Application of CHyMErA Cas9-Cas12a combinatorial genome editing platform for genetic interaction mapping and gene fragment deletion screening

Abstract

CRISPR-based forward genetic screening represents a powerful approach for the systematic characterization of gene function. Recent efforts have been directed towards establishing CRISPR-based tools for the programmable delivery of combinatorial genetic perturbations, most of which are mediated by a single nuclease and the expression of structurally identical guide backbones from two promoters. In contrast, we have developed CHyMErA (Cas Hybrid for Multiplexed Editing and Screening Applications), which is based on the co-expression of Cas9 and Cas12a nucleases in conjunction with a hybrid guide RNA (hgRNA) engineered by the fusion of Cas9 and Cas12a guides and expressed from a single U6 promoter. CHyMErA is suitable for the high-throughput deletion of genetic segments including the excision of individual exons. Furthermore, CHyMErA enables the concomitant targeting of two or more genes and can thus be used for the systematic mapping of genetic interactions in mammalian cells. CHyMErA can also be applied for the perturbation of paralogous gene pairs thereby allowing the capturing of phenotypic roles that would otherwise be masked due to genetic redundancy. Here, we provide instructions for the cloning of hgRNA screening libraries and individual hgRNA constructs, and offer guidelines for designing and performing combinatorial pooled genetic screens using CHyMErA. Starting with the generation of Cas9 and Cas12a-expressing cell lines, CHyMErA screening can be implemented within 15-20 weeks.

Introduction

Advances in gene editing technologies have sparked unprecedented innovation in the field of functional genomics. In particular, the application of CRISPR (clustered regulatory interspaced short palindromic repeats) Cas (CRISPR-associated) technology affords the facile manipulation of diverse genomes with high target accuracy and minimal off-target effects^1–3. The development of CRISPR-Cas based genetic screening tools has prompted large-scale identification of genotype-to-phenotype relationships and the functional annotation of previously uncharacterized genes and genetic elements^4–9.

In many organisms, and especially in complex mammalian systems, many biological functions are not merely influenced by a single gene output but are controlled by gene regulatory processing events such as alternative splicing and polyadenylation as well as higher-order genetic networks. Although conventional single-gene-targeting Cas9-based genetic screening platforms have provided tremendous novel insights into diverse biological processes which are sensitive to single gene ablation^10–19, combinatorial targeting systems hold the potential to reveal epistatic relationships that impact phenotypes regulated by complex genetic networks^20–26. Furthermore, multiplexed targeting systems enable sizeable gene fragment deletions that can be used to uncover the functional role of individual exons, introns and untranslated regions (UTRs), many of which await functional annotation. This is of particular biomedical relevance given that recent transcriptome profiling studies have revealed widespread disruption of RNA processing events in diverse human diseases and disorders, and that the vast majority of them remains uncharacterized^27–30.

Central to the issue of elucidating genetic interactions and critical gene fragments is the development of tools that can deliver multiplexed genetic perturbations, which has been enabled by a rapidly increasing repertoire of available Cas nucleases³¹. Although Streptococcus pyogenes (Sp)Cas9 has served as the major work horse for genome editing in mammalian cells, orthogonal DNA-targeting nucleases from the Cas9 and Cas12a (formerly known as Cpf1)^32–34 families as well as RNA-targeting nucleases from the Cas13 family^35–37 are increasingly used for various genetic manipulations. In recent years, several combinatorial genetic screening platforms have been developed, including systems that employ the expression of multiple SpCas9 guides^{20,23,26,38–40}, systems employing orthologous Cas9 nucleases^22,41, and multiplexed Cas12a systems^25,42–45 (Box 1). While these technologies have been employed to reveal novel genetic interactions, many of the combinatorial Cas9 systems are limited by challenges including recombination between duplicated promoter regions and tracrRNAs, resulting in compromised editing efficiency^23,46–49.

Box 1: Combinatorial-targeting systems.

Over the last few years several CRISPR-Cas systems have been described that afford multiplexed genome targeting. Here we provide a brief overview of the available CRISPR combinatorial screening platforms, as shown in the figure in this box. Initially, several tools were developed that are based on the lentiviral delivery and expression of dual SpCas9 guides using two promoters. These are either combined with wild-type Cas9^23,26,39 or catalytically dead Cas9 enzymes fused with transcriptional modulators^20,24. More recently a plethora of additional options have emerged. The discovery of the Cas12a nuclease, and its ability to process its own pre-crRNA, enabled higher-order multiplexing applications using gRNA arrays expressed from a single promoter^32–34. While initial applications of Cas12a were characterized with reduced editing efficiency in mammalian cells compared to Cas9, recent permutations of Cas12a nucleases have resulted in variants with substantially increased editing efficiency^25,43,45,58.

More complex tools have employed orthogonal Cas nucleases for combinatorial editing. SpCas9 and SaCas9 have been co-expressed in mammalian cells for combinatorial editing either using catalytically active nucleases or dead Cas9 fused with different modalities^22,41. In addition, we have recently described CHyMErA, which is based on the co-expression of SpCas9 and LbCas12a, along with an hgRNA engineered by the fusion of Cas9 and Cas12a guides²¹. CHyMErA offers robust editing abilities while enabling numerous applications for multiplexed genome editing (Box 2). CHyMErA, similar to the orthologous Cas9 systems, is characterized by increased diversity of CRISPR elements (tracrRNAs and direct repeat) and thus reduced recombination potential. In addition, CHyMErA enables the expression of hgRNAs from a single U6 promoter, ensuring equal expression of guide components. Furthermore, CHyMErA and other systems employing the Cas12a nuclease are compatible with higher-order multiplexing of gRNAs.

Development of the protocol

To overcome these limitations, we have recently developed a novel combinatorial screening system, entitled Cas Hybrid for Multiplexed Editing and screening Applications (CHyMErA), employing co-expression of SpCas9 and Lachnospiraceae bacterium (Lb)Cas12a nucleases alongside a hybrid guide (hg)RNA that fuses Cas9 and Cas12a gRNAs under a single promoter²¹ (Fig. 1). Several characteristics of Cas12a make it attractive for use in combinatorial screening systems. In addition to DNA editing activity, Cas12a possesses intrinsic RNase activity allowing for the processing of multiplexed guide (g)RNA arrays^32–34. Furthermore, Cas12a does not require a long and structured tracrRNA but instead recognizes gRNAs via a short direct repeat (DR) sequence, thereby substantially reducing the length of gRNAs³². In the context of CHyMErA, these characteristics afford the expression of individual Cas9 and Cas12a guides from a single transcriptional unit following the liberation of the two gRNAs that can subsequently be loaded onto their respective nucleases. These features allow compact guide cassette design which minimizes recombination potential while at the same time ensuring equal transcription of the two gRNAs. Cas12a nucleases also display expanded PAM preferences (TTTV) compared to Cas9 (NGG), allowing for broader genome targeting compared to a single nuclease platform.

Figure 1. CHyMErA combinatorial genome editing platform.

The CHyMErA system is based on cell lines expressing nuclear SpCas9 and LbCas12a along with a hybrid guide (hg)RNA expression cassette. Hybrid guides RNAs consists of a fusion of Cas9 and Cas12a guide (g)RNAs and are expressed under a single U6 promoter. The hgRNA transcript is subsequently cleaved by Cas12a using its intrinsic RNA-processing activity, which recognizes the direct repeat (DR) sequence and cleaves upstream of it, thereby liberating functional Cas9 and Cas12a gRNAs that are loaded onto the respective nuclease for directed combinatorial genome editing.

Applications of the method

The CHyMErA system has been previously applied for the dual-targeting of single genes, the large-scale mapping of genetic interactions, and for exon-resolution functional genomics in mammalian cells²¹. These screens comprised both negative selection (dropout) as well as positive selection (enrichment) screening formats. In particular, we have shown that targeting individual genes with both Cas9 and Cas12a results in increased gene inactivation efficiency²¹. Therefore, dual-targeting CHyMErA libraries may allow researchers to perform screens with reduced numbers of guides and prove as a useful tool in screens where only a relatively small number of cells can be profiled, such as use in combination with single-cell RNA-Seq or fluorescence-activated cell sorting (FACS). The aptitude of CHyMErA in genetic interaction mapping was demonstrated by targeting over 650 paralogous gene pairs, which represents an almost exhaustive number of paralogs with only two members expressed across a panel of diverse human cell lines²¹. These screens revealed widespread genetic redundancy between paralogous gene pairs, uncovering phenotypic roles of paralogs that are typically masked in single-gene-targeting screens. Finally, CHyMErA has been used to target over 2,000 alternative cassette exons for deletion, identifying over 100 exons whose disruption results in cell fitness and proliferation defects²¹. A pooled dual-gene and paralog-targeting library (Addgene #155199) as well as an exon deletion hgRNA library (Addgene #155200) are available for use in conjunction with CHyMErA.

Besides the aforementioned applications and available libraries, CHyMErA can also be utilized to probe a diverse range of other genetic phenomena. Namely, the CHyMErA screening platform may be utilized for genomic fragment deletion screens targeting promoters, enhancers, UTRs, alternative polyadenylation sites, or non-coding RNAs (Box 2). In this manuscript we provide a step-by-step protocol for establishing Cas9/Cas12a-expressing cell lines, cloning customized CHyMErA libraries, and executing proliferation-based drop-out screens.

Box 2: Applications of the CHyMErA combinatorial screening platform.

CHyMErA represents an efficient and versatile system for the combinatorial perturbation of genetic sites in mammalian cells. Importantly, the Cas9 and Cas12a guides encoded within a hgRNA allow the programmed targeting of the two Cas nucleases to independent sites. The multi-targeting feature of CHyMErA facilitates various potential genome engineering applications which are described below and depicted in the following schematic figure:

1) Increased editing efficiency (dual-targeting of single genes): hgRNAs can be designed where both the Cas9 and Cas12a guide target the same gene, thereby achieving a higher perturbation efficiency and increasing the likelihood of generating a loss of function mutation. The elevated perturbation efficiency affords the capture of subtle phenotypes that would remain undetected with single-targeting systems²¹. At the same time, it also affords a reduction in the number of constructs per target, thereby allowing smaller library sizes. This is beneficial for applications where only a small number of cells can be profiled (e.g. complex phenotypic readouts or experimental systems).

2) Genetic fragment deletions: Besides perturbing a complete gene, CHyMErA can also be used to the study the role of individual gene segments such as alternative exons, polyadenylation sites, promoters, enhancers, UTRs, or other non-coding sections in the genome. To this end, hgRNAs can be programmed to target sites flanking a fragment of interest in order to excise it. It should be noted that for the successful deletion of an intervening genetic segment, the flanking target sites should be cut simultaneously, and the two break sites must be joined by endogenous DNA repair pathways. Hence, fragment deletions are more challenging to achieve compared to the introduction of multiple point mutations that can occur independently from each other. It is therefore key to use a combinatorial screening system with high editing efficiency for this application.

3) Genetic interaction mapping (combinatorial targeting of genes): Genetic interactions are deviations from predicted phenotypic outcomes following the simultaneous perturbation of two or more genes and can be observed as both synergistic and buffering relationships. The study of genetic interactions is a powerful approach to gain insight into the function and hierarchical organization of gene networks and pathways, uncover functional redundancy in the genome, and explore novel therapeutic targets. Towards this, hgRNAs can be programmed to target selected gene pairs. Phenotypic effects between single- and combinatorial-targeting of genes can subsequently be compared to identify genetic interactions. Through targeting of gene pairs in both orientations (i.e. gene A targeted by Cas9 and gene B targeted by Cas12a and vice versa) and subsequent selection for phenotypic outcomes that are confirmed in both orientations, CHyMErA enables robust classification of genetic interactions.

4) Targeting of paralogs along with single genes in genetic screens: Although related to genetic interaction mapping, we additionally want to highlight the application of CHyMErA screening libraries to include the combinatorial targeting of paralogs along with conventional single-gene-targeting constructs. The emergence of paralogous genes is widespread in higher organisms and the genetic redundancy helps ensure phenotypic robustness. However, the genetic buffering between paralogs limits detection of gene functions using single gene loss-of-function approaches^43,76. The combinatorial targeting of paralog gene families using CHyMErA can enable the detection of phenotypic changes that would otherwise be masked due to functional redundancy, and thereby uncover the functional importance of paralogs in systematic screens. A library that comprehensively targets paralogs that have only two members expressed across various human cell lines is available for use with CHyMErA.

5) Higher-order multiplexing: The Cas12a intrinsic RNA-processing activity can not only be exploited to cleave the hgRNA, liberating functional Cas9 and Cas12a gRNAs, but it can also be applied to processes further multiplexed Cas12a guides^33,34. This allows encoding of multiple Cas12a targets, along with one Cas9 target, in a single hgRNA that can be processed into individual Cas9 and Cas12a guides. We have previously shown that the CHyMErA system can be applied to efficiently multiplex up to four guides (one Cas9 and three Cas12a guides) encoded in a single hgRNA driven from a U6 promoter²¹. This property enables the systematic study of higher-order genetic interactions beyond gene pairs, perturbation of paralog families that comprise more than two members, or the interrogation of multiple genetic elements through parallel fragment deletions.

6) Future applications - Combination of multiple effector modules: Although CHyMErA is currently set up with active DNA-cleaving nucleases, it can be further developed to employ catalytically dead Cas nucleases (dCas) that can be fused to multiple effector domains. This may include the use of transcription activator or repressor domains, epigenetic modifiers, base editors, or fluorescent proteins. Importantly, the use of two nucleases (Cas9 and Cas12a) in the CHyMErA system permits the application of two different effector domains. This may enable more complex assays such as interrogating the effects of activating a set of genes with one nuclease (i.e. using CRISPRa system^{54–56,59,60}) while simultaneously inactivating (i.e. using CRISPRi system^54–57,60) a different set of targets with the second nuclease in the same cells or simultaneously applying multiple base editors (i.e. CBEs and ABEs^77,78) at distinct genetic sites. CHyMErA could thus be applied for introducing various genetic perturbations directed by hgRNAs within a single screening library or focused assay. Importantly, the use of catalytically dead Cas12a enzymes only impacts the DNA-cleavage domain and does not impair RNA-processing activity required for hgRNA processing³⁴.

Limitations

DNA damage

As seen in other combinatorial genome editing systems, a caveat of CHyMErA is that its application elicits two double stranded breaks (DSB) in the interrogated cell line. This may trigger target-independent toxicity in cell lines that are particularly sensitive to DNA damage. Of note, we have successfully performed CHyMErA screens in hTERT RPE-1 cells harboring wild-type TP53, despite such cells being described as sensitive to DNA damage elicited by CRISPR screens^50–53. Nevertheless, a transient reduction in cell proliferation may be observed upon combinatorial genome targeting for certain cell lines. Irrespective of the cell line, it is essential to control for non-target-specific DSB toxicity by designing negative control hgRNAs targeting intergenic regions rather than using non-targeting guides (see Experimental design and Box 3). Alternatively, for combinatorial gene targeting, CHyMErA can be used in combination with catalytically inactive Cas9 and Cas12a nucleases fused to transcriptional repressor (CRISPRi^54–57) or activator (CRISPRa^58–60) domains. In this setting, hgRNAs can be programmed to target dCas9 and dCas12a to promoters to perturb gene expression, eliminating the toxicity associated with DNA damage (Box 2).

Box 3: Design features for CHyMErA hybrid guide (hg)RNAs.

• For SpCas9, 20 nt long guides (spacers) that target a genomic protospacer region with a 3’-end NGG PAM site (N being any nucleotide) should be used. We also recommend incorporating established guide design rules for Cas9 including balanced GC content, depletion of Ts in the PAM-proximal regions, and modeling off-target effects^64,79–82.

• For LbCas12a, we recommend selecting 23 nt long spacers that target a genomic protospacer region with a TTTV PAM site at the 5’ end (V being any nucleotide other than T). We also recommend selecting guides with high on-target scores predicted to result in high editing efficiency as determined by CHyMErA-Net (https://github.com/BlencoweLab/CHyMErA-Net) or DeepCpf1 guide scoring algortithms^21,83.

• For both SpCas9 and LbCas12a we recommend selecting guides with high specificity scores, which in addition to the number of potential off-targets sites also take into account the position and nature of mismatched nucleotides⁸¹. This score has been shown to effectively remove confounding effects of promiscuous Cas9 gRNAs^84,85.

• hgRNA libraries are cloned using restriction digestion and hence final hgRNA constructs need to be filtered for harboring possible restriction enzyme cutting sites. When following the cloning procedure described in this protocol, avoid BfuAI/BspMI/BveI (ACCTGC) and BsmBI/Esp3I (CGTCTC) cut sites. Make sure to also exclude hgRNAs harboring the reverse complement of those cut sites (GCAGGT and GAGACG). Furthermore, avoid Cas9 guides ending with GCAG, which in combination with the adjacent Cas9 tracrRNA reconstitutes a BfuAI/BspMI/BveI site, or Cas12a guides ending with GCAGG, which in combination with the polyT generates a BfuAI/BspMI/BveI site as well.

• CHyMErA hgRNAs need to be designed in a coordinated fashion so that the Cas9 and Cas12a nucleases are simultaneously directed to specific sites in order to achieve the desired editing outcome. For gene inactivation, Cas9 and Cas12a gRNAs are designed to target exonic regions. Cleavage of those exonic sites by either of the two nucleases results in DSB that are repaired by the endogenous DNA repair machinery and often result in the introduction of insertions or deletions that change the reading frame which elicits gene inactivation. For excision of individual exons Cas9 and Cas12a gRNAs are designed to target intronic sequences flanking an exon of interest. Similarly, other genomic segments such as enhancers, promoters, protein domains, or polyA signals can be targeted through combinatorial genome editing up- and downstream of those elements. We recommend that, in the case of exon deletion, the targeted flanking regions should be at least 100 bp away from splice sites to avoid the introduction of DSB repair mutations which may interfere with the recognition of the splice sites.

• When designing CHyMErA libraries it is critical to control for on- and unintended off-target effects of each guide. To this end, we recommend for each hgRNA guide pair (i.e. Cas9 guide and Cas12a guide) to design single-targeting constructs whereby one of the two guides is replaced by a control guide targeting the intergenic space (i.e. guide that cuts DNA but is not expected to cause any specific fitness effect). This results in two additional hgRNAs that should be used to assess the single effect of each hgRNA component. The intergenic control sites should not be located in close proximity of any gene regulatory element to avoid unintended phenotypic effects in the event of deletions introduced in the course of DNA repair.

• Similarly, to differentiate between phenotypic effects stemming from fragment deletions vs. single cutting at either of the flanking sites, two ‘single-targeting’ control hgRNAs should be designed for each fragment deletion guide pair. These single-targeting controls direct only one of the two nucleases to the target site while the other nuclease should be programmed to target an unrelated intergenic site. Furthermore, to ensure robust detection of phenotypic effects multiple hgRNAs flanking a chosen target segment should be applied and designed in both orientations (Cas9 targeting upstream, Cas12a targeting downstream and vice versa).

• To compare gene vs. segment-specific phenotypic effects, for genic fragment deletions we recommend including hgRNAs disrupting the gene harboring the fragment of interest. This will reveal whether the targeted genic fragment plays an important role in gene function.

• It is recommended to design multiple hgRNAs for each targeted gene, gene combination or genetic element to control for potential guide off-target effects as well as differences in guide efficiencies.

• We recommend to always include a set of hgRNAs targeting reference core essential and non-essential genes in order to monitor screen performance⁶⁴. In proliferation-based screens, hybrid guides targeting core essential genes are expected to drop out over the course of the screen while non-essential genes should remain in the cell population. Similarly, the efficiency of gene segment deletions should be controlled by deleting frame-altering exons in reference core essential and non-essential genes which is expected to result in inactivation of targeted genes. Accordingly, similar controls should be implemented for other phenotypic read-outs.

Relatively low efficiency of gene fragment deletion

As described in Box 2, the CHyMErA platform can be applied for a variety of combinatorial editing purposes such as dual-targeting of single genes, combinatorial targeting of gene pairs or genetic fragment deletions. Each of these applications may bring their own technical challenges. For example, the introduction of insertions or deletions for the knockout of targeted genes may occur in an independent manner by Cas9 or Cas12a, while for deletion of a genetic fragment, two cuts need to occur in a timely coordinated fashion for the intervening segment to be excised. Accordingly, the latter application may be more challenging to execute and requires higher editing activity than the simple introduction of a knockout mutation.

Despite CHyMErA being one of the most efficient current tools for systematic gene segment deletions in a screening format, the platform still suffers from high false negative rates, indicating that the deletion efficiency remains relatively low²¹. Increasing the number of hgRNAs that target specific segments and applying guide prediction scores have helped distinguish noise from signal in the past²¹. It is also important to include a plethora of positive and negative control guides to assess gene fragment deletion and performance of each screen (Box 3).

Intermolecular recombination of hgRNAs

During lentiviral packaging, a common problem is the intermolecular recombination between library elements, which occurs due to template switching of the lentiviral reverse transcriptase and results in the shuffling of variable elements^47,61. This is particularly important in the context of combinatorial screening since pre-determined guide combinations can be uncoupled during lentiviral packaging. In proliferation-based drop-out screens this can be easily mitigated by filtering out reshuffled guide pairs during data analysis. However, this comes at the cost of “throwing out” 20% of sequencing reads. Alternative approaches, such as diluting the plasmid library with a carrier plasmid have also been described but these result in reduced viral titers and thus are difficult to implement in genome scale screens⁶². Another source for intermolecular recombination may be template switching by DNA polymerases during PCR reactions⁶³. Although the distance between the hgRNA guide sequences, and thereby the risk of shuffling of paired sequence elements, is rather low, it is recommended to minimize the number of PCR cycles during library oligo amplification and preparation of sequencing libraries.

Experimental design

Generation of mammalian cell lines that stably express SpCas9 and LbCas12a (Steps 1-20)

The first step for CHyMErA implementation is the generation of a cell line that stably expresses Cas9 and Cas12a (Fig. 2). We have previously shown that LbCas12a is more efficient than AsCas12a in the context of CHyMErA screens, and hence this protocol focuses on the application of SpCas9 and LbCas12a nucleases²¹. The transduction of SpCas9 and LbCas12a should be performed sequentially to avoid stressing the cell line through double antibiotic selection. The cells are transduced and selected as a bulk population as described in Steps 11-16. While we observed a benefit in selecting a clonal SpCas9 line, we have found that a clonal line for LbCas12a expression is not necessary for successful screening. However, depending on the cell line, generation of clonal lines may be beneficial (Steps 1-20).

Figure 2. Experimental workflow of CHyMErA screens.

First, cell lines are engineered to express SpCas9 and LbCas12a using sequential transduction with lentivirus carrying expression cassettes for SpCas9-NLS-BlastR and LbCas12a-2xNLS-G418R. In parallel, pooled hgRNA libraries are designed and cloned into a lentiviral backbone. Cas9/Cas12a expressing cells are then transduced with the lentiviral hgRNA library at a low multiplicity of infection (MOI) to promote single integration of hgRNAs per cell. The hgRNAs will program the two nucleases for directed combinatorial genome editing and cells can be screened for various phenotypic readouts including proliferation or marker-based cell sorting. Genomic DNA is extracted from the cell pool at the start, intermediate (optional), and end time point of the screen. HgRNA barcodes are amplified by PCR and subjected to sequencing library preparation. Next-generation sequencing (NGS) is used to determine hgRNA barcode abundance over time in order to determine guides that are enriched or depleted in a given pool of cells. The sequencing data is subsequently analyzed and scored using available tools such as Orthrus⁶⁵ in order to prioritize hits for validation and further follow-up analysis.

Cell line characterization and assessment of CHyMErA editing efficiency (Steps 21-22A, B)

After generation of SpCas9/LbCas12a cells, the cell line should be characterized for nuclear expression of the nucleases and combinatorial editing efficiency. Nuclease expression can be assessed by western blotting (Step 21, Fig. 3a). For assessing combinatorial editing efficiency, we propose two assays (Steps 22 A, B). The first method (Step 22A) employs the monitoring of exon deletion in the human HPRT1 gene by targeting SpCas9 and LbCas12a to intronic sequences flanking exon_2 or exon_3 (Fig. 3b). In the second assay (Step 22B), combinatorial editing efficiency is assessed through the monitoring of SpCas9 and LbCas12a-mediated gene disruption of the TK1 and HPRT1 genes, respectively, which results in resistance to thymidine block and 6-thioguanine treatment (Fig. 3c). Alternatively, the user may choose to establish a custom-made assay by cloning hgRNAs targeting gene pairs or genetic segments whose perturbation or deletion may be assayed on a DNA (by PCR or sequencing), RNA (by RT-PCR), protein (by western blotting, immunofluorescence or flow cytometry), or other phenotypic level (e.g. cell viability or reporter assay).

Figure 3. Anticipated results for Cas9/Cas12a cell line characterization, hgRNA cloning, sequencing library production and screen performance assessment.

a, Western blot analysis of Cas9, Myc-Cas12a and Tubulin across HAP1 and RPE-1 wild type (WT), Cas9-, or Cas9- and Cas12a-expressing cells as indicated. Asterisk indicates non-specific signal. b, PCR monitoring of HPRT1 exon deletion in HAP1 and RPE-1 cells stably expressing Cas9 and Cas12a. Cells were transduced with independent lentiviral hgRNA constructs targeting sites flanking HPRT1 exon 2 or exon 3 (guides 2.1 and 3.1) or an intergenic control site (Con) as indicated. The percentage of exon deletion is indicated below the agarose gel. c, Assessment of combinatorial editing efficiency by drug resistance assay and western blotting²¹. HAP1 cells expressing Cas9 and Cas12a were transduced with lentiviral hgRNA constructs concurrently targeting TK1 (Cas9 gRNA) and HPRT1 (Cas12a gRNA) or a control site (Con), respectively. To assay combinatorial editing efficiency cells were either control-treated or challenged with 250 μM thymidine or 6 μM 6-thioguanine. TK1 and HPRT1 process these two compounds into cytostatic or toxic products, respectively. However, when the two genes are knocked out, thymidine and 6-thioguanine do not impact cell survival and proliferation. Cell viability was measured by AlamarBlue staining 4 d post treatment and normalized to the control. Bars indicate mean ± s.d. of three independent biological replicates (left panel). Western blot was performed to detect HPRT1 levels, and β-actin was used as a loading control (right panel). d, Agarose gel showing undigested, partially digested, completely digested and gel extracted pLCHKO vector backbone. Note that the properly digested pLCHKO backbone to be extracted is 7,500 bp, and the stuffer sequence fallout of 1,870 bp should also be visible on the gel. e, Agarose gel depicting products from the amplification of library DNA oligos or a control reaction with no oligos (Con). 5 μL of the PCR products and non-amplified 1μM library DNA oligo input were resolved on a 2.5% agarose gel to visualize the size shift following extension of the DNA oligo sequences during the PCR reaction. f, Agarose gels depicting sequencing library PCR1 and PCR2 products. Note that in addition to the anticipated 660bp PCR1 product, the genomic DNA (gDNA) input will also be visible at the top of the gel. The anticipated PCR2 product is ~340 bp but larger products amplified by leftover PCR1 primers in combination with PCR2 primers will also be generated. Thus, it is important to carefully resolve the PCR2 product on a 2% agarose gel in order to avoid extracting any of the larger intermediate products or leftover primers. g, Published screening data showing the depletion of single- versus dual-targeting hgRNAs perturbing core essential genes, other genes (non-core essentials), or intergenic sites in HAP1 cells with either Cas9 (blue), Cas12a (orange) or both nucleases (yellow) (T18)²¹. Boxes show IQR, 25th to 75th percentile, with the median indicated by a horizontal line. Whiskers extend to the quartile ±1.5 × IQR. Subsets were compared using two-tailed Mann–Whitney U-tests. hgRNA guides per group: 3,310 (Cas9 exonic–Cas12a exonic), 1,148 (Cas9 exonic–Cas12a intergenic) and 1,676 (Cas9 intergenic–Cas12a exonic) targeting core essential genes; 25,578 (Cas9 exonic–Cas12a exonic), 8,753 (Cas9 exonic–Cas12a intergenic) and 12,874 (Cas9 intergenic–Cas12a exonic) targeting other protein-coding genes; and 4,993 (Cas9 intergenic–Cas12a intergenic) controls.

Using an existing screening library (Steps 23-33)

We have previously described two CHyMErA screening libraries that are available through Addgene which can be amplified using a relatively simple protocol. These existing libraries can be applied for combinatorial targeting of human paralogs, dual-targeting of single genes, or for deletion of selected human alternative cassette exons. The Paralog & Dual-targeting hybrid guide RNA Library (Addgene # 155199) targets human paralog pairs with single- and combinatorial-targeting hgRNAs, and can be used to uncover phenotypes which are potentially masked by paralogous gene pairs. The library also contains single- and dual-targeting (i.e. with both Cas9 and Cas12) hybrid guides that target ~5,000 highly expressed genes, permitting capture of single-gene ablation phenotypes with increased sensitivity. The Exon-deletion hgRNA Library (Addgene # 155200) targets ~2,000 human alternative cassette exons for excision and also includes guides that knockout alternative exon-containing genes, allowing the investigation of the phenotypic role of these alternative exons.

Cloning of hybrid guide (hg)RNAs into pLCHKO vector (Steps 34-70A, B, C)

To construct and amplify pooled hgRNA libraries, we designed a streamlined, two-step cloning process involving two rounds of Golden Gate assembly into the pLCHKO lentiviral vector (Steps 36-69). We also provide a protocol describing the generation of new customized libraries (Steps 34-35). In the first step of the two-step cloning process, DNA oligos comprising the SpCas9 and LbCas12a spacer sequences are ligated into the pLCHKO backbone (Steps 36-60). Following digestion of the first ligation product (Steps 61-62), the Cas9 tracrRNA and Cas12a DR scaffolds are introduced (Steps 63-69), completing the cloning of the hgRNA expression cassette (Fig. 4). Besides guidelines for the cloning of screening libraries, we also provide a detailed protocol for the focused cloning of individual hgRNAs into the pLCHKO vector backbone using three different approaches (Step 70A, B, C). While the possible applications of CHyMErA are diverse, we provide general recommendations for hgRNA design (Box 3) and highlight below critical controls that must be built into customized libraries to assess the effects of individual guides as well as to monitor screen performance.

Figure 4. Hybrid guide (hg)RNA cloning process.

Hybrid guide RNA libraries are in silico designed and commercially synthesized as a pooled single-stranded DNA oligo library carrying the desired Cas9 and Cas12a spacer combinations. The oligo pool is converted into double stranded DNA by PCR using the TKO_F1 and TKO_R1 primers. In the first of two Golden Gate assembly reactions, the library is digested with BfuAI/BveI and ligated into the pLCHKO vector digested with the same enzyme. In the second Golden Gate assembly, the ligation 1 product along with a TOPO vector carrying the Cas9 tracrRNA and Cas12a direct repeat (DR) are digested with Esp3I/BsmBI and the tracrRNA/DR segment is ligated into the pLCHKO vector. This completes the generation of a functional hgRNA expression cassette, flanked by lentiviral long terminal repeats (LTR) and a puromycin resistance genes (PuroR).

Recommended controls for screening libraries and focused experiments

To monitor screen performance and control for combinatorial activity of the CHyMErA system we recommend including the following control hgRNA categories in screening libraries or focused experiments. The number of these controls may vary from 1-2 controls for focused experiments to several hundred for screening libraries. Below we describe 3 critical hgRNA control categories. Further recommendations and considerations for the design of hgRNAs can be found in Box 3.

1) Dual-cutting controls: to assess guide-independent toxicity due to DNA-damage response triggered by the dual cutting of DNA by Cas9 and Cas12a nucleases we recommend including hgRNAs in each experiment that target intergenic regions. The two guides may target the same or different chromosomes. In a typical screening library, we recommend including ~1% of such dual-cutting controls.

2) Single-targeting controls: to determine the phenotypic effects of individual guides it is important to include single-targeting controls for each guide pair. To this end, for each guide pair, two single-targeting controls should be designed whereby one of the two guides is replaced with a control guide targeting an intergenic region. These single-targeting controls are necessary to determine genetic interactions (i.e. deviation from predicted combinatorial effect calculated based on single-targeting of genes) but are also necessary to differ between phenotypic effects triggered by fragment deletions vs. single cutting at either of the flanking sites of a genetic element. It should be noted that these single-targeting controls will make up a significant portion of a screening library (i.e. for each combinatorial-targeting hgRNA two single-targeting controls are recommended).

3) Screen performance controls: besides the above-mentioned constructs required to control for DNA-damage and guide-specific effects, we strongly recommend including guides that allow the monitoring of screen performance. A typical control set will include guides that target sets of core essential and non-essential genes⁶⁴, which over the course of the screen are expected to dropout or remain in the surviving cell population, respectively. The control set can be further expanded or customized based on the specific experimental system and phenotype used for CHyMErA screens (i.e. cell-type specific essential genes or known regulators of a reporter construct). Importantly, given the use of two nucleases we recommend targeting those control genes with Cas9 and Cas12a individually (i.e. second nuclease targeting intergenic space) and in combination to monitor the activity of both nucleases. To assess gene fragment deletion efficiency, we recommend including guide pairs resulting in the deletion of frame-altering exons in essential and non-essential genes. Collectively, these controls will allow the monitoring of individual and combinatorial Cas9 and Cas12a editing efficiencies through determining dropout or enrichment of positive control hgRNAs.

Performing CHyMErA screen (Steps 71-148)

Hybrid guide libraries are packaged into lentiviral particles (Steps 71-80) and transduced into Cas9 and Cas12a-expressing cells at a low multiplicity of infection (MOI) to promote integration of single hgRNAs per cell (Steps 85-98). Following selection of transduced cells the cell pool is split into replicates that are serially passaged over ~15 cell doublings (2-3 weeks) at a >250-fold library coverage (Steps 99-107). It is critical to plan a screen thoughtfully and fully assess the phenotypic readout, suitability of cell lines, cell doubling times, potential growth substrates, and media conditions from a biological perspective while also taking the available infrastructure and resources into consideration. A minimum representation of 250 cells for each library element is recommended for dropout screens. For example, if using a 90k library, a minimum of 22.5 million cells should be maintained throughout each step of the screen. For a MOI of ~0.3, 75 million cells should be used during hgRNA library transduction resulting in successful infection of 22.5 million cells. Following the selection of transduced cells, a minimum of 22.5 million cells should be passaged at every time point and collected for gDNA extraction to assess drop-out or enrichment of hgRNAs. In general, we recommend ~15-20 doublings to allow for sufficient guide depletion or enrichment within a cell pool in order to capture genes and genomic loci whose perturbation might result both in stronger and weaker phenotypes. However, the number of doublings required depends on the biological question asked. Although it may be tempting to extend the length of screens to capture as many hits as possible, the caveat of high doubling numbers is the loss of dynamic range, the accumulation of noise and the increased cost and time required to culture cell populations. Based on our experience, ~15-20 cell doublings result in an optimal signal-to-noise ratio, but earlier and later time points may be analyzed as well.

During the screen (Steps 81-107), a fraction of cells from the starting, end, and optional intermediate time points are collected for genomic (g)DNA extraction (Steps 108-125). Hybrid guide RNA sequences are subsequently amplified and barcoded by PCR and subjected to next-generation sequencing (NGS) on Illumina sequencing platforms (Steps 126-140, Fig. 5). We recommend PCR amplification of hgRNA cassettes from a 100-fold cell coverage followed by high-throughput NGS corresponding to a minimum 200-fold coverage of each hgRNA cassette (preferentially 400-fold for the starting time point). These requirements should be taken into consideration while designing and planning the screen since this will dictate the time and resource investment required for the successful completion of the screen.

Figure 5. Generation of NGS sequencing libraries.

After extraction of genomic (g)DNA from collected screen samples, sequencing libraries amenable for Illumina next generation sequencing (NGS) are generated using a nested PCR approach. First, the lentivirally integrated hgRNA expression cassette is amplified by PCR using ‘outer’ PCR primers in parallel PCR reactions (PCR1) in order to achieve sufficient hgRNA coverage. The PCR1 reactions are then pooled and a fraction of the product is subjected to a second PCR reaction (PCR2) in which i5 and i7 indices (magenta) as well as Illumina TruSeq sequencing adapters (brown and purple) are attached to the hgRNA barcode. In addition, stagger sequences (green) are introduced to maintain the sequence diversity at each imaging cycle by shifting apart constant sequences between each sample. The dashed purple lines indicate the sequencing primers used for reading the i5 and i7 indices, which allow for pooling of multiple sequencing libraries in a single NGS round using an Illumina NextSeq 500 or a NovaSeq 6000 machine. The generated NGS data can be demultiplexed using the i5 and i7 index combinations and the data from individual screening time points can be analyzed for depletion and enrichment of specific hgRNAs.

Downstream high-throughput analysis of genomics data is then applied to identify enriched and depleted hgRNAs over time in a treatment group or sorted subpopulations (Steps 141-148). An accompanying protocol provides detailed instructions for analyzing the sequencing data, including genetic interaction scoring⁶⁵.

Primer design for generation of NGS libraries

CRISPR-based genetic screens are ultimately based on the detection of gRNAs in cell populations of interest that have been stably integrated through lentiviral transduction. NGS libraries of hgRNA cassettes are prepared in two steps: in the first PCR reaction (PCR 1), the hgRNA expression cassettes are amplified from the genomic DNA and in the second PCR (PCR 2), Illumina TruSeq adapters with i5 and i7 indices are added (Fig. 5). In addition, we also recommend including short stagger regions of varying length in the PCR2 primers (Table 1 and example given below). These staggers are absolutely required if there is no option to run dark cycles (i.e. base additions without imaging) during Illumina sequencing. The stagger regions will maintain the sequence diversity across the flow-cell at each imaging cycle by shifting apart constant sequences between each sample. Staggered primers can also be used in combination with dark cycles to increase sequence diversity when reading beyond the spacer sequence reaching the constant Cas9 tracrRNA and Cas12a direct repeat sequences. We thus recommend to always include stagger regions independently of the running mode. Stagger regions should be introduced right before the primer sequence annealing to the hgRNA expression cassette as outlined below. We additionally recommend varying the length of the stagger region from 0 to 5 bases (N refers to the i5/i7 barcodes, S refers to the staggered region, lower case indicates annealing sequence):

TruSeq i5 forward primer (annealing to end of U6 promoter):

AATGATACGGCGACCACCGAGATCTACAC[NNNNNNNN]ACACTCTTTCCCTACACGACGCTCTTCCGATC T[S]ccgaggggacccagagaattc

TruSeq i7 reverse primer (annealing downstream of transcription termination sequence):

CAAGCAGAAGACGGCATACGAGAT[NNNNNNNN]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT[S]gtggaaaggacgaggtaccg

Table 1:

Primers

Name	Sequence	Protocol step
HPRT1_exon2_F	GAATACCCGTATGTTCATCACCC	22A iv
HPRT1_exon2_R	GTGATTCAGCCCCAGTCCAT	22A iv
HPRT1_exon3_F	AACCTGCCAGTCTGATAGGTG	22A iv
HPRT1_exon3_R	CGCCAATACTCTAGCTCTCCA	22A iv
U6_fwd	GACTATCATATGCTTACCGT	47, 51, 70A xi, 70A xvii, 70C ix
TKO_F1	TGTCAGTTGTCATTCGCGAAAAAGAGAACCTGCAGAGACC	41
TKO_R1	GTCACTGACGCGGTTTTGTAGATCTCTACCTGCCTCTAAA	41
PCR1_Hybrid_Outer_F2	TGAAGAATCGCAAAACCAGCA	127
PCR1_Hybrid_Outer_R1	GAGGGCCTATTTCCCATGATTC	127
A701-Cas9-R1	CAAGCAGAAGACGGCATACGAGATATCACGACGTGACTGGAGTTC AGACGTGTGCTCTTCCGATCTGTGGAAAGGACGAGGTACCG	131
A703-Cas9-R2	CAAGCAGAAGACGGCATACGAGATCAGATCCAGTGACTGGAGTTC AGACGTGTGCTCTTCCGATCTCAGGTGGAAAGGACGAGGTACCG	131
A702-Cas9-R3	CAAGCAGAAGACGGCATACGAGATACAGTGGTGTGACTGGAGTTC AGACGTGTGCTCTTCCGATCTGCAGGTGGAAAGGACGAGGTACCG	131
A708-Cas9-R1	CAAGCAGAAGACGGCATACGAGATCACCACACGTGACTGGAGTTC AGACGTGTGCTCTTCCGATCTGTGGAAAGGACGAGGTACCG	131
A709-Cas9-R2	CAAGCAGAAGACGGCATACGAGATGAAACCCAGTGACTGGAGTTC AGACGTGTGCTCTTCCGATCTCAGGTGGAAAGGACGAGGTACCG	131
A712-Cas9-R3	CAAGCAGAAGACGGCATACGAGATAGGAGTGGGTGACTGGAGTTC AGACGTGTGCTCTTCCGATCTGCAGGTGGAAAGGACGAGGTACCG	131
A704-Cas9-R1	CAAGCAGAAGACGGCATACGAGATACAAACGGGTGACTGGAGTTC AGACGTGTGCTCTTCCGATCTGTGGAAAGGACGAGGTACCG	131
A710-Cas9-R2	CAAGCAGAAGACGGCATACGAGATTGTGACCAGTGACTGGAGTTC AGACGTGTGCTCTTCCGATCTCAGGTGGAAAGGACGAGGTACCG	131
D724-Cas9-R3	CAAGCAGAAGACGGCATACGAGATGCGATTAAGTGACTGGAGTTC AGACGTGTGCTCTTCCGATCTGCAGGTGGAAAGGACGAGGTACCG	131
A502-Cas12a-F1	AATGATACGGCGACCACCGAGATCTACACTGCTAAGTACACTCTT TCCCTACACGACGCTCTTCCGATCTCCGAGGGGACCCAGAGAATT C	131
A505-Cas12a-F2	AATGATACGGCGACCACCGAGATCTACACCTAATCGAACACTCTT TCCCTACACGACGCTCTTCCGATCTGCCGAGGGGACCCAGAGAAT TC	131
A506-Cas12a-F3	AATGATACGGCGACCACCGAGATCTACACCTAGAACAACACTCTT TCCCTACACGACGCTCTTCCGATCTCGCCGAGGGGACCCAGAGAA TTC	131
A507-Cas12a-F1	AATGATACGGCGACCACCGAGATCTACACTAAGTTCCACACTCTT TCCCTACACGACGCTCTTCCGATCTCCGAGGGGACCCAGAGAATT C	131
A508-Cas12a-F2	AATGATACGGCGACCACCGAGATCTACACTAGACCTAACACTCTT TCCCTACACGACGCTCTTCCGATCTGCCGAGGGGACCCAGAGAAT TC	131
D505-Cas12a-F3	AATGATACGGCGACCACCGAGATCTACACAGGCGAAGACACTCTT TCCCTACACGACGCTCTTCCGATCTCGCCGAGGGGACCCAGAGAA TTC	131
A504-Cas12a-F1	AATGATACGGCGACCACCGAGATCTACACTAAGACACACACTCTT TCCCTACACGACGCTCTTCCGATCTCCGAGGGGACCCAGAGAATT C	131

Importantly, when introducing stagger regions, the sequencing strategy should be adjusted by increasing the read length during Illumina sequencing. In addition to adding stagger regions, the sequence diversity across the flow-cell can be further increased by using primers in reversed orientation (i.e., the i5 forward primer binds to the U6 promoter and the i7 reverse primer binds to the transcription termination region).

Alternative phenotypic screening read-outs

CHyMErA screens can be coupled to various phenotypic readouts. Arguably one of the most popular type in functional genomics are cell viability and proliferation screens for genes or genetic segments that impact on cell fitness (for example^11,66–71). Fitness screens may be performed on their own, combined with a drug treatment, or conducted under various environmental conditions in order to identify genes or genetic segments whose perturbation may sensitize or buffer cells to a particular treatment or condition (for example^16,19,59,72). Another powerful phenotypic readout could be the expression of a certain endogenous marker or exogenous reporter constructs that may be indicative for a specific cell stage or pathway activity (Fig. 2). Depending on the type of marker and sorting type, antibody staining may be required to allow for the sorting of subpopulations with increased or reduced marker expression using fluorescence, magnetic, or microfluidic-based cell sorting (for example^10,15,73,74). Some of these sorting strategies may be costly, require advanced facility booking and careful planning of the screening strategy and timeline.

Expertise needed to implement the protocol

The protocol described here can be executed by experienced graduate and post-doctoral researchers. Basic molecular biology and mammalian cell culture expertise is necessary for CHyMErA library cloning, screen performance, and the generation of sequencing libraries. Access to an Illumina sequencing platform (e.g. NextSeq 500 or NovaSeq 6000) is required for generating screening data. Advanced computational expertise is required for guide library design while basic proficiency in R programming is sufficient for sequencing data analysis using available scoring tools such as Orthrus⁶⁵ and MAGeCKFlute⁷⁵.

Materials

REAGENTS:

Plasmids

• pMDG.2 (https://www.addgene.org/12259/): VSV-G envelope expressing plasmid

• psPAX.2 (https://www.addgene.org/12260/): 2nd generation lentiviral packaging plasmid. Can be used with 2nd or 3rd generation lentiviral vectors and envelope expressing plasmid

• Lenti-Cas9-2A-Blast (https://www.addgene.org/73310/): lentiviral expression construct for human codon-optimized N-terminal FLAG-tagged Streptococcus pyogenes (Sp)-Cas9 nuclease with C-terminal NLS and Blasticidin S resistance

• plenti-Lb-Cas12a-2xNLS (https://www.addgene.org/155046/): Lentiviral expression construct for human codon-optimized C-terminal Myc-tagged Lachnospiraceae bacterium (Lb)-Cas12a nuclease with N- and C-terminal NLS (SV40 and nucleoplasmin, respectively) and Neomycin/G418/Geneticin resistance

• pLCHKO (https://www.addgene.org/155048/): Lentiviral backbone for cloning and expressing U6 driven hybrid guide (hg)RNAs with BfuAI cloning sites and puromycin selection.

• Topo_SpCas9.tracr_LbCas12a.DR (https://www.addgene.org/155049/): TOPO vector for the cloning of the SpCas9 tracrRNA - LbCas12a Direct Repeat (DR) fragment into the pLCHKO hgRNA vector

• CHyMErA Paralog & Dual-targeting hgRNA pooled library (Addgene no. 155199) (https://www.addgene.org/pooled-library/moffat-blencowe-chymera/): The Paralog & Dual-targeting hybrid guide RNA Library targets human paralogous gene pairs with both single- and combinatorial-targeting hgRNAs. The library also contains single- and dual-targeting hgRNAs targeted towards the ~5,000 highest expressed genes across a panel of widely used human cell lines.

• CHyMErA Exon-deletion hgRNA pooled library (Addgene no. 155200) (https://www.addgene.org/pooled-library/moffat-blencowe-chymera/): The Exon-deletion hgRNA Library targets for deletion ~2,100 human alternative cassette exons.

• pLCHKO_HPRT1_exon2_1_Lb (https://www.addgene.org/155051/): Lentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and LbCas12a nucleases

• pLCHKO_HPRT1_exon3_1_Lb (https://www.addgene.org/155053/): Lentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and LbCas12a nucleases

• pLCHKO_TK1_HPRT1_Lb_1 (https://www.addgene.org/155059/): Lentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting TK1 using SpCas9 and HPRT1 using LbCas12a

• pLCHKO_intergenic-intergenic_1 (https://www.addgene.org/155077/): Lentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting two intergenic sites in the human genome

• pLCHKO_intergenic-intergenic_2 (https://www.addgene.org/155078/): Lentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting two intergenic sites in the human genome

hgRNA cloning

• DNase/RNase-free Distilled water (Thermo Fisher Scientific, cat. no. 10977015)

• FastDigest Esp3I (Thermo Fisher Scientific, cat. no. FD0454)

• FastDigest BveI (Thermo Fisher Scientific, cat. no. FD1744)

• BfuAI (New England Biolabs, cat. no. R0701S)

• BsmBI (New England Biolabs, cat. no. R0739S)

• DL-Dithiothreitol solution (DTT; 1 M, Sigma Aldrich, cat. no. 646563-10X.5ML)

  CAUTION: DTT is toxic and may cause skin, eye, or respiratory irritation. Wear protective equipment.

• T4 polynucleotide kinase (T4 PNK; New England Biolabs, cat. no. M0201)

• T4 DNA ligase (New England Biolabs, cat. no. M0202)

• Shrimp Alkaline Phosphatase (rSAP; New England Biolabs, cat. no. M0371S)

• Q5 High-Fidelity DNA Polymerase (New England Biolabs, cat. no. M0491S)

• TE Buffer (10 mM Tris-HCl, pH 7.5- 8.0, 1 mM EDTA; Thermo Fisher Scientific, cat. no. 12090015)

• Deoxynucleotide (dNTP) Solution Mix (New England Biolabs, cat. no. N0447S)

• Ethanol, absolute (Sigma Aldrich, cat. no. E7023-500ML)

  CAUTION: Ethanol is flammable. Keep away from heat and open flames.

• Sodium acetate buffer solution (NaAc; 3M, Sigma Aldrich, cat. no. S7899-100ML)

• Pellet Paint NF Co-Precipitant (Sigma Aldrich, cat. no. 70748-3)

• PCR purification kit (Thermo Fisher Scientific, cat. no. K0701)

• Gel extraction kit (Thermo Fisher Scientific, cat. no. K0691)

• Lucigen endura electro competent cells (Lucigen, cat. no. 60242-2)

  CRITICAL: High-efficiency competent cells reduce the number of electroporations required for obtaining sufficient gRNA library representation. It is also critical to use competent cells suitable for the propagation of lentiviral vectors.

• S.O.C. medium (Thermo Fisher Scientific, cat. no. 15544034)

• LB Agar Lennox (Sigma Aldrich, cat. no. L2897-250G)

• Carbenicillin disodium salt (Sigma Aldrich, cat. no. C3416)

• Plasmid Miniprep or Midiprep kit (Thermo Fisher Scientific, cat. nos. K210003, K210004)

• Plasmid Maxiprep or Megaprep kit (Thermo Fisher Scientific, cat. nos. K210006, K210008XP)

• Stbl3 chemically competent cells (for focused colony validation; Thermo Fisher Scientific, cat. no. C737303)

  CRITICAL: Recombination-deficient competent cells such as Stbl3 cells are required to avoid recombination of the lentiviral vector backbone.

Gel electrophoresis

• Tris-acetate-EDTA buffer (TAE; Thermo Fisher Scientific, cat. no. B49)

• Agarose (Thermo Fisher Scientific, cat. no. 16500500)

• SYBR Safe DNA gel stain (Thermo Fisher Scientific, cat. no. S33102)

• GeneRuler 1kb Plus DNA ladder (Thermo Fisher Scientific, cat. no. SM1331)

• 6x DNA loading dye (Thermo Fisher Scientific, cat. no. R0611)

• Hydrochloric acid (HCl; Sigma Aldrich, cat. no. 320331)

  CAUTION: HCl causes skin burns and eye damage. Wear protective equipment when handling HCl.

Exon deletion assay

• Kapa HiFi HotStart ReadyMix (Roche, cat. no. KK2601)

  CRITICAL: PCR conditions described in this section have been optimized for Kapa polymerase and we noticed that other polymerases do not work well in combination with the provided primers.

• Genomic DNA purification kit (Thermo Fisher Scientific, cat. no. K0721)

6-thioguanine and thymidine toxicity assay

• 6-thioguanine (Sigma Aldrich, cat. no. A4882-250MG)

• Thymidine (Thermo Fisher Scientific, cat. no. T1895-5G)

• AlamarBlue (Thermo Fisher Scientific, cat. no. DAL1100)

Antibodies for western blotting and immunofluorescence

• M2 Anti-FLAG (Sigma Aldrich, cat. no. F3165, http://antibodyregistry.org/AB_259529, RRID:AB_259529)

• Anti-Myc (Sigma Aldrich, cat. no. M4439, http://antibodyregistry.org/AB_439694, RRID:AB_439694)

• Anti-SpCas9 antibody (Diagenode, cat. no. C15200229, https://antibodyregistry.org/search.php?q=AB_2889848, RRID:AB_2889848)

• Anti-LbCpf1/Cas12a (Sigma Aldrich, cat. no. SAB4200777, https://antibodyregistry.org/search.php?q=AB_2889872, RRID:AB_2889872)

Tissue culture

• HEK 293T/17 cells (American Type Culture Collection, CRL-11268)

• DMEM media, high glucose, sodium pyruvate (Thermo Fisher Scientific, cat. no. 11995073)

• DPBS (Thermo Fisher Scientific, cat. no. 14190250)

• Fetal bovine serum (FBS; Thermo Fisher Scientific, cat. no. 16140071)

• Penicillin Streptomycin solution (Pen/Strep; Thermo Fisher Scientific, cat. no. 15140122)

• Trypsin 0.25% EDTA (Thermo Fisher Scientific, cat. no 25200114)

• OptiMEM (Thermo Fisher Scientific, cat. no. 31985062)

• X-tremeGENE 9 (Sigma Aldrich, cat. no. XTG9-RO)

• Bovine Serum Albumin, heat shock fraction (BSA; Sigma Aldrich, cat. no. A9647-100G)

• Hexadimethrine bromide (Polybrene; Sigma Aldrich, cat. no. H9268-10G)

• Blasticidin S HCl (Thermo Fisher Scientific, cat. no. A11139-03)

• Geneticin/G418 (Thermo Fisher Scientific, cat. no. 10131035)

• Puromycin Dihydrochloride (Thermo Fisher Scientific, cat. no. A1113802)

• e-Myco Plus Mycoplasma PCR Detection Kit (Bulldog Bio, cat. no. 25237)

• Bleach solution (Fisher Scientific, cat. no. 50156261)

  CAUTION: Sodium hypochlorite/bleach solution causes skin burns and eye damage. Wear protective equipment when handling bleach.

Genomic DNA extraction

• Wizard Genomic DNA Purification Kit (Promega, cat. no. A1120)

• TE Buffer (10 mM Tris-HCl, pH 7.5 or 8.0, 1 mM EDTA; Thermo Fisher Scientific, cat. no. 12090015)

• Proteinase K (New England Biolabs, cat. no. P8107S) (needed for paraformaldehyde-fixed cells only)

• RNaseA, 20 mg/mL (Thermo Fisher Scientific, cat. no. 12091021)

• 2-Propanol (Isopropanol; Sigma Aldrich, cat. no. I9516-500ML)

Sequencing library PCR

• 2x NEBNext Ultra II Q5 Master Mix (New England Biolabs, cat. no. M0544)

  CRITICAL: NEBNext Ultra II Q5 Master Mix has been optimized for next-generation sequencing library generation and features high-fidelity application without GC bias.

• Gel extraction kit (Thermo Fisher Scientific, cat. no. K0691)

• Primers (Sigma Aldrich, desalted oligos for short primers; Integrated DNA Technologies (IDT), 4 nmole Ultramer DNA Oligo for barcoded PCR 2 primers; see Table 1 for sequences)

Pink: i5/i7 barcode; Green: stagger sequence (for further primer details also refer to Experimental Design section)

EQUIPMENT:

Filtered sterile pipette tips

Microcentrifuge tubes (1.7 mL; VWR, cat. no. 87003-294)

1.5 mL Low DNA binding microfuge tubes (Fisher Scientific, cat. no. NC0964895)

PCR strip tubes (Thomas Scientific, cat. no. 1148A28)

15 mL centrifuge tubes (Sigma Aldrich, cat. no. CLS430791-500EA)

50 mL centrifuge tubes (Sigma Aldrich, cat. no. CLS430829-500EA)

5 mL pipettes (Fisher Scientific, cat. no. 07200573)

10 ml pipettes (Fisher Scientific, cat. no. 07200574)

25 ml pipettes (Fisher Scientific, cat. no. 07200575)

50 ml pipettes (Fisher Scientific, cat. no. 07200739)

Aspirating pipettes (Fisher Scientific, cat. no. 03395165)

Electroporation Cuvette, 0.1cm (Thermo Fisher Scientific, cat. no. P410-50)

Sterile 150x15mm petri dishes (Fisher Scientific, cat. no. FB0875714)

Sterile 100x15mm petri dishes (Fisher Scientific, cat. no. FB0875712)

Bacti Cell Spreaders (VWR, cat. no. 60828-688)

PPCO Centrifuge Bottles with Sealing Closure (4x 250ml; Thermo Fisher Scientific, cat. no. 3141-0250PK)

6-well plates, TC-treated (Sigma Aldrich, cat. no. CLS3516-50EA)

12-well plates, TC-treated (Sigma Aldrich, cat. no. CLS3513-50EA)

15 cm plates, TC-treated (Sigma Aldrich, cat. no. CLS430599-60EA)

10, 20, 200, 1000 μL pipettes (e.g. FisherScientific, cat. no. F167370G)

Pipet controller (e.g. Eppendorf, cat. no. 4430000018)

Thermocycler (e.g. FisherScientific, cat. no. 4375786)

Bacteria plate incubator (e.g. FisherScientific, cat. no. 51028065H)

Bacteria shaking incubator (e.g. Eppendorf, cat. no. M1320-0004)

Water bath (e.g. FisherScientific, cat. no. TSGP10PMO5)

Bacteria electroporator (e.g. FisherScientific, cat. no. BTX452042)

Table microcentrifuge (e.g. Eppendorf, cat. no. 5406000445)

Benchtop centrifuge with swinging-bucket rotor (e.g. Eppendorf, cat. no. 022628188)

Minicentrifuge (e.g. FisherScientific, cat. no. 12006901)

Agarose gel electrophoresis system (e.g. FisherScientific, cat. no. 09528110B)

Blue light transilluminator (e.g. LifeTechnologies, cat. no. LB0100)

NanoDrop UV spectrophotometer (e.g. FisherScientific, cat. no. 13400519)

Qubit fluorometer (optional) (e.g. ThermoFisher Scientific, cat. no. Q33238)

Cell culture incubator (humidified, 37°C and 5% CO2) (e.g. FisherScientific, cat. no. 13998131)

Biosafety cabinet (e.g. FisherScientific, cat. no. 13-261-346)

Aspirating system (e.g. VWR International, cat. no. 10141-552)

Cell counter (e.g. BeckmanCoulter, cat. no. C19201)

Microscope (e.g. Leica, SP8 LIGHTNING)

Vortex (e.g. FisherScientific, cat. no. 50728002)

Plate reader (e.g. ThermoFisher Scientific, cat. no. VL0L00D0)

Microwave (e.g. Sharp, cat. no. SMC2242DS)

Balance (e.g. FisherScientific, cat. no. S28567)

4 °C refrigerator (e.g. FisherScientific, cat. no. TSV05RPSA)

−20 °C freezer (e.g. VWR International, cat. no. 97014-903)

−80 °C freezer (e.g. ThermoFisher Scientific, cat. no. EXF60086V)

BioAnalyzer (may be supplied by sequencing facility, e.g. Agilent, cat. no. G2939BA)

Illumina sequencer (may be supplied by sequencing facility, e.g. Illumina, NextSeq 550/1000/2000, NovaSeq 6000)

REAGENT SETUP:

LB agar plates

Suspend LB Agar Lenox at a concentration of 35 g/L in deionized water and swirl to mix. Autoclave for 15-20 minutes at 121 °C to sterilize the solution. Let the LB agar to cool to ~55 °C and then add ampicillin or carbenicillin at 100 μg/mL. Carefully swirl the bottle to mix the solution without creating bubbles. Pour LB agar onto plates on a clean and sterile surface and partially cover plates with lids. Let the agar to solidify at room temperature (~23°C) for ~60 min. Close the lids to cover the plates completely and let the plates dry overnight at room temperature. Invert the plates and store at 4 °C in plastic bags for up to 3 months.

BSA Stock

Make 20 g /100 mL BSA stock by resuspending BSA in DMEM media. We recommend using a magnetic stirrer and resuspending BSA gradually. Once the BSA is resuspended, filter sterilize the solution using a 0.22 μm vacuum filter in a biosafety cabinet. The BSA stock can be stored at 4 °C for several weeks to months.

Serum-free virus harvest medium

To make the serum-free virus harvest medium add 32 mL of 20 g/100 mL BSA stock to 500 mL DMEM (high glucose, sodium pyruvate) and add 5 mL of 100x Pen/Strep solution. The serum-free virus harvest medium can be stored at 4 °C for several weeks to months.

Procedure

Generation of mammalian cell lines that stably express SpCas9 and LbCas12a (Timing 3-4 weeks)

Generation of Cas9 and Cas12a lentivirus (Timing 4 d)

CRITICAL: Note that all cell incubation steps are carried out in a humidified incubator at 37 °C and 5% CO₂. Steps 1-16 must be performed separately for the generation and transduction of SpCas9 and LbCas12a virus.

• 1Seed 500-600 x 10³ low-passage, mycoplasma-free HEK293T packaging cells in each well of a 6-well plate in 2 mL low-antibiotic growth media (DMEM + 10% FBS + 0.1% Pen/Strep).
• 2Incubate cells for 24 h (37 °C, 5% CO₂). The cells should be 70-80% confluent at the time of transfection.
• 3
  Prepare a ~1:1:1 molar mixture of the three transfection plasmids in Opti-MEM as follows: Flick the tube to mix the reagents. Prepare separate transfection mixes for Cas9 and Cas12a.

  Component	Amount per 6-well
  Opti-MEM	50 μL
  psPAX2	600 ng
  pMD2.G	400 ng
  Lenti-Cas9 or plenti-Lb-Cas12a	1 μg

• 4
  Prepare a separate mixture of 50 μL Opti-MEM and 6 μL X-tremeGENE 9. Gently flick the tube to mix the reagents and incubate at room temperature (~23°C) for 5 min.

  Component	Amount per 6-well
  Opti-MEM	50 μL
  X-tremeGENE 9	6 μL

• 5Combine the plasmid mix from Step 3 and the X-tremeGENE 9 mix from Step 4 to obtain a 3:1 ratio of transfection reagent:DNA complex. Mix by gently flicking the tube. Incubate the mix for 30 min at room temperature.
• 6If there are many floating HEK293T cells from Step 2, change the media before transfection.

  CRITICAL Note that the medium needs to be changed very carefully as HEK293T cells detach easily.

• 7Add the transfection mix from Step 5 to the packaging cells from Step 6 in a dropwise manner, distributing the mix across the plate. Rock the plates manually to mix the reagents with the growth medium.
• 8After 16 h, remove medium containing the transfection reagent and replace with viral harvest medium.
• 9After 24 h, harvest the lentivirus-containing supernatant in a 15 mL polypropylene storage tube and centrifuge at 500g for 5 min at 4 °C to remove any cell debris.

  CAUTION Exercise extra caution to avoid any spills while handling lentivirus.

• 10Aliquot supernatant into sterile screw cap storage tubes and store at 4 °C for short-term (hours to days) or −80 °C for long-term storage.

  PAUSE POINT Can be left overnight at 4 °C or frozen for several weeks at −80 °C.

Transduction of mammalian cell lines with SpCas9 and LbCas12a lentivirus (Timing 2-3 weeks)

• 11Prior to transduction, determine the Blasticidin S and G418/Geneticin sensitivity of each cell line by generating a kill curve. A typical dilution range should span 0-20 μg/mL in 5 μg/mL increments for Blasticidin S and 0-1,000 μg/mL in 100-250 μg/mL increments for G418/Geneticin. Note that depending on the cell line, full selection with either of the two antibiotics may require one week or more and multiple lifting and reseeding cycles.
• 12Seed desired mycoplasma-free cell lines in a 6-well (250-350 x 10³ cells in 2 mL cell line-specific culture medium), 6 cm (500-750 x 10³ cells in 4 mL medium), or 10 cm plate (1-2 x 10⁶ cells in 8 mL medium) such that plates will reach confluency in 2-3 d in media containing 8 μg/mL polybrene to enhance lentiviral transduction. Add the appropriate volume of Cas9 or Cas12a lentivirus to each plate, aiming for an MOI < 0.5. Include two wells or plates as no-virus controls to monitor the MOI. Also include one non-transduced and transduced control sample that in Step 13 will either be selected with Blasticidin S or G418/Geneticin or non-selected, respectively. These controls will serve to monitor the selection process and the MOI of the experiment. Mix each plate thoroughly by rocking the plates manually.

  CRITICAL We discourage performing double transduction with both Cas9 and Cas12a lentivirus simultaneously since double selection with both antibiotics may be toxic to many cells. Instead, we recommend serial transduction and selection to establish cell lines expressing both Cas9 and Cas12a (order of transduction does not matter).

• 13After 24 h, remove the medium and add 3-10 mL of fresh culture medium containing the appropriate selection antibiotic. For most cell lines ~10 μg/mL Blasticidin S and ~500 μg/mL G418/Geneticin can be used for the selection of cells transduced with SpCas9-2A-Blast and LbCas12a-2A-G418, respectively. Add the selection drug to one of the two control samples to monitor the selection process while culturing the second control without the drug to assess the MOI of the experiment.
• 14Replace the culture medium containing the selection antibiotic every 2-3 d and passage cells as necessary and until there are no viable cells in the no-virus control (typically 4–7 d).
• 15Scale up the culture volume and freeze down cell stocks as appropriate for the respective cell lines. As a general guideline we recommend freezing cell lines in growth medium + 20-50% FBS + 10% DMSO in cryogenic vials. Frozen vials may be stored at −80 °C for short-term (days to weeks) or in liquid nitrogen for long-term storage.

  PAUSE POINT Frozen cells can be stored in liquid nitrogen for several years.

• 16Repeat Steps 12-15 for transduction of the cell line obtained in Step 15 with lentivirus encoding for the second nuclease.

  CRITICAL In general, we recommend to initially test editing of cell lines without single cell cloning. However, single cell cloning can be performed to select clones with high editing efficiency. This step can be performed sequentially after introduction of each nuclease, or after establishing of expression of both Cas9 and Cas12a. Note that not all cell lines may grow well as single cell clones and the process of establishing monoclonal cell lines and assessing their editing efficiency may be time-consuming. While we have not found that the generation of clonal lines for SpCas9 or LbCas12a is necessary for successful screening, in certain cell lines the clonal selection may yield clones with improved editing efficiency. A general procedure for single cell cloning is described below:

• 17Optional: Propagate fully selected single cells to identify clones with high editing efficiency. Seed cells at a density of 0.6 cells/well in a 96-well plate in 100 μL culture medium. It is recommended to perform a dilution series of the cells and to seed cells from a low concentration stock. Note that for many cell lines the growth of single cell clones can be enhanced by supplying conditioned medium (from cultured cells) or increasing the amount of FBS (e.g. 20% instead of 10% FBS).
• 18Optional: Perform half media changes (remove 50 μL media prior adding 50 μL fresh media) every 3-4 days. Check for cell clones 10-14 days after seeding and mark wells that contain more than one colony. Wells with more than one clone should be excluded.
• 19Optional: Once clones reach a critical size expand them into a larger well format.
• 20Optional: Screen single cell clones for nuclease expression and genome editing efficiency as described in Steps 21-22.

Cell line characterization and assessment of CHyMErA editing efficiency (Timing 4-9 d)

• 21Optional: After selection of cells transduced with both Cas9 and Cas12a lentiviruses, ensure nuclear expression of the two nucleases by western blot and/or immunofluorescence microscopy using anti-FLAG and anti-Myc or anti-SpCas9 and anti-LbCpf1/Cas12a antibodies²¹ (Fig. 3a). Alternatively, skip this step and directly proceed to the Step 22 to assess editing efficiency.
• 22Assess combinatorial editing efficiency of the generated CHyMErA cell lines to ensure adequate performance using one of two assays: option A for an exon deletion assay or option B for 6-thioguanine and thymidine toxicity assay. Note that the exon deletion assay measures the combined action of both nucleases while the drug resistance assays independently assess editing of each nuclease. Thus, we typically start with the exon deletion assay and perform the drug toxicity assay to either confirm results or to identify which of the two nucleases may exhibit low editing efficiency. Use available pLCHKO vectors expressing hgRNA pairs in these assays to monitor robust genome editing.

  ?TROUBLESHOOTING

(A). Exon deletion assay (Timing 4-5 d)

1. Seed CHyMErA cell lines from Step 16 or 20 in 6-well plates at a density of ~150-350 x 10³ cells (or in 12-well plates at a density of ~75-150 x 10³ cells) in 2 mL cell line-specific culture medium containing 8 μg/mL polybrene and transduce cells at low MOI (MOI < 0.4) with pLCHKO_HPRT1_exon2_1_Lb, pLCHKO_HPRT1_exon3_1_Lb or pLCHKO_intergenic-intergenic_2 lentivirus (for pLCHKO virus production please see Steps 71-80). Also include two non-transduced controls that will either be non-selected or selected with puromycin in Step 22A ii.

2. After 24 h, select cells with 1-2 μg/mL puromycin for 48-72 h until selection is complete (i.e. no viable cells in puromycin selection control).

3. 4 d post transduction, collect selected cells and extract genomic (g)DNA using a standard gDNA extraction kit (e.g. GeneJET Genomic DNA Purification Kit), following manufacturer’s instructions.

   PAUSE POINT Cell pellets can be frozen for several weeks −20 °C.

4. PCR amplify the region surrounding the targeted exon using the HPRT1 primers listed in Table 1. Perform independent PCR reactions with gDNA from edited (cells transduced with hgRNAs targeting HPRT1 exon_2 or exon_3) and non-edited (cells transduced with hgRNAs targeting intergenic-targeting controls) cells, using the conditions listed below.

   Component	Amount	Final concentration
   gDNA	10 ng	1 ng/μL
   Forward primer, 5 μM	0.4 μL	0.2 μM
   Reverse primer, 5 μM	0.4 μL	0.2 μM
   Kapa DNA polymerase mix, 2x	5 μL	1x
   H2O	To 10 μL
   Total	10

   Cycle number	Denature	Anneal	Extend
   1	95 °C, 3 min
   2-36	98 °C, 20 s	65 °C, 15 s	72 °C, 25 s
   37			72 °C, 1 min

5. Resolve PCR products on a 1% agarose gel containing SYBR Safe at 100 V for 45-60 min. The expected band size for the PCR product from unedited cells is 1,396 bp and 1,049 bp for HPRT1 exon_2 and exon_3, respectively. For edited cells a PCR product of ~320 bp and ~395 bp is expected for HPRT1 exon_2 and exon_3, respectively (size varies slightly depending on the repair outcome and an additional band corresponding to microdeletions may be visible) (Fig. 3b).

6. Use ImageJ or any other pixel quantification software to calculate the intensity of the wild-type (WT) and exon-deleted (Δexon) PCR products. Normalize the values by product size (intensity/product size) assuming a linear relationship between product size and dye incorporation. Next, use the formula (Δexon/(WT+Δexon)*100) to estimate percent exon deletion. Cells with robust editing efficiency are expected to yield ~30-50% exon deletion efficiency.

(B). 6-thioguanine and thymidine toxicity assay (Timing 8-9 d)

1. Seed CHyMErA cell lines in 6-well plates at a density of ~150-350 x 10³ cells in 2 mL medium containing 8 μg/mL polybrene and transduce cells at low MOI (MOI < 0.4) with pLCHKO_TK1_HPRT1_Lb_1 or pLCHKO_intergenic-intergenic_2 lentivirus (for pLCHKO virus production please see Steps 71-80). Also include two non-transduced controls that will either be non-selected or selected with puromycin in Step 22B ii.

2. After 24 h, select cells with 1-2 μg/mL puromycin for 48-72 h until selection is complete (i.e. no viable cells in puromycin selection control).

3. Count and seed cells into 12-well plates at a density of ~ 50-100 x 10³ cells in 1.5 mL cell line-specific culture medium. Seed each transduced population in nine wells (three different treatment conditions in three technical replicates each).

4. After ~16-18 h, treat the cells with 2.5 mM thymidine, 6 μM 6-thioguanine or DMSO control by adding drug-containing medium.

5. After 4 d (or until mock-treated cells reach confluency), determine cell counts or viability using AlamarBlue or any other viability dyes. Normalize viability of the drug-treated to the control-treated cells. Efficient combinatorial editing is expected to result in 70-100% cell viability in thymidine or 6-thioguanine-treated compared to control-treated cells, while unedited cells (i.e. transduced with intergenic-targeting hgRNAs) are expected to exhibit strongly reduced cell viability of 0-30% (Fig. 3c).

Amplification of existing screening library (Timing 2-3 d)

CRITICAL For all steps of this protocol (Steps 23-33) it is crucial to work in a clean environment to avoid cross contamination with other plasmid DNA, which can substantially interfere with results. It is recommended to carefully clean the working surface, pipettes, and racks with 10% bleach (0.5% final concentration of hypochlorite). Wipe all bleached material with water to remove bleach. Aliquot out all required reagents to reduce contamination of stock reagents. Use filter tips for all steps and carefully eject tips to avoid creating aerosols.

• 23Dilute the hgRNA library to a concentration of 50 ng/μL in TE Buffer.
• 24Electroporate the library into electro-competent bacteria. Set up 4 replicate reactions of 2 μL diluted hgRNA library to 25 μL of Lucigen Endura electro-competent cells. Electroporate according to the manufacturer’s instructions. Add 975 μL of the manufacturer’s supplied Recovery Medium (or S.O.C. medium) and transfer cells to a culture tube containing an additional 1 mL of Recovery Medium. Recover bacteria in a shaking incubator at 200 rpm for 1 hour at 30 °C.
• 25Pool all 8 mL of recovered cells and mix well.
• 26To titer the library to estimate transformation efficiency and to ensure that full library representation is preserved, firstly transfer 10 μL of cells to 990 μL of Recovery Medium, mix well, and plate 20 μL onto a pre-warmed 10 cm LB + 100 μg/mL ampicillin or carbenicillin agar plate. This represents a 40,000-fold dilution of the full transformation.
• 27In parallel, plate the library by spreading recovered cells on a total of 20 15-cm LB + 100 μg/mL ampicillin or carbenicillin agar plates. Spread 400 μL of recovered cells on each of the pre-warmed plates.
• 28Incubate the plates for 14-16 h at 30 °C.
• 29Calculate transformation efficiency by counting the number of colonies on the dilution plate. Multiply the number of colonies by 40,000 (i.e. dilution factor) to calculate the expected total number of colonies from the complete transformation reaction. Proceed if the total number of colonies represents a library coverage of at least 200-fold (i.e. 200x size of hgRNA library) (optimally 500-1,000-fold library coverage). Otherwise optimize the transformation protocol or increase the number of electroporations.
• 30Harvest colonies. Add 7 mL of LB + 100 μg/mL ampicillin or carbenicillin medium to each 15-cm plate. Scrape the colonies off with a cell spreader and transfer the scraped cells into a sterile bottle using a 10 mL pipet. Rinse the scraped plate with an additional 5 mL of LB + 100 μg/mL ampicillin or carbenicillin medium and transfer to the bottle.
• 31Repeat with all 20 plates and collect all scraped cells in one bottle. Stir well for 30 min at 4 °C to homogenize the bacterial population prior to splitting into multiple aliquots for plasmid purification.
• 32Transfer cells to pre-weighed centrifuge bottles. Centrifuge at 7,000g at 4°C for 10 min and discard media. Invert the bottles to drain any remaining supernatant. Weigh the wet cell pellet.
• 33Purify the library plasmid pool using a Maxi- or Mega-scale plasmid purification kit, following the manufacturer’s instructions. Perform multiple Maxi or Mega preps according to column capacity. Typically, a Maxi and Mega column can process 1 g and 2.5 g of wet cell pellet, respectively.

Cloning of hybrid guide (hg)RNA screening libraries into pLCHKO vector (Timing 4-6 weeks)

CRITICAL For all steps of the library preparation (Steps 36-69) it is crucial to work in a clean environment to avoid cross contamination with other plasmid DNA. It is recommended to carefully clean the working surface, pipettes, and racks with 10% bleach (0.5% final concentration of hypochlorite). Wipe all bleached material with water to remove bleach. Aliquot out all required reagents to reduce contamination of stock reagents. Use filter tips for all steps and carefully eject tips to avoid creating aerosols.

Design and synthesis of DNA oligo libraries (Timing 2-4 weeks)

• 34
  Design desired oligos to clone a CHyMErA hgRNA library using the outline provided below (20 nt Cas9 spacer sequence indicated in blue; 23 nt Cas12a spacer sequence indicated in orange; restriction sites are indicated with capital letters in black). Use available webtools and customized scripts to select and combine Cas9 and Cas12a guides following the design criteria summarized in Box 3.

  agagaACCTGCagagaccgNNNNNNNNNNNNNNNNNNNNgtttaGAGACGgctaaatccgCGTCTCgagatNNNNNNNNNNNNNNNNNNNNNNNttttagagGCAGGTagaga

• 35Synthesize the in silico designed oligo library as a pool using DNA oligo synthesis platforms such as CustomArray or Twist Bioscience. Synthesis typically requires ~2 weeks depending on the size of the oligo library. Store the oligos at 4 °C until use.

Restriction enzyme digestion of the pLCHKO vector backbone (Timing 1 d)

• 36
  Digest the pLCHKO backbone with the restriction enzyme BfuAI (BveI), which cuts around the hgRNA target region and removes an 1870 bp stuffer sequence (Fig. 4). Prepare a master mix for setting up 8 digestion reactions as follows. The digestion of the vector backbone ahead of the Golden Gate assembly (Steps 43-44) promotes efficiency of the library cloning and reduces the occurrence of recovering vectors that do not carry an oligo insert.

  Component	Amount per reaction	Final concentration	Master mix (8x)
  pLCHKO vector	4 μg	80 ng/μL	32 μg
  BfuAI, 5,000 units/mL	4 μL	0.4 units/μL	32 μL
  NEBuffer 3.1, 10x	5 μL	1x	40 μL
  H2O	To 50 μL		To 400 μL
  Total	50 μL		400 μL

  Prepare aliquots of 50 μL reactions from the master mix and incubate the restriction digest reaction at 50 °C for 3 h.

• 37Add 1 μL rSAP phosphatase and incubate at 37 °C for an additional hour.
• 38After the digestion reaction is completed, pool the restriction digest reactions and run the entire volume on a 1% (weight/volume) agarose gel at 60 V for ~2 h (use TAE buffer and SYBR safe for nucleic acid staining).
• 39Gel-extract the digested backbone using a gel extraction kit following manufacturer’s recommendations and quantify the product with a NanoDrop UV spectrophotometer. Note that the properly digested pLCHKO backbone to be extracted is 7,500 bp, and the stuffer sequence fallout of 1,870 bp should also be visible on the gel (Fig. 3d).

PCR amplification of the pooled oligo library (Timing 4 h)

• 40Dilute pooled oligo library from Step 35 to 500 nM in TE buffer.
• 41
  To amplify the diluted oligo library using the TKO-F1 and TKO-R1 primers (Table 1) prepare a master mix and run PCR reactions as follows:

  Component	Amount per reaction	Final concentration	Master mix (10x)
  Oligos, 500 nM (Step 40)	4 μL	40 nM	40 μL
  Q5 buffer, 5x	10 μL	1x	100 μL
  dNTPs, 10 mM	1 μL	200 μM	10 μL
  TKO-F1, 10 μM	1 μL	0.2 μM	10 μL
  TKO-R1, 10 μM	1 μL	0.2 μM	10 μL
  Q5 High-Fidelity DNA polymerase, 2,000 units/ml	3.5 μL	0.14 units/μL	35 μL
  H2O	29.5 μL		295 μL
  Total	50 μL		500 μL

  Cycle number	Denature	Anneal	Extend
  1	98 °C, 30 s
  2-11	98 °C, 10 s	53 °C, 30 s	72 °C, 10 s
  12			72 °C, 2 min

  ?TROUBLESHOOTING

• 42After the reaction is complete, pool the PCR reactions and purify the PCR product using a PCR purification kit following manufacturer’s recommendations. Quantify the product with a NanoDrop UV spectrophotometer and run 3-5 μL on a 2.5% agarose gel containing SYBR Safe DNA stain at 90 V for 45 min to check the integrity of the PCR product. The amplified library is expected to be visible as a single 157 bp band (Fig. 3e).

  ?TROUBLESHOOTING

Optimization of vector:insert ratio for ligation reaction 1 (Timing 2.5 d)

• 43
  Set up a master mix for a Golden Gate assembly on ice as follows. For each Golden Gate assembly use 17 fmoles digested pLCHKO hybrid vector from Step 39. Titrate the amount of the amplified oligos from Step 42 as indicated below to identify the backbone:insert ratio that results in the most efficient ligation. Be sure to include the necessary negative control reactions that do not contain the hgRNA library insert to assess empty vector background rates.

  Component	Amount per reaction	Final concentration	Master mix (8.5x)
  Digested pLCHKO (Step 39)	17 fmoles	0.85 nM	144.5 fmoles
  T4 DNA Ligase Reaction Buffer, 10x	2 μL	1x	17 μL
  FastDigest Oligo, 0.01 mM	0.5 μL	0.25 μM	4.25 μL
  FastDigest BveI	1 μL		8.5 μL
  T4 DNA ligase, 400,000 units/ml	1 μL	20 units/μL	8.5 μL
  H2O	To 15 μL		To 127.5 μL
  Amplified oligos (Step 42)	5 μL
  Total	20 μL

  Amplified oligos H2O
  0 μL	5 μL
  0.25 μL	4.75 μL
  0.5 μL	4.5 μL
  1 μL	4 μL
  2 μL	3 μL
  3 μL	2 μL
  4 μL	1 μL
  5 μL	0 μL

• 44
  Run Golden Gate assembly reaction overnight using the following conditions:

  Cycle number	Digestion	Ligation-I	Ligation-II	Inactivation
  1-12	37 °C, 30 min	16 °C, 30 min	24 °C, 60 min
  13	37 °C, 15 min			65 °C, 10 min

• 45
  Ethanol precipitation of the Golden Gate reaction. Mix the Golden Gate assembly with the following ingredients:

  Component	Amount	Final concentration
  Golden Gate reaction (Step 44)	20 μL
  H2O	180 μL
  NaAc, 3M	20 μL	~100 mM
  Pellet Paint	0.5 μL
  100% EtOH	400 μL	~67%
  Total	620 μL

• 46Mix and incubate at RT for 10 min prior centrifuging at >13,000g for 5 min to precipitate plasmid DNA. Wash pellet twice with 80% EtOH, air dry the pellet for 5 min, and resuspend pellet in 10 μL UltraPure TE.
• 47Electroporate 2 μL of the purified plasmid DNA to 25 μL Endura ElectroCompetent cells according to the manufacturer’s directions.
• 48Recover competent cells in 975 μL S.O.C. medium at 30 °C and 200 rpm for 1 h and plate 200 μL of 1:100, 1:1,000 and 1:10,000 dilutions onto pre-warmed 15 cm LB agar plates containing 100 μg/mL ampicillin or carbenicillin. For the negative control ligation reaction (without amplified library oligos) also plate undiluted recovered competent cells. Incubate overnight at 30 °C.
• 49Determine the optimal vector:insert ration for ligation reaction 1 by calculating the electroporation efficiency of each ligation reaction as follows. Count the number of colonies in the 1:10,000 dilution plates. Multiply the number by 250,000 (i.e. dilution factor) to estimate the total number of colonies for each Golden Gate assembly. Ensure that the negative control reaction gives negligible number of colonies compared to reactions with an insert.
• 50Select the vector:insert ratio that resulted in the highest number of colonies for a large-scale Golden Gate assembly and estimate the number of reactions required to obtain a minimum coverage of 500 colonies (ideally ~1,000) for each hgRNA present in the library. For example, for a 90,000 hgRNA library, assuming that 25 colonies were counted in the 1:10,000 plate dilution, set up between 8-14 reactions (90,000 hgRNAs x 500 to 1,000 library coverage / (25 counted colonies x 250,000 dilution factor)).
• 51Optional: As a quality control, inoculate 24 colonies for mini-prep plasmid purification followed by Sanger sequencing of the dual spacer inserts with the U6-fwd primer (Table 1). To do so, pick single bacterial colonies from the LB agar plates and start 4 mL overnight cultures in LB containing 100 μg/mL ampicillin or carbenicillin. Incubate culture at 30 °C for 16 h. Spin down bacteria and extract plasmid DNA using a mini-prep plasmid DNA isolation kit as per manufacturer’s instructions. Estimate the DNA concentration and send the required plasmid amount mixed with 5 pmol/μL (5 μM) U6-fwd primer for Sanger sequencing (Table 1). Ensure that the recovered gRNA sequences match to a hgRNA pair included in the hgRNA library.

  ?TROUBLESHOOTING

Large-scale Golden Gate assembly 1 (Timing 2.5-5.5 d)

• 52Set up enough ligation reactions to acquire a coverage of 500-1,000 colonies per hgRNA following Steps 43-45. Set up a Golden Gate assembly master mix on ice and be sure to include a negative control (i.e. no insert) reaction. Run reaction overnight.
• 53
  Ethanol precipitation of ligation reactions. Pool all ligation reactions (except the negative control, which is purified separately). Aliquot the ligation mix into multiple tubes if the total volume exceeds 100 μL.

  Component	Amount	Final concentration
  Pooled ligation reaction	x μL
  H2O	360-x μL
  NaAc, 3M	40 μL	100 mM
  Pellet Paint	0.5 μL
  100% EtOH	800 μL	67%
  Total	1200 μL

  Vortex for 15 s and incubate at room temperature for 5-10 min. Centrifuge at >13,000g for 5 min at room temperature to precipitate plasmid DNA. Wash pellet twice with 80% EtOH, air dry the pellet for 5 min, and resuspend pellet in 10 μL UltraPure TE buffer. Combine the aliquoted plasmids in a single tube.

• 54Optional: Perform test-transformation to estimate the large-scale ligation efficiency by repeating Steps 47-48.
• 55Optional: Count the colonies and calculate the number of electroporation reactions required to achieve the desired coverage as described in Step 49-50.
• 56Optional: As a quality control, sequence 24 colonies by Sanger sequencing following the protocol in Step 51.

  ?TROUBLESHOOTING

• 57Set up large-scale transformation reactions. Perform multiple electroporations of 2 μL of purified plasmid to 25 μL Endura ElectroCompetent cells according to the manufacturer’s directions.
• 58Recover competent cells in 975 μL S.O.C. medium at 30 °C for 1h and plate 200 μL in pre-warmed 15 cm LB agar plates containing 100 μg/mL ampicillin or carbenicillin. Incubate overnight at 30 °C.
• 59Harvest E. Coli colonies. On the next day scrape the colonies from the LB agar plates using ~8 mL LB containing 100 μg/mL ampicillin or carbenicillin per plate. Use a cell spreader to gently detach colonies from the plate. After collecting the liquid to a sterile flask apply another ~4 mL of LB + ampicillin or carbenicillin medium to wash plates and capture remaining colonies and transfer the liquid to the flask. Stir the collected bacteria at 4 °C for 45-60 min and aliquot on 50 mL falcon tubes. Spin down the bacteria at 3,200g for 20 min at 4 °C and measure the pellet weight in each tube. Freeze pellets at −80 °C until plasmid purification or for long-term storage.

  PAUSE POINT

• 60Purification of intermediate library products. Use 1 g of bacteria from Step 68 for 1 column of a Maxi prep plasmid purification kit following manufacturer’s recommendations. If the weight of bacteria in the 50 mL tube is more than 1 g, use multiple Maxi prep columns. Pool the resulting plasmid DNA and quantify the product with a NanoDrop UV spectrophotometer. The plasmid can be stored at −20 °C for long-term storage.

Digestion of Ligation 1 Library (Timing 1 d)

• 61
  Restriction digest the pLCHKO vector containing the dual spacer inserts from Step 60. Digest the amplified intermediate library backbone from Step 60 with the restriction enzyme BsmBI (Esp3I). The BsmBI recognition sites have been introduced with the oligos cloned into the pLCHKO backbone and surround the Cas9 and Cas12a spacers (Fig. 4). Prepare a master mix for setting up 6 reactions as outlined below.

  Component	Amount per reaction	Final concentration	Master mix (6x)
  pLCHKO-Ligation 1 (Step 60)	2.5 μg	50 ng/μL	15 μg
  BsmBI, 10,000 units/mL	4 μL	0.8 units/μL	24 μL
  NEBuffer 3.1, 10x	5 μL	1x	30 μL
  H2O	To 50 μL		To 300 μL
  Total	50 μL		300 μL

  Incubate the reactions at 55 °C for 4 h, then add 1 μL rSAP per reaction and incubate for 1 h at 37 °C.

• 62PCR purify the library plasmid using 2 columns of a PCR Purification kit according to manufacturer’s recommendations and quantify the product with a NanoDrop UV spectrophotometer. The digested plasmid can be stored at −20 °C for long-term storage.

Golden Gate assembly 2 (Timing 3-6 d)

• 63
  Optional: Optimization of ligation 2. Either optimize vector:insert ratio as described below or use a standard 1:30 vector:insert ratio using 20 fmoles digested pLCHKO-Ligation 1 from Step 62 and 600 fmoles TOPO-tracrLbDR.

  Ratio	0	5	10	20	30	40	60
  Digested pLCHKO-Ligation 1 (fmoles)	20	20	20	20	20	20	20
  Undigested TOPO tracrLbDR (fmoles)	0	100	200	400	600	800	1200

• 64Golden Gate assembly for final hgRNA library cloning. Set up 8 ligation reactions using a 1:30 ratio (or alternative optimized ratio determined in Step 63) of digested pLCHKO vector with TOPO-tracrRNA-DR vector. Set up a master mix on ice and be sure to include a negative control reaction containing no insert.
  Setting up 8 ligation reactions should be sufficient to acquire a coverage of 500-1,000 colonies per hgRNA. Run reaction overnight as follows:

  Component	Amount per reaction	Final concentration	Master mix (6.5-25x)
  Digested pLCHKO-Ligation 1 (Step 62)	20 fmoles	1 nM	130-500 fmoles
  T4 DNA Ligase Reaction Buffer, 10x	2 μL	1x	13-50 μL
  DTT, 20 mM	1 μL	1 mM	6.5-25 μL
  FastDigest Esp3I	1 μL		6.5-25 μL
  T4 DNA Ligase, 400,000 units/ml	1 μL	20 units/μL	6.5-25 μL
  H2O	x μL		6.5-25x μL
  TOPO tracrRNA-LbDR	600 fmoles	30 nM
  Total	20 μL

  Cycle number	Digestion	Ligation-I	Ligation-II	Heat inactivation
  1-12	37 °C, 30 min	16 °C, 30 min	24 °C, 60 min
  13	37 °C, 15 min			65 °C, 10 min

• 65
  Precipitate the ligation reaction. Pool all ligation reactions (except the negative control which is purified separately). Aliquot the ligation mix into multiple tubes if the total volume exceeds 100 μL.

  Component	Amount	Final concentration
  Pooled ligation reaction	x μL
  H2O	360-x μL
  NaAc, 3M	40 μL	100 mM
  Pellet Paint	0.5 μL
  100% EtOH	800 μL	67%
  Total	1200 μL

  Vortex for 15 s and incubate at RT for 5-10 min. Centrifuge at >13,000g for 5 min at room temperature to precipitate plasmid DNA. Wash pellet twice with 80% EtOH, air dry the pellet for 5 min and resuspend pellet in 10 μL TE buffer. Combine the aliquoted plasmids in a single tube.

• 66Perform test transformation following Steps 54-56.
• 67Perform large-scale transformation and harvest bacteria following Steps 57-59.

  PAUSE POINT

• 68For the purification of the hgRNA library use 4 g of bacteria for 1 column of an endotoxin-free Mega prep kit following manufacturer’s recommendations. If the weight of bacteria in the 50 mL tube is more than 4 g use multiple Mega prep columns or reduce the input material. Pool the resulting plasmid DNA and quantify the product with a NanoDrop UV spectrophotometer.
• 69Determine hgRNA distribution by next-generation sequencing of amplified hgRNA cassettes. Detailed instructions for Illumina compatible sequencing library generation are provided in Steps 126-137. Note that sequencing libraries can be generated from library plasmid in a single PCR step (PCR 2) and no prior amplification (PCR 1) is needed. The amount of plasmid input for PCR 2 should be determined empirically by titrating the plasmid input down to ~ 50-300 ng per 50 μL PCR reaction.

Cloning of individual hgRNAs into pLCHKO vector (Timing 1-4 weeks)

• 70For focused cloning of hgRNAs into the pLCHKO backbone, three strategies are provided below. Option A: This strategy involves a two-step cloning approach (similar to the cloning of CHyMErA hgRNA libraries) whereby the guide sequences and Cas9 tracrRNA/Cas12a direct repeat are sequentially cloned into the pLCHKO vector backbone. This is the quickest but also most laborintensive and costly approach considering cloning, plasmid prepping, and sequencing costs.

  Option B: In lieu of cloning individual hgRNAs using restriction cloning (option A), we recommend synthesizing the final pLCHKO hgRNA construct using DNA synthesis services provided by synthetic DNA manufacturers such as TWIST Bioscience. This cloning-free strategy does not require any experimental work but takes the longest out of the three options described in this protocol. Option B may thus be most suitable for researchers that want to minimize bench time and for orders that are not very time sensitive.

  Option C: To save time and cost compared to commercial cloning services (option B), dsDNA fragments comprising the complete hgRNA sequences flanked by restriction sites can be ordered from commercial DNA synthesis providers such as TWIST Biosciences (process described below). The DNA fragments can subsequently be cloned into pLCHKO in a one-step Golden Gate reaction. The cloning cost of this strategy can be further reduced by cloning multiple fragments in parallel in a pooled reaction. Option C is thus especially recommended for larger and more time-sensitive hgRNA cloning projects.

(A). hgRNA cloning using restriction enzymes (Timing 1 week)

hgRNA oligo annealing (Timing 2 h)

• iOrder forward and reverse oligos carrying SpCas9 (indicated in blue) and LbCas12a (indicated in orange) guides, a stuffer sequence with Esp3I/BsmBI restriction sites, and cloning overhangs as listed below. Standard de-salted oligos are sufficient for cloning and oligo should be resuspend to 100 μM in H₂O or TE buffer.
  hgRNA fwd oligo: 5’-

  accgNNNNNNNNNNNNNNNNNNNNgtttaGAGACGgctaaatccgCGTCTCgagatNNNNNNNNNNNNNNNNNNNNNNN −3’

  hgRNA rev oligo: 5’- aaaa[NNNNNNNNNNNNNNNNNNNNNNN]_rev-comp

  atctcGAGACGcggatttagcCGTCTCtaaac[NNNNNNNNNNNNNNNNNNNN]_rev-comp -3’

• ii
  Phosphorylate oligos at 37 °C for 30 min using the following conditions:

  Component	Amount	Final concentration
  Fwd oligo, 100 μM	1 μL	10 μM
  Rev oligo, 100 μM	1 μL	10 μM
  T4 DNA Ligase Reaction Buffer, 10x	1 μL	1x
  T4 PNK, 10,000 units/ml	0.5 μL	5 units
  H2O	6.5 μL
  Total	10 μL

  CRITICAL The reaction above is set up using the T4 DNA Ligase Reaction Buffer (containing ATP). If using the T4 PNK buffer instead, ATP needs to be added on top of the reaction mix.

• iii
  Add 1.1 μL of NEBuffer 3.1 (NEB) and anneal the oligos in a thermocycler using the following conditions:

  Cycle number	Denature	Anneal
  1	95 °C, 5 min	ramp down temperature to 25 °C at 2 °C/min

• ivDilute the annealed oligo 1:250 (250-fold).

pLCHKO backbone digestion (Timing 1 d)

• v
  Restriction digest the pLCHKO vector backbone (to replace the 1.8 kb stuffer sequence with an hgRNA) as follows:

  Component	Amount	Final concentration
  pLCHKO vector	1.5 μg	75 ng/μL
  BfuAI, 5,000 units/ml	1.5 μL	0.375 units/μL
  NEBuffer 3.1, 10x	2 μL	1x
  H2O	To 20 μL
  Total	20 μL

  Incubate at 50 °C for 4 h.

• viAdd 1 μL rSAP and incubate at 37 °C for 1 h to dephosphorylate the digested backbone.
• viiGel purify the reaction by running it on a 1% agarose gel at 100 V for about 1.5 h, or until stuffer is over half-way down the gel. The following two fragments should be visible: vector backbone at ~7,500 bp, and the stuffer at ~1,800 bp. Cut out the vector backbone fragment from gel and purify it using a column from a gel extraction kit, following manufacturer’s instructions. Elute the purified pLCHKO backbone with 30 μL elution buffer.

Ligation 1 (Timing 3 d)

• viii
  Ligate annealed and diluted hgRNA oligos into the pLCHKO vector backbone as follows:

  Component	Amount	Final concentration
  Digested pLCHKO vector (Step 70A vii)	50 ng	5 ng/μL
  annealed oligos (1:250 dilution) (Step 70A iv)	1μL
  T4 DNA Ligase Reaction Buffer, 10x	1 μL	1x
  T4 DNA Ligase, 400,000 units/mL	1 μL	40 units/μL
  H2O	To 10 μL
  Total	10 μL

  Incubate at room temperature for 1 h (or overnight at 16 °C).

• ixTransform 2 μL of the ligation reaction into 20 μL Stbl3 electro-competent cells by heat shock at 42 °C for 40 s, S.O.C.-treat at 30 °C for 1 h and plate on LB agar plates containing 100 μg/mL ampicillin or carbenicillin. Incubate overnight at 30 °C.
• xAmplify and purify ligation 1 product using a mini or mid prep plasmid purification kit, following manufacturer’s instructions.

  CRITICAL When using EndA⁺ bacterial E. coli strains such as Stbl3, ensure to use a plasmid purification kit containing an additional wash step to remove any contamination with endonuclease I as it may degrade the plasmid DNA during the digestion in Step 70A xii.

  ?TROUBLESHOOTING

• xiConfirm insertion of hgRNA by Sanger sequencing using the U6-fwd primer (Table 1).

Ligation 2 (Timing 3 d)

• xii
  Restriction digest the pLCHKO vector containing the dual spacer inserts from Step 70A x. Digest the amplified intermediate pLCHKO backbone with the restriction enzyme Esp3I/BsmBI. The Esp3I/BsmBI recognition sites have been introduced with the oligos cloned into the pLCHKO backbone and surround the Cas9 and Cas12a spacers (Fig. 4). Prepare a master mix as follows:

  Component	Amount	Final concentration
  pLCHKO-Ligation 1 (Step 70A x)	1.5 μg	75 ng/μL
  BsmBI, 10,000 units/mL	2 μL	1 unit/μL
  NEBuffer 3.1, 10x	2 μL	1x
  H2O	To 20 μL
  Total	20 μL

  Incubate the reactions at 55 °C for 4 h, then add 1 μL rSAP and incubate for 1 h at 37 °C.

• xiiiPCR purify the library plasmid using 2 columns of a PCR Purification kit according to manufacturer’s recommendations and quantify the product with a NanoDrop UV spectrophotometer.
• xiv
  Introduce the SpCas9 tracrRNA and the Cas12a direct repeat into the digested pLCHKO-Ligation 1 intermediate construct through Golden Gate assembly as follows:

  Component	Amount	Final concentration
  digested pLCHKO-Ligation 1 (Step 70A xiii)	20 fmoles	1 nM
  TOPO tracrRNA-LbDR (undigested)	600 fmoles	30 nM
  T4 DNA Ligase Reaction Buffer, 10x	2 μL	1x
  DTT, 20 mM	1 μL	1 mM
  FastDigest Esp3I	1 μL
  T4 DNA Ligase, 400,000 units/ml	1 μL	20 units/μL
  H2O	To 20 μL
  Total	20 μL

  Cycle number	Digestion	Ligation-I	Ligation-II	Heat inactivation
  1-12	37 °C, 30 min	16 °C, 30 min	24 °C, 60 min
  13	37 °C, 15 min			65 °C, 10 min

• xvTransform 2 μL of the ligation 2 product into 20 μL Stbl3 electro-competent cells by heat shock at 42 °C for 40 s, S.O.C.-treat at 30 °C for 1 h and plate on LB agar plates containing 100 μg/mL ampicillin or carbenicillin.
• xviAmplify and purify final pLCHKO hgRNA construct using a mini or mid prep plasmid purification kit, following manufacturer’s instructions.
• xviiConfirm final hgRNA cassette by Sanger sequencing using the U6-fwd primer (Table 1).

(B). Synthesis of complete hgRNAs using commercial cloning services (Timing 4 weeks)

1. Design 300 bp hgRNA inserts containing a 5’ padding sequence (black), Cas9 spacer sequence (20 bp, blue underlined), Cas9 tracrRNA (blue), Lb-Cas12a direct repeat (orange), Cas12a spacer sequence (23 bp, orange underlined) and a 3’ padding sequence (black) as follow:

   atcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaggtaccgNNNNNNNNNNNNNNNNNNNNgtttcagagctatgctggaaacagcatagcaagttgaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctaatttctactaagtgtagatNNNNNNNNNNNNNNNNNNNNNNNttttttttgaattctctgggtcccctcggggttgggaggtgggtctgaaacgataatggtgaatatccctgccta

2. Create a TWIST user account, request access to the ‘pLCKO Hybrid’ custom vector and generate order for gene cloning as outlined below. The pLCHKO vector has been onboarded by TWIST as a custom vector (named pLCKO Hybrid) and access to this custom vector can be requested through customer service free of charge.

   1. Select “Genes”
   2. Start new project
   3. Upload DNA name and sequence
   4. Select custom vector: pLCKO hybrid
   5. Select insertion point: BfuAI
   6. Request and review quote
   7. Submit order

(C). Cloning of hgRNA fragments into pLCHKO (Timing 2 weeks)

dsDNA fragment design and synthesis (Timing ~7-9 d)

• i
  Design 300 bp hgRNA inserts comprising a 5’ padding sequence (black) containing a BveI restriction site (bold), Cas9 spacer sequence (20 bp, blue underlined), Cas9 tracrRNA (blue), Lb-Cas12a direct repeat (orange), Cas12a spacer sequence (23 bp, orange underlined) and a 3’ padding sequence (black) containing a BveI restriction site (bold) as follow:

  cggctatggtgtcagtttattgaggttgaagagcatgcatgatatgtcattcgcgaaagacACCTGCagagaccgNNNNNNNNNNNNNNNNNNNNgtttcagagctatgctggaaacagcatagcaagttgaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctaatttctactaagtgtagatNNNNNNNNNNNNNNNNNNNNNNNttttgtagGCAGGTgatctacaaaaccgcgtcgccatgcatttgaagatgaaacatttaagtgacggctatgact

• iiCreate TWIST user account and generate order for DNA fragment synthesis as follow:

  1. Select “Genes”

  2. Start new project

  3. Order “Gene Fragments”

  3. Upload DNA name and sequence

  6. Request and review quote

  7. Submit order

pLCHKO backbone digestion (Timing 1 d)

• iiiRestriction digest the pLCHKO vector backbone containing a 1.8 kb stuffer sequence and replace the stuffer sequence with a hgRNA as described in Step 70A v-vii.

dsDNA fragment digestion (Timing 0.5 d)

• ivResuspend 1 μg of lyophilized dsDNA fragments (Step 70C i) in 42 μL H₂O, bringing the fragments to a concentration of 24 ng/μL.
• v
  Digest the dsDNA fragment with BveI as indicated below. Note, dsDNA fragments can be pooled before digestion to save reagent cost for cloning. The guide inserts of each cloned construct can subsequently be determined by Sanger sequencing.

  Component	Amount	Final concentration
  dsDNA fragment, 24 ng/μL (Step 70C iv)	5 μL	6 ng/μL
  H2O	11 μL
  FastDigest Oligo, 0.01 mM	1 μL	0.5 μM
  FastDigest Buffer, 10x	2 μL	1x
  FastDigest BveI	1 μL
  Total	20 μL

  Incubate at 37 °C for 1 h.

Ligation

• vi
  Ligate annealed and diluted hgRNA oligos into the pLCHKO vector backbone using a 1:5 vector:insert ratio.

  Component	Amount	Final concentration
  digested dsDNA fragment, 6 ng/μL	1.5 μL	0.9 ng/μL
  digested pLCHKO vector	50 ng	5 ng/μL
  T4 DNA Ligase Reaction Buffer, 10x	1.5 μL	1x
  T4 DNA Ligase, 400,000 units/mL	1 μL	40 units/μL
  H2O	To 15 μL
  Total	15 μL

  Incubate at room temperature for 1 h (or overnight at 16 °C).

• viiTransform 3.5 μL of ligation mix into 20 μL Stbl3 electro-competent cells by heat shock at 42 °C for 40 s, S.O.C.-treat at 37 °C for 1 h and plate on LB agar plates containing 100 μg/mL ampicillin or carbenicillin.
• viiiAmplify and purify ligation products using a miniprep plasmid purification kit, following manufacturer’s instructions.
• ixConfirm insertion of gRNA by Sanger sequencing using the U6-fwd primer (Table 1).

Lentivirus production for (hg)RNAs (Timing 4 d)

CRITICAL All cell incubation steps are carried out in a humidified incubator at 37 °C and 5% CO₂.

CAUTION When working with active lentivirus (virus production, MOI determination and primary infection steps), double glove, utilize manual pipetting in lieu of vacuum aspiration to avoid generation of virus containing aerosols, and soak all waste in 20% bleach (1% final concentration of hypochlorite) for 30 min to inactivate virus before removal from the biosafety cabinet. Note that the concentration of hypochlorite in bleach may vary between different bleach products and the dilution of the bleach stock may need to be adjusted accordingly.

Lentivirus production for hgRNA screening libraries or individual hgRNAs

• 71For large-scale virus production required for screening libraries, seed 8-9 x 10⁶ low-passage, mycoplasma-free HEK293T packaging cells in a 15 cm plate in 20 mL low-antibiotic growth media (DMEM + 10% FBS + 0.1% Pen/Strep). The number of plates for lentivirus production depends on the scale of the screen as well as the transduction efficiency of the targeted cell line. As a general guideline, virus produced from a single 15 cm plate should be sufficient for multiple screens, but we recommend setting up virus production in ~3 plates to buffer for lower production efficiency. For small-scale virus production for individual hgRNAs, seed 500-600 x 10³ low-passage, mycoplasma-free HEK293T packaging cells in a well of a 6-well plate in 2 mL low-antibiotic growth media (DMEM + 10% FBS + 0.1% Pen/Strep).
• 72Incubate cells for 24 h (37 °C, 5% CO₂). The cells should be 70-80% confluent at the time of transfection.
• 73
  Prepare a ~1:1:1 molar mixture of the three transfection plasmids (psPAX2, pMD2.G and pLCHKO) in Opti-MEM using the amounts listed in the table below. Flick the tube to mix the reagents.

  Component	Amount per 15 cm plate	Amount per 6-well
  Opti-MEM	100 μL	50 μL
  psPAX2	6.5 μg	725 ng
  pMD2.G	4 μg	525 ng
  pLCHKO hgRNA library or single hgRNA construct (Steps 68, 70A xvi, 70B ii, 70C viii)	6 μg	750 ng

• 74
  Prepare a separate mixture Opti-MEM and X-tremeGENE 9 as follows. Gently flick the tube to mix the reagents and incubate at room temperature for 5 min.

  Component	Amount per 15 cm plate	Amount per 6-well
  Opti-MEM	700 μL	50 μL
  X-tremeGENE 9	48 μL	6 μL

• 75Combine the entire volumes of the plasmid mix from Step 73 and the X-tremeGENE 9 mix from Step 74 to obtain a 3:1 ratio of transfection reagent:DNA complex. Mix by gently flicking the tube. Incubate the mix for 30 min at room temperature.
• 76If there are many floating HEK293T cells (Step 72), carefully change the media before transfection.
• 77Add the transfection mix to the packaging cells in a dropwise manner, distributing the mix across the plate.
• 78After 16 h, remove medium containing the transfection reagent and replace with 20 mL viral harvest medium.
• 79After 24h, harvest the lentivirus-containing supernatant in a 15 mL polypropylene storage tube and centrifuge at 500g for 5 min at 4 °C to remove cell debris.
• 80Aliquot supernatant into sterile screw cap storage tubes and store at 4 °C for short-term (for hours to few days) or −80 °C for long-term storage.

  PAUSE POINT Can be left overnight at 4°C or frozen for several weeks −80 °C.

Pooled CHyMErA screens (Timing 4-6 weeks)

Optimization of culture conditions (Timing 1-2 weeks)

• 81Ensure that the screened cell lines are mycoplasma-free before starting and after completing the screens. We recommend a PCR-based mycoplasma detection kit (e.g. e-Myco Plus Mycoplasma PCR Detection Kit), following the manufacturer’s instructions.
• 82Carefully optimize culture conditions of Cas9/Cas12a cells (Steps 16, 20) and determine optimal cell plating density in the chosen culture format. Typically, cell culture for pooled screens is performed in 15 cm plates and cells are seeded at a density of 1.5-5 x 10⁶ cells in 20-30 mL culture medium. The cell seeding density should allow for linear cell proliferation for 3-4 days and cells should be passaged before reaching full confluency. Measure the approximate doubling time of your cells under the chosen condition. Ensure that cells adhere reasonably well to tissue culture vessels. If working with cell lines growing in suspension adjust the subsequent passaging steps accordingly.
• 83Determine puromycin sensitivity of cell line by generating a killing curve. Dilution range should span 0-5 μg/mL in 0.5 μg/mL increments. The concentration of puromycin to be used in a screen should be 0.5-1 μg/mL higher than that required to kill 100% of uninfected cells in 48 h.
• 84Test cells for sensitivity to polybrene (up to 8 μg/mL) by doing a dose response curve in the same method as used for measuring puromycin sensitivity.

Determination of lentivirus Multiplicity of Infection (MOI) for CHyMErA screens (Timing 4 d)

• 85Before starting a screen, it is crucial to determine the Multiplicity of Infection (MOI) of the hgRNA library virus. Achieving a MOI of ~0.3 will minimize the probability of multiple hgRNA integrations in the same cell. MOI determination should be carried out under the same conditions as planned for the screen, using the specific Cas9/Cas12a cell line or clone, tissue culture plates, media constituents and volume, cell plating density, and pooled virus preps - without prior thawing - that will be used in the screen.

  CRITICAL To accurately determine MOI, it is important that non-selected cells continue to proliferate during the assay to prevent selected cells catching up due to lower cell confluence. Thus, a seeding density needs to be chosen that does not result in reaching full confluency and growth arrest within 72 h. Firstly, thaw a fresh aliquot of pooled CHyMErA hgRNA library lentivirus (Step 81) and keep on ice.

• 86Design dilution series of virus for MOI determination. Typically, we test ~6 volumes of virus between 10 and 200 μL and include controls as described below. Add each volume of virus in duplicates, with one plate to be puromycin selected and the other to be cultured in antibiotic-free medium. Include a non-infected control that will serve to monitor puromycin-sensitivity during the experiment.
• 87Seed optimized cell number of Cas9/Cas12a cells (Step 82) in 15 cm plates, add 20 mL cell-specific culture media and 8 μg/mL polybrene and briefly mix the plates. Then add the designated volume of virus and mix the plates thoroughly by manually rocking for 2 min before transferring them to the incubator.
• 8824 h after addition of virus, cells should be infected and tightly adhered to the plate. Remove media with virus using pipettes. Dispose of media and pipettes in 20% bleach solution (1% final concentration of hypochlorite).
• 89Gently wash plates with PBS to remove any extraneous virus. Dispose of PBS and pipette tips in 20% bleach solution (1% final concentration of hypochlorite).
• 90Add fresh media (25 mL for 15 cm plate) containing puromycin at the required concentration to plates of one virus dilution series and fresh media without puromycin to the other virus dilution series.
• 91After 48 h of puromycin selection, all uninfected cells should be dead. You must use a dose of puromycin that will kill all uninfected cells within 48 h. Note that some cells may require 72 h selection, in which case they need to be seeded at a cell density that ensures exponential growth of non-selected cells during that time period.
• 92Remove media, wash cells with PBS to dislodge remaining dead cells and add 2 mL trypsin to collect selected cells. Incubate cells in trypsin either at room temperature or 37 °C until they start to dislodge (typically 2-5 min).
• 93Add 10 mL culture media to each plate, resuspend the cells and count viable cells using an automated cell counter or a hemocytometer using Trypan blue viability staining. Graph the cell counts for the two series (+/− puromycin).
• 94Determine the virus volume that gives 20-30% survival with puromycin selection compared to infected unselected controls. This is the volume of virus required to achieve a MOI of 0.2-0.3 under the conditions used.

Pooled screen (Timing 3-4 weeks)

• 95
  Expand Cas9/Cas12a cell lines (Steps 16, 20) for library transduction at 250-fold representation at MOI of ~0.3. Typically, 70-100 x 10⁶ cells are required for the transduction of a ~90,000 hgRNA library. Taking the cell line’s proliferation rate into account, the total number of cells to be transduced should be sufficient such that at a MOI of 0.3, a cell number equal or higher to a 250-fold library size is present after puromycin selection. For example, for a 90,000 hgRNA library, a minimal number of 75 x 10⁶ cells (90,000 hgRNAs * 250-fold / 0.3 MOI) should be seeded. For cell lines with slower proliferation rates, seeding density may need to be increased in order to have enough cells available to start replicates at T0. We recommend calculating generously, allowing for MOI and proliferation fluctuations. In addition to the screening plates, three extra plates are required to monitor the puromycin selection and to calculate the actual MOI for the screen as outlined below:

  Sample	Number of Plates	Treatment
  Screening plates	Variable	Virus, + puromycin
  Negative Control	1	No virus, + puromycin (0% survival control)
  Positive Control	2 (2 replicates)	Virus, no puromycin (100% survival control)

• 96Thaw a fresh aliquot of pooled CHyMErA hgRNA library lentivirus (Step 80). Keep the virus on ice until it is used.
• 97Repeat Steps 87-89.
• 98Add fresh media (25 mL for 15 cm plate) containing puromycin at the required concentration and fresh media without puromycin to the respective control plates.
• 99After 48 (or 72) h of puromycin selection, all uninfected cells should be dead. Remove media, wash cells with 10 mL PBS to dislodge remaining dead cells (wash twice if necessary) and add 2 mL trypsin. Incubate for 2-5 min at room temperature or 37 °C until cells dislodge, add 10 mL culture medium per 15 cm plate, resuspend cells and collect them into one sterile container. Collect controls separately. Make sure that all cell clumps are dispersed by gentle repeated pipetting when harvesting cells from multiple plates.
• 100Count the viable cells from the pooled screening plates as well as the control plates using an automated cell counter or hemocytometer using Trypan blue or other viability stains. Determine the screen MOI by dividing the cell concentration of the transduced, puromycin-selected sample with the concentration of non-selected control sample. Ensure that the puromycin-selection is complete, indicated by the lack of viable cells on the non-transduced puromycin-treated control plate.
• 101Collect three samples from the transduced, puromycin-selected cell pool at a 400-fold library coverage into a 50 mL conical tube each (these samples serve as a reference time point for the screen and we thus recommend a high representation of 400-fold. For for later time points the representation can be reduced to 250-fold). Pellet cells by centrifugation at 335g for 5 min at room temperature. Discard supernatant, wash with 5 mL PBS, pellet cells again and thoroughly remove supernatant. To save freezer space, we recommend transferring the pellet to a smaller tube by resuspending the washed pellet in 1 mL PBS, transfer the cells to a 1.5 mL tube, pellet cells by centrifugation at 335g for 5 min at room temperature and carefully remove the supernatant. Label tubes and freeze the “dry” cell pellets at −20 or −80 °C. These are the ‘Time 0’ (T0) reference samples, one of which will be subjected to library preparation and sequencing (Step 108). The other two samples serve as backup and can be stored frozen for several weeks to months.
• 102From the remaining cell pool, plate cells into three replicate groups (e.g. replicates A, B, C) at the predetermined cell density (Step 82) onto equal number of plates. Do not use puromycin in this or in subsequent plating steps as this may affect proliferation rates. For dropout screens 250-fold coverage (or higher) of the library should be maintained throughout the screen for each replicate, while positive selection screens can be performed at 20-50-fold representation.

  CRITICAL Optionally, the screen may alternatively be performed with true biological replicates by separately repeating the library transduction three times instead of generating technical replicates stemming from one single library transduction.

• 103From the remaining cells in the pool, collect ~200 x 10³ cells for a mycoplasma test using commercially available kits such as the e-Myco Plus Mycoplasma PCR Detection Kit following manufacturer’s instructions.
• 104Passage the cells every 3-5 d out to the endpoint (~15-20 doublings). The pool-infected cells should be passaged at the same density that cells would normally be split when expanding them. At every passage, remove media, wash cells with 10 mL PBS and add 2 mL trypsin per 15 cm plate. Incubate for 2-5 min at room temperature or 37 °C until cells dislodge, add 10 mL culture medium per 15 cm plate, resuspend cells and collect them into one sterile container. Make sure that all cell clumps are dispersed by gentle repeated pipetting when harvesting cells from multiple plates.

  CRITICAL A transient slowing of cell growth after the infection may be noticed (especially for TP53 WT cells)⁵⁰, with a return to normal growth speed 5-10 d after infection.

• 105At every passage, pool cells from all the vessels in each separate replicate group with each other. Count cells and seed cells at 250-fold coverage for each replicate group exactly as done at T0.
• 106Collect three cell samples of at least 250-fold library coverage for each replicate group exactly as done at T0 (Step 101). Each pellet will receive a time (T) number and a replicate designation. This number corresponds to the number of days post puromycin selection (i.e. T0) that it was collected (e.g. T3_A, T6_B, T9_C, etc.).
• 107At the final time point, collect ~200 x 10³ cells for mycoplasma test. Note that for dropout screens we recommend a typical screening length of ~15-20 cell doublings but this can be customized based on the application and biological question.

Genomic DNA extraction of CHyMErA screening samples (Timing 4-6 h)

CRITICAL: gDNA extraction can be performed using various kits including the QIAamp Blood Maxi kit⁸⁶ (Qiagen) and the Wizard Genomic DNA Purification Kit (Promega). We recommend the Wizard Genomic DNA Purification Kit as a cost- and time-effective alternative to column-based DNA extraction kits and therefore describe the steps for this kit in this protocol. The steps described in this protocol are optimized for gDNA extraction from 20-50 × 10⁶ cells. Reagent volumes for extraction from 0.5-5 x 10⁶ cells (with the option of being paraformaldehyde-fixed) are indicated in brackets.

CRITICAL It is crucial to work in a clean environment to avoid contamination of the gDNA with plasmid DNA carrying guide RNA expression cassettes, which can substantially interfere with results. It is recommended to carefully clean the working surface as well as pipettes and racks with 10% bleach (0.5% final concentration of hypochlorite). Wipe all bleached material with water to remove bleach and subsequently wipe them with 70% ethanol. Aliquot out all required reagents to reduce contamination of stock reagents. Use filter tips for all steps and carefully eject tips to avoid creating aerosols.

• 108Thaw cell pellets (Steps 101, 106) at room temperature for 5 min.
• 109Optional: For paraformaldehyde-fixed cells add 120 μL 0.5 M EDTA solution (pH 8.0) to 500 μL Nuclei Lysis Solution in a 1.5 mL