is sensitive to oxidative changes in mitochondria [70]. Briefly, mitochondrial ROS production increased 3 h after acute exercise and remained elevated for up to 12 h in the gastrocnemius muscle, which has a fiber type composition similar to that of the plantaris muscle [54,70]. In contrast, a study investigating oxidative stress in electrically stimulated single muscle fibers found that mitochondria do not produce ROS [71]. During contractile activity, cytosolic ROS production increases by 94 %, suggesting that ROS are generated from distinct sites or regions [71]. Furthermore, although both compartments produce ROS, cytosolic ROS respond more quickly than mitochondrial ROS to contraction, highlighting the temporal differences in ROS production [72].

In conclusion, because we did not isolate specific cellular compartments or cell types within the muscle tissue, we were unable to identify which parts of the muscle contributed to ROS production during exercise. Existing studies highlight the involvement of both mitochondrial and cytosolic compartments, with their contributions varying based on the type of muscle activity. However, the precise source of ROS in skeletal muscle in response to acute exercise remains unclear.

4.3. Acute exercise promotes the activation of transcription factors involved in UPRmt

One of the key findings of this study is that acute exercise increases the mRNA levels (ATF5, CHOP, C/EBPβ, and ATF4) and protein expression (ATF5, CHOP, and C/EBPβ) of transcription factors involved in UPRmt. Briefly, the UPRmt was first identified in mammalian cells in response to mitochondrial stress and later characterized in Caenorhabditis elegans, leading to the induction of transcripts encoding mitochondria-specific enzymes that maintain mitochondrial protein homeostasis [20,73]. In response to mitochondrial stress, the UPRmt is activated to protect mitochondrial function and restore protein homeostasis through several steps: (1) sensing stress, (2) translocation of transcription factors to the nucleus, (3) induction of protective genes, and (4) restoration of mitochondrial homeostasis and overall health [11,18,46,74].

ATF4, ATF5, CHOP, and C/EBPβ are key regulators of the mitochondrial stress response, working together to induce the expression of mitochondrial chaperones and proteases that restore mitochondrial homeostasis [60,75]. However, it is important to note that these proteins also play essential roles in other stress pathways, such as ISR, UPRmt, and UPRER [27,76]. While these pathways target distinct cellular compartments, they share overlapping signaling components and are often co-activated during mitochondrial stress, making it challenging to determine which pathway is most dominant. Notably, ATF5 is a key regulator of the UPRmt pathway, and its function can alleviate mitochondrial stress, as described in both mammals and nematodes [20,73,77]. Under basal conditions, ATF5 accumulates and is degraded within mitochondria [25] similar to ATFS-1 in Caenorhabditis elegans [73]. Upon stress, ATF5 translocates to the nucleus, binds to the promoters of target genes, and induces the transcription of chaperones and proteases, thereby restoring mitochondrial function and providing vital support for cellular survival [20]. Furthermore, the chemical and genetic induction of UPRmt requires ATF5 activation, which has been implicated in cardio protection and neuroprotection, highlighting the role of ATF5 in tissue function [36,78]. Additionally, the transcriptional activation of UPRmt genes has been shown to require the heterodimerization of CHOP and C/EBP-β, and members of the ATF family are also known heterodimerize with members of these transcription factors in response to the accumulation of unfolded proteins [20,31,79,80]. Previous studies have shown an increased expression of ATF4 and CHOP in both cell culture (C2C12 muscle cells) and in vivo models of chronic contraction in the rat tibialis anterior muscle, suggesting that contraction is a potent stimulus for the induction of ATF4 and CHOP [45,46]. Additionally, the increased expression of UPRmt markers following acute exercise in the gastrocnemius muscle of mice further supports the idea that exercise may enhance the UPRmt response in a similar manner [44]. Interestingly, Slavin et al. observed that the cytosolic and nuclear levels of ATF5 remained unchanged in the tibialis anterior muscle following acute exercise, while CHOP levels in the nucleus increased [48]. Moreover, acute exercise led to the accumulation of ATF5 in mitochondrial fractions. A possible explanation for this is that the delayed response following exercise plays a crucial role in the nuclear translocation of ATF5 in skeletal muscle, suggesting that longer post-exercise time points may be necessary to observe this translocation.

4.4. Contribution of UPRmt signaling to acute exercise

Mitochondrial protein quality control is tightly regulated by the UPRmt, which ensures the refolding and degradation of unfolded, misfolded, and damaged proteins. This process is initiated by the transcriptional activation of chaperones and proteases, which facilitate proper protein folding and degradation to maintain mitochondrial protein homeostasis [32,81]. As the final step of UPRmt signaling, the transcriptional activation of downstream molecules such as Hsp70, Hsp60, Hsp10, ClpP, and Lonp1 induced through the binding of transcription factors to the promoter regions of these chaperones and proteases [20,34]. Previous studies have shown that UPRmt markers respond to contractile activity in both cell culture and animal models [42–48]. These findings are consistent with our study, which demonstrates that acute exercise increases the gene expression of mtHsp70, Hsp70, Hsp60, Hsp10, ClpP, and Lonp1 in the skeletal muscle of rats, suggesting that exercise serves as a potent stimulus for the induction of UPRmt markers. Additionally, we observed an increase in the gene and protein expression of UPRmt markers following acute exercise, with a transient rise in mRNA expression during the first few hours post-exercise, followed by subsequent changes in protein levels. This interaction may reflect a targeted mitochondrial stress response to exercise, where the selective synthesis of UPRmt markers is crucial for overcoming detrimental effects of mitochondrial stress. The cumulative effects of transient mRNA fluctuations during each exercise session likely contribute to the overall protein abundance of mitochondrial or mitochondria-related proteins [82]. However, recent studies suggest that increases in mRNA levels do not always correlate with parallel changes in protein levels [56,83,84]. Furthermore, the abundance of proteins associated with lipid metabolism was found to increase despite no corresponding changes in their mRNA levels in response to exercise [82], suggesting a time-dependent regulation of gene and protein expression.

Mechanistic studies focusing on the UPRmt signaling cascade have shown that either knockout or overexpression of chaperones and proteases in both cell culture and animal models results in elevated levels of unfolded proteins, impaired mitochondrial morphology and function, or enhanced mitochondrial function [85–87]. From a skeletal muscle-specific perspective, genetic ablation of Lonp1 in skeletal muscle impairs mitochondrial protein turnover, leading to mitochondrial dysfunction, decreased muscle strength, and reduced fiber size [88]. These findings align with our study, which shows that acute exercise increases mitochondrial activity, as indicated by SDH and COX staining, suggesting that UPRmt markers are vital for maintaining mitochondrial health and skeletal muscle function. Interestingly, transgenic mice lacking the ClpP gene are protected against high-fat diet-induced obesity and insulin resistance, along with improved glucose tolerance [89]. A possible explanation is that a compensatory mechanism may improve the metabolic health of these animals, as genes related to mitochondrial quality control (mitochondrial biogenesis, chaperones, and fission/fusion markers) and energy-sensitive pathways were upregulated in multiple tissues of these animals [89,90]. As previously mentioned, UPRmt signaling follows a three-step process: 1) perturbation of mitochondrial homeostasis, 2) translocation of transcription factors to the nucleus, and 3) transcriptional activation of chaperones and proteases to restore mitochondrial protein homeostasis [91]. Specifically, these steps involve the regulation of transcription factors, which are central to UPRmt signaling. Mitochondrial stress-specific activation of ATF5 is crucial for the activation of downstream UPRmt markers in cultured rat cardiomyocytes [92]. An increase in the gene expression of Hsp60, mtHsp70, and Lonp1 was observed in HEK 293 T cells treated with paraquat [25], a substance that generates ROS in the mitochondrial matrix [93]. However, transcription of these genes was reduced in ATF5 knockout cells following shRNA transfection [25], suggesting that ATF5-dependent activation of these genes plays a role in maintaining protein homeostasis. Contrary to these findings, mice lacking ATF5 exhibited increased protein expression of UPRmt chaperones [48]. Interestingly, ATF5 knockdown also led to increased CHOP protein expression, suggesting potential crosstalk between these transcription factors [48]. These results align with mechanistic studies showing that the promoter regions of Hsp60, Hsp10, and ClpP contain binding sites for CHOP and C/EBP-β, with a two-fold increase in the promoter activity of these chaperones and proteases observed in cells overexpressing CHOP/C/EBP-β [20,31,94]. These results imply that these transcription factors drive the expression of genes downstream of UPRmt signaling, either independently or synergistically [74].

5. Conclusion

Acute exercise induces a wide range of physiological adaptations in skeletal muscle, with mitochondria at the core of these changes. Mitochondrial adaptations in skeletal muscle are regulated by dynamic processes such as mitochondrial biogenesis, mitophagy, and mitochondrial dynamics, all of which are critical for maintaining mitochondrial homeostasis. Our findings show that acute exercise activates UPRmt, leading to increased expression of chaperones and proteases that are essential for maintaining mitochondrial proteostasis. These findings enhance our understanding of how exercise improves mitochondrial quality and function and may guide future therapeutic strategies targeting mitochondrial dysfunction.

6. Limitations and future directions

There are several limitations of this study that should be addressed. First, we were unable to measure mitochondrial function from isolated mitochondria or permeabilized muscle fibers, which is critical for fully characterizing mitochondrial function in response to exercise and investigating the interaction between UPRmt and mitochondrial function. Additionally, since UPRmt is activated by the accumulation of damaged proteins within mitochondria, it may be necessary to assess mitochondrial protein accumulation, rather than analyzing bulk tissue, to better understand the extent of protein damage caused by exercise. Finally, given that the initial step in UPRmt activation involves the nuclear translocation of transcription factors, it is important to quantify the protein expression of ATF5, CHOP, C/EBP-β, and ATF4 in the nucleus.

Mitochondrial research is at the core of scientific inquiry, spanning all areas of exercise science (e.g., exercise physiology and kinesiology) due to its multifaceted role in energy production and metabolic pathways. While valuable research has investigated exercise-induced changes in UPRmt signaling in skeletal muscle, we are still far from fully understanding the regulation of UPRmt and how exercise interacts with mitochondrial stress pathways. In this context, critical questions remain to be answered:

  1. How do different fiber types (glycolytic and oxidative) influence the UPRmt response to acute exercise?

  2. What effects do exercise type, intensity, and duration have on UPRmt activation?

  3. Is sex a significant factor affecting UPRmt to exercise?

  4. How is UPRmt sensed in skeletal muscle during exercise, and what are the key inducers?

  5. Do age and disease state alter UPRmt to exercise?

  6. Does UPRmt interact with other stress response pathways (e.g., ISR and UPRER), or does it operate as a distinct pathway?

  7. What are the molecular mechanisms driving UPRmt induction beyond the well-characterized transcription factors, chaperones, and proteases?

Acknowledgements

The authors would like to thank Gulhane Health Sciences Institute, Gulhane Training and Research Hospital Pathology Laboratory, and Amasya University Central Research Laboratory for their valuable technical assistance. We would also like to thank Ebru Bodur and Suleyman Bulut for providing the nitro blue tetrazolium reagent used in the SDH staining. Graphical abstract was created with BioRender.com

Funding

This work was supported by the Scientific and Technological Research Council of Turkey (TUBITAK) [123S878].

Abbreviations:

ATF5

activating transcription factor 5

CHOP

C/EBP homologous protein

C/EBP-β

CCAAT/enhancer-binding protein beta

mtHsp70

mitochondrial heat shock protein 70

Hsp70

heat shock protein 70

Hsp60

heat shock protein 60

Hsp10

heat shock protein 10

Lonp1

Lon Peptidase 1

ClpP

caseinolytic peptidase P

VO2max

maximal oxygen uptake

ISR

integrated stress response

UPRER

unfolded protein response of the endoplasmic reticulum

ATF4

activating transcription factor 4

eIF2α

eukaryotic translation initiation factor 2A

uORF

upstream open reading frame

NADPH

nicotinamide-adenine dinucleotide phosphate

Footnotes

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

CRediT authorship contribution statement

Ibrahim Turkel: Writing – review & editing, Writing – original draft, Visualization, Validation, Software, Resources, Methodology, Investigation, Formal analysis, Data curation, Conceptualization. Gokhan Burcin Kubat: Writing – original draft, Methodology, Investigation. Tugba Fatsa: Methodology, Investigation, Formal analysis. Ozgu Acet: Methodology, Investigation. Berkay Ozerklig: Visualization, Methodology, Formal analysis. Burak Yazgan: Methodology, Investigation. Gulcin Simsek: Writing – review & editing, Methodology, Investigation. Keshav K. Singh: Writing – review & editing, Writing – original draft, Supervision. Sukran Nazan Kosar: Writing – review & editing, Project administration, Funding acquisition, Conceptualization.

Data availability

Data will be made available on request.

References

  • [1].Smith JAB, Murach KA, Dyar KA, Zierath JR, Exercise metabolism and adaptation in skeletal muscle, Nat. Rev. Mol. Cell Biol. 24 (9) (2023) 607–632, 10.1038/s41580-023-00606-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [2].Zierath JR, Hawley JA, Skeletal muscle fiber type: influence on contractile and metabolic properties, PLoS Biol. 2 (10) (2004) e348, 10.1371/journal.pbio.0020348. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [3].Distefano G, Goodpaster BH, Effects of exercise and aging on skeletal muscle, Cold Spring Harb. Perspect. Med. 8 (3) (2018), 10.1101/cshperspect.a029785. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [4].Fluck M, Hoppeler H, Molecular basis of skeletal muscle plasticity—from gene to form and function, Rev. Physiol. Biochem. Pharmacol. 146 (2003) 159–216, 10.1007/s10254-002-0004-7. [DOI] [PubMed] [Google Scholar]
  • [5].Adhihetty PJ, Irrcher I, Joseph AM, Ljubicic V, Hood DA, Plasticity of skeletal muscle mitochondria in response to contractile activity, Exp. Physiol. 88 (1) (2003) 99–107, 10.1113/eph8802505. [DOI] [PubMed] [Google Scholar]
  • [6].Reisman EG, Hawley JA, Hoffman NJ, Exercise-regulated mitochondrial and nuclear signalling networks in skeletal muscle, Sports Med. 54 (5) (2024) 1097–1119, 10.1007/s40279-024-02007-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [7].Egan B, Sharples AP, Molecular responses to acute exercise and their relevance for adaptations in skeletal muscle to exercise training, Physiol. Rev. 103 (3) (2023) 2057–2170, 10.1152/physrev.00054.2021. [DOI] [PubMed] [Google Scholar]
  • [8].Egan B, Zierath JR, Exercise metabolism and the molecular regulation of skeletal muscle adaptation, Cell Metab. 17 (2) (2013) 162–184, 10.1016/j.cmet.2012.12.012. [DOI] [PubMed] [Google Scholar]
  • [9].Hood DA, Memme JM, Oliveira AN, Triolo M, Maintenance of skeletal muscle mitochondria in health, exercise, and aging, Annu. Rev. Physiol. 81 (2019) 19–41, 10.1146/annurev-physiol-020518-114310. [DOI] [PubMed] [Google Scholar]
  • [10].Anderson AJ, Jackson TD, Stroud DA, Stojanovski D, Mitochondria-hubs for regulating cellular biochemistry: emerging concepts and networks, Open Biol. 9 (8) (2019) 190126, 10.1098/rsob.190126. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [11].Merry TL, Ristow M, Mitohormesis in exercise training, Free Radic. Biol. Med. 98 (2016) 123–130, 10.1016/j.freeradbiomed.2015.11.032. [DOI] [PubMed] [Google Scholar]
  • [12].Picard M, Shirihai OS, Mitochondrial signal transduction, Cell Metab. 34 (11) (2022) 1620–1653, 10.1016/j.cmet.2022.10.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [13].Russell AP, Foletta VC, Snow RJ, Wadley GD, Skeletal muscle mitochondria: a major player in exercise, health and disease, Biochim. Biophys. Acta 1840 (4) (2014) 1276–1284, 10.1016/j.bbagen.2013.11.016. [DOI] [PubMed] [Google Scholar]
  • [14].Slavin MB, Memme JM, Oliveira AN, Moradi N, Hood DA, Regulatory networks coordinating mitochondrial quality control in skeletal muscle, Am. J. Physiol. Cell Physiol. 322 (5) (2022) C913–C926, 10.1152/ajpcell.00065.2022. [DOI] [PubMed] [Google Scholar]
  • [15].Wallace DC, Fan W, Procaccio V, Mitochondrial energetics and therapeutics, Annu. Rev. Pathol. 5 (2010) 297–348, 10.1146/annurev.pathol.4.110807.092314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [16].Pucadyil TJ, Chipuk JE, Liu Y, O’Neill L, Chen Q, The multifaceted roles of mitochondria, Mol. Cell 83 (6) (2023) 819–823, 10.1016/j.molcel.2023.02.030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [17].Anderson NS, Haynes CM, Folding the mitochondrial UPR into the integrated stress response, Trends Cell Biol. 30 (6) (2020) 428–439, 10.1016/j.tcb.2020.03.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [18].Haynes CM, Ron D, The mitochondrial UPR - protecting organelle protein homeostasis, J. Cell Sci. 123 (Pt 22) (2010) 3849–3855, 10.1242/jcs.075119. [DOI] [PubMed] [Google Scholar]
  • [19].Sutandy FXR, Gossner I, Tascher G, Munch C, A cytosolic surveillance mechanism activates the mitochondrial UPR, Nature 618 (7966) (2023) 849–854, 10.1038/s41586-023-06142-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [20].Zhao Q, Wang J, Levichkin IV, Stasinopoulos S, Ryan MT, Hoogenraad NJ, A mitochondrial specific stress response in mammalian cells, EMBO J. 21 (17) (2002) 4411–4419, 10.1093/emboj/cdf445. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [21].Bjorkholm P, Harish A, Hagstrom E, Ernst AM, Andersson SG, Mitochondrial genomes are retained by selective constraints on protein targeting, Proc. Natl. Acad. Sci. USA 112 (33) (2015) 10154–10161, 10.1073/pnas.1421372112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [22].Arnould T, Michel S, Renard P, Mitochondria retrograde signaling and the UPR mt: where are we in mammals? Int. J. Mol. Sci. 16 (8) (2015) 18224–18251, 10.3390/ijms160818224. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [23].Wang S, Gao K, Liu Y, UPR(mt) coordinates immunity to maintain mitochondrial homeostasis and animal fitness, Mitochondrion 41 (2018) 9–13, 10.1016/j.mito.2017.11.004. [DOI] [PubMed] [Google Scholar]
  • [24].Zhu L, Luo X, Fu N, Chen L, Mitochondrial unfolded protein response: a novel pathway in metabolism and immunity, Pharmacol. Res. 168 (2021) 105603, 10.1016/j.phrs.2021.105603. [DOI] [PubMed] [Google Scholar]
  • [25].Fiorese CJ, Schulz AM, Lin YF, Rosin N, Pellegrino MW, Haynes CM, The transcription factor ATF5 mediates a mammalian mitochondrial UPR, Curr. Biol. 26 (15) (2016) 2037–2043, 10.1016/j.cub.2016.06.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [26].Quiros PM, Prado MA, Zamboni N, D’Amico D, Williams RW, Finley D, Auwerx J, Multi-omics analysis identifies ATF4 as a key regulator of the mitochondrial stress response in mammals, J. Cell Biol. 216 (7) (2017) 2027–2045, 10.1083/jcb.201702058. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [27].Teske BF, Fusakio ME, Zhou D, Shan J, McClintick JN, Kilberg MS, Wek RC, CHOP induces activating transcription factor 5 (ATF5) to trigger apoptosis in response to perturbations in protein homeostasis, Mol. Biol. Cell 24 (15) (2013) 2477–2490, 10.1091/mbc.E13-01-0067. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [28].Zhou D, Palam LR, Jiang L, Narasimhan J, Staschke KA, Wek RC, Phosphorylation of eIF2 directs ATF5 translational control in response to diverse stress conditions, J. Biol. Chem. 283 (11) (2008) 7064–7073, 10.1074/jbc.M708530200. [DOI] [PubMed] [Google Scholar]
  • [29].Lu PD, Harding HP, Ron D, Translation reinitiation at alternative open reading frames regulates gene expression in an integrated stress response, J. Cell Biol. 167 (1) (2004) 27–33, 10.1083/jcb.200408003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [30].Vattem KM, Wek RC, Reinitiation involving upstream ORFs regulates ATF4 mRNA translation in mammalian cells, Proc. Natl. Acad. Sci. USA 101 (31) (2004) 11269–11274, 10.1073/pnas.0400541101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [31].Horibe T, Hoogenraad NJ, The chop gene contains an element for the positive regulation of the mitochondrial unfolded protein response, PLoS One 2 (9) (2007) e835, 10.1371/journal.pone.0000835. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [32].Shpilka T, Haynes CM, The mitochondrial UPR: mechanisms, physiological functions and implications in ageing, Nat. Rev. Mol. Cell Biol. 19 (2) (2018) 109–120, 10.1038/nrm.2017.110. [DOI] [PubMed] [Google Scholar]
  • [33].Zhu L, Zhou Q, He L, Chen L, Mitochondrial unfolded protein response: an emerging pathway in human diseases, Free Radic. Biol. Med. 163 (2021) 125–134, 10.1016/j.freeradbiomed.2020.12.013. [DOI] [PubMed] [Google Scholar]
  • [34].Zhou Z, Fan Y, Zong R, Tan K, The mitochondrial unfolded protein response: a multitasking giant in the fight against human diseases, Ageing Res. Rev. 81 (2022) 101702, 10.1016/j.arr.2022.101702. [DOI] [PubMed] [Google Scholar]
  • [35].Apablaza P, Borquez JC, Mendoza R, Silva M, Tapia G, Espinosa A, Del Campo A, Exercise induces an augmented skeletal muscle mitochondrial unfolded protein response in a mouse model of obesity produced by a high-fat diet, Int. J. Mol. Sci. 24 (6) (2023), 10.3390/ijms24065654. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [36].Wang YT, Lim Y, McCall MN, Huang KT, Haynes CM, Nehrke K, Brookes PS, Cardioprotection by the mitochondrial unfolded protein response requires ATF5, Am. J. Physiol. Heart Circ. Physiol. 317 (2) (2019) H472–H478, 10.1152/ajpheart.00244.2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [37].Drake JC, Wilson RJ, Yan Z, Molecular mechanisms for mitochondrial adaptation to exercise training in skeletal muscle, FASEB J. 30 (1) (2016) 13–22, 10.1096/fj.15-276337. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [38].Hawley JA, Hargreaves M, Joyner MJ, Zierath JR, Integrative biology of exercise, Cell 159 (4) (2014) 738–749, 10.1016/j.cell.2014.10.029. [DOI] [PubMed] [Google Scholar]
  • [39].Ashcroft SP, Stocks B, Egan B, Zierath JR, Exercise induces tissue-specific adaptations to enhance cardiometabolic health, Cell Metab. 36 (2) (2024) 278–300, 10.1016/j.cmet.2023.12.008. [DOI] [PubMed] [Google Scholar]
  • [40].Powers SK, Radak Z, Ji LL, Exercise-induced oxidative stress: past, present and future, J. Physiol. 594 (18) (2016) 5081–5092, 10.1113/JP270646. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [41].Powers SK, Radak Z, Ji LL, Jackson M, Reactive oxygen species promote endurance exercise-induced adaptations in skeletal muscles, J. Sport Health Sci. 13 (6) (2024) 780–792, 10.1016/j.jshs.2024.05.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [42].Cordeiro AV, Bricola RS, Braga RR, Lenhare L, Silva VRR, Anaruma CP, Ropelle ER, Aerobic exercise training induces the mitonuclear imbalance and UPRmt in the skeletal muscle of aged mice, J. Gerontol. A Biol. Sci. Med. Sci. 75 (12) (2020) 2258–2261, 10.1093/gerona/glaa059. [DOI] [PubMed] [Google Scholar]
  • [43].Cordeiro AV, Peruca GF, Braga RR, Bricola RS, Lenhare L, Silva VRR, Ropelle ER, High-intensity exercise training induces mitonuclear imbalance and activates the mitochondrial unfolded protein response in the skeletal muscle of aged mice, Geroscience 43 (3) (2021) 1513–1518, 10.1007/s11357-020-00246-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [44].Gaspar RS, Katashima CK, Crisol BM, Carneiro FS, Sampaio I, Silveira LDR, Ropelle ER, Physical exercise elicits UPR(mt) in the skeletal muscle: the role of c-Jun N-terminal kinase, Mol. Metab. 78 (2023) 101816, 10.1016/j.molmet.2023.101816. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [45].Memme JM, Oliveira AN, Hood DA, Chronology of UPR activation in skeletal muscle adaptations to chronic contractile activity, Am. J. Physiol. Cell Physiol. 310 (11) (2016) C1024–C1036, 10.1152/ajpcell.00009.2016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [46].Mesbah Moosavi ZS, Hood DA, The unfolded protein response in relation to mitochondrial biogenesis in skeletal muscle cells, Am. J. Physiol. Cell Physiol. 312 (5) (2017) C583–C594, 10.1152/ajpcell.00320.2016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [47].Ornatsky OI, Connor MK, Hood DA, Expression of stress proteins and mitochondrial chaperonins in chronically stimulated skeletal muscle, Biochem. J. 311 (Pt 1) (1995) 119–123, 10.1042/bj3110119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [48].Slavin MB, Kumari R, Hood DA, ATF5 is a regulator of exercise-induced mitochondrial quality control in skeletal muscle, Mol. Metab. (2022) 101623, 10.1016/j.molmet.2022.101623. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [49].Turkel I, Ozerklig B, Yazgan B, Ozenc AE, Kubat GB, Simsek G, Kosar SN, Systemic and tissue-specific spexin response to acute treadmill exercise in rats, Peptides (2024) 171281, 10.1016/j.peptides.2024.171281. [DOI] [PubMed] [Google Scholar]
  • [50].Turkel I, Tahtalioglu S, Celik E, Yazgan B, Kubat GB, Ozerklig B, Kosar SN, Time-course and muscle-specific gene expression of matrix metalloproteinases and inflammatory cytokines in response to acute treadmill exercise in rats, Mol. Biol. Rep. 51 (1) (2024) 667, 10.1007/s11033-024-09637-9. [DOI] [PubMed] [Google Scholar]
  • [51].Contarteze RVL, Manchado FB, Gobatto CA, De Mello MAR, Stress biomarkers in rats submitted to swimming and treadmill running exercises, Comp. Biochem. Physiol. A Mol. Integr. Physiol. 151 (3) (2008) 415–422, 10.1016/j.cbpa.2007.03.005. [DOI] [PubMed] [Google Scholar]
  • [52].Oliveira GP Jr., Porto WF, Palu CC, Pereira LM, Petriz B, Almeida JA, Pereira RW, Effects of acute aerobic exercise on rats serum extracellular vesicles diameter, concentration and small RNAs content, Front. Physiol. 9 (2018) 532, 10.3389/fphys.2018.00532. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [53].Poole DC, Copp SW, Colburn TD, Craig JC, Allen DL, Sturek M, Musch TI, Guidelines for animal exercise and training protocols for cardiovascular studies, Am. J. Physiol. Heart Circ. Physiol. 318 (5) (2020) H1100–H1138, 10.1152/ajpheart.00697.2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [54].Bloemberg D, Quadrilatero J, Rapid determination of myosin heavy chain expression in rat, mouse, and human skeletal muscle using multicolor immunofluorescence analysis, PLoS One 7 (4) (2012) e35273, 10.1371/journal.pone.0035273. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [55].Livak KJ, Schmittgen TD, Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method, Methods 25 (4) (2001) 402–408, 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  • [56].Bishop DJ, Hoffman NJ, Taylor DF, Saner NJ, Lee MJ, Hawley JA, Discordant skeletal muscle gene and protein responses to exercise, Trends Biochem. Sci. 48 (11) (2023) 927–936, 10.1016/j.tibs.2023.08.005. [DOI] [PubMed] [Google Scholar]
  • [57].Rosenzweig R, Nillegoda NB, Mayer MP, Bukau B, The Hsp70 chaperone network, Nat. Rev. Mol. Cell Biol. 20 (11) (2019) 665–680, 10.1038/s41580-019-0133-3. [DOI] [PubMed] [Google Scholar]
  • [58].Deshwal S, Fiedler KU, Langer T, Mitochondrial proteases: multifaceted regulators of mitochondrial plasticity, Annu. Rev. Biochem. 89 (2020) 501–528, 10.1146/annurev-biochem-062917-012739. [DOI] [PubMed] [Google Scholar]
  • [59].Bar-Ziv R, Bolas T, Dillin A, Systemic effects of mitochondrial stress, EMBO Rep. 21 (6) (2020) e50094, 10.15252/embr.202050094. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [60].Richards BJ, Slavin M, Oliveira AN, Sanfrancesco VC, Hood DA, Mitochondrial protein import and UPR(mt) in skeletal muscle remodeling and adaptation, Semin. Cell Dev. Biol. (2022), 10.1016/j.semcdb.2022.01.002. [DOI] [PubMed] [Google Scholar]
  • [61].Memme JM, Erlich AT, Phukan G, Hood DA, Exercise and mitochondrial health, J. Physiol. 599 (3) (2021) 803–817, 10.1113/JP278853. [DOI] [PubMed] [Google Scholar]
  • [62].Henriquez-Olguin C, Meneses-Valdes R, Jensen TE, Compartmentalized muscle redox signals controlling exercise metabolism - current state, future challenges, Redox Biol. 35 (2020) 101473, 10.1016/j.redox.2020.101473. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [63].Powers SK, Jackson MJ, Exercise-induced oxidative stress: cellular mechanisms and impact on muscle force production, Physiol. Rev. 88 (4) (2008) 1243–1276, 10.1152/physrev.00031.2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [64].Sies H, Jones DP, Reactive oxygen species (ROS) as pleiotropic physiological signalling agents, Nat. Rev. Mol. Cell Biol. 21 (7) (2020) 363–383, 10.1038/s41580-020-0230-3. [DOI] [PubMed] [Google Scholar]
  • [65].Dillard CJ, Litov RE, Savin WM, Dumelin EE, Tappel AL, Effects of exercise, vitamin E, and ozone on pulmonary function and lipid peroxidation, J. Appl. Physiol. Respir. Environ. Exerc. Physiol. 45 (6) (1978) 927–932, 10.1152/jappl.1978.45.6.927. [DOI] [PubMed] [Google Scholar]
  • [66].Davies KJ, Quintanilha AT, Brooks GA, Packer L, Free radicals and tissue damage produced by exercise, Biochem. Biophys. Res. Commun. 107 (4) (1982) 1198–1205, 10.1016/s0006-291x(82)80124-1. [DOI] [PubMed] [Google Scholar]
  • [67].McArdle A, Pattwell D, Vasilaki A, Griffiths RD, Jackson MJ, Contractile activity-induced oxidative stress: cellular origin and adaptive responses, Am. J. Physiol. Cell Physiol. 280 (3) (2001) C621–C627, 10.1152/ajpcell.2001.280.3.C621. [DOI] [PubMed] [Google Scholar]
  • [68].Wang P, Li CG, Qi Z, Cui D, Ding S, Acute exercise induced mitochondrial H₂O₂ production in mouse skeletal muscle: association with p(66Shc) and FOXO3a signaling and antioxidant enzymes, Oxid. Med. Cell. Longev (2015) 536456, 10.1155/2015/536456. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [69].Margaritelis NV, Theodorou AA, Paschalis V, Veskoukis AS, Dipla K, Zafeiridis A, Nikolaidis MG, Adaptations to endurance training depend on exercise-induced oxidative stress: exploiting redox interindividual variability, Acta Physiol. (Oxford) 222 (2) (2018), 10.1111/apha.12898. [DOI] [PubMed] [Google Scholar]
  • [70].Laker RC, Drake JC, Wilson RJ, Lira VA, Lewellen BM, Ryall KA, Yan Z, Ampk phosphorylation of Ulk1 is required for targeting of mitochondria to lysosomes in exercise-induced mitophagy, Nat. Commun. 8 (1) (2017) 548, 10.1038/s41467-017-00520-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [71].Michaelson LP, Shi G, Ward CW, Rodney GG, Mitochondrial redox potential during contraction in single intact muscle fibers, Muscle Nerve 42 (4) (2010) 522–529, 10.1002/mus.21724. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [72].Pearson T, Kabayo T, Ng R, Chamberlain J, McArdle A, Jackson MJ, Skeletal muscle contractions induce acute changes in cytosolic superoxide, but slower responses in mitochondrial superoxide and cellular hydrogen peroxide, PLoS One 9 (5) (2014) e96378, 10.1371/journal.pone.0096378. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [73].Nargund AM, Pellegrino MW, Fiorese CJ, Baker BM, Haynes CM, Mitochondrial import efficiency of ATFS-1 regulates mitochondrial UPR activation, Science 337 (6094) (2012) 587–590, 10.1126/science.1223560. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [74].Melber A, Haynes CM, UPR(mt) regulation and output: a stress response mediated by mitochondrial-nuclear communication, Cell Res. 28 (3) (2018) 281–295, 10.1038/cr.2018.16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [75].Sanfrancesco VC, Hood DA, Acute contractile activity induces the activation of the mitochondrial integrated stress response and the transcription factor ATF4, J. Appl. Physiol. (2024), 10.1152/japplphysiol.00307.2024 (1985). [DOI] [PubMed] [Google Scholar]
  • [76].Nishitoh H, CHOP is a multifunctional transcription factor in the ER stress response, J. Biochem. 151 (3) (2012) 217–219, 10.1093/jb/mvr143. [DOI] [PubMed] [Google Scholar]
  • [77].Nargund AM, Fiorese CJ, Pellegrino MW, Deng P, Haynes CM, Mitochondrial and nuclear accumulation of the transcription factor ATFS-1 promotes OXPHOS recovery during the UPR(mt), Mol. Cell 58 (1) (2015) 123–133, 10.1016/j.molcel.2015.02.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [78].Hu D, Liu Z, Qi X, UPR(mt) activation protects against MPP(+)-induced toxicity in a cell culture model of Parkinson’s disease, Biochem. Biophys. Res. Commun. 569 (2021) 17–22, 10.1016/j.bbrc.2021.06.079. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [79].Dogan SA, Pujol C, Maiti P, Kukat A, Wang S, Hermans S, Trifunovic A, Tissue-specific loss of DARS2 activates stress responses independently of respiratory chain deficiency in the heart, Cell Metab. 19 (3) (2014) 458–469, 10.1016/j.cmet.2014.02.004. [DOI] [PubMed] [Google Scholar]
  • [80].Su N, Kilberg MS, C/EBP homology protein (CHOP) interacts with activating transcription factor 4 (ATF4) and negatively regulates the stress-dependent induction of the asparagine synthetase gene, J. Biol. Chem. 283 (50) (2008) 35106–35117, 10.1074/jbc.M806874200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [81].Torres AK, Fleischhart V, Inestrosa NC, Mitochondrial unfolded protein response (UPR(mt)): what we know thus far, Front. Cell Dev. Biol. 12 (2024) 1405393, 10.3389/fcell.2024.1405393. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [82].Perry CG, Lally J, Holloway GP, Heigenhauser GJ, Bonen A, Spriet LL, Repeated transient mRNA bursts precede increases in transcriptional and mitochondrial proteins during training in human skeletal muscle, J. Physiol. 588 (Pt 23) (2010) 4795–4810, 10.1113/jphysiol.2010.199448. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [83].McGinley C, Bishop DJ, Distinct protein and mRNA kinetics of skeletal muscle proton transporters following exercise can influence interpretation of adaptations to training, Exp. Physiol. 101 (12) (2016) 1565–1580, 10.1113/EP085921. [DOI] [PubMed] [Google Scholar]
  • [84].Miller BF, Konopka AR, Hamilton KL, The rigorous study of exercise adaptations: why mRNA might not be enough, J. Appl. Physiol. (1985) 121 (2) (2016) 594–596, 10.1152/japplphysiol.00137.2016. [DOI] [PubMed] [Google Scholar]
  • [85].De Gaetano A, Gibellini L, Bianchini E, Borella R, De Biasi S, Nasi M, Pinti M, Impaired mitochondrial morphology and functionality in Lonp1(wt/−) mice, J. Clin. Med. 9 (6) (2020), 10.3390/jcm9061783. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [86].Haynes CM, Petrova K, Benedetti C, Yang Y, Ron D, ClpP mediates activation of a mitochondrial unfolded protein response in C. elegans, Dev. Cell 13 (4) (2007) 467–480, 10.1016/j.devcel.2007.07.016. [DOI] [PubMed] [Google Scholar]
  • [87].Lin KM, Lin B, Lian IY, Mestril R, Scheffler IE, Dillmann WH, Combined and individual mitochondrial HSP60 and HSP10 expression in cardiac myocytes protects mitochondrial function and prevents apoptotic cell deaths induced by simulated ischemia-reoxygenation, Circulation 103 (13) (2001) 1787–1792, 10.1161/01.cir.103.13.1787. [DOI] [PubMed] [Google Scholar]
  • [88].Xu Z, Fu T, Guo Q, Zhou D, Sun W, Zhou Z, Gan Z, Disuse-associated loss of the protease LONP1 in muscle impairs mitochondrial function and causes reduced skeletal muscle mass and strength, Nat. Commun. 13 (1) (2022) 894, 10.1038/s41467-022-28557-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [89].Bhaskaran S, Pharaoh G, Ranjit R, Murphy A, Matsuzaki S, Nair BC, Deepa SS, Loss of mitochondrial protease ClpP protects mice from diet-induced obesity and insulin resistance, EMBO Rep. 19 (3) (2018), 10.15252/embr.201745009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [90].Gispert S, Parganlija D, Klinkenberg M, Drose S, Wittig I, Mittelbronn M, Auburger G, Loss of mitochondrial peptidase Clpp leads to infertility, hearing loss plus growth retardation via accumulation of CLPX, mtDNA and inflammatory factors, Hum. Mol. Genet. 22 (24) (2013) 4871–4887, 10.1093/hmg/ddt338. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [91].Pellegrino MW, Nargund AM, Haynes CM, Signaling the mitochondrial unfolded protein response, Biochim. Biophys. Acta 1833 (2) (2013) 410–416, 10.1016/j.bbamcr.2012.02.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [92].Smyrnias I, Gray SP, Okonko DO, Sawyer G, Zoccarato A, Catibog N, Shah AM, Cardioprotective effect of the mitochondrial unfolded protein response during chronic pressure overload, J. Am. Coll. Cardiol. 73 (14) (2019) 1795–1806, 10.1016/j.jacc.2018.12.087. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [93].Cocheme HM, Murphy MP, Complex I is the major site of mitochondrial superoxide production by paraquat, J. Biol. Chem. 283 (4) (2008) 1786–1798, 10.1074/jbc.M708597200. [DOI] [PubMed] [Google Scholar]
  • [94].Aldridge JE, Horibe T, Hoogenraad NJ, Discovery of genes activated by the mitochondrial unfolded protein response (mtUPR) and cognate promoter elements, PLoS One 2 (9) (2007) e874, 10.1371/journal.pone.0000874. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data will be made available on request.

RESOURCES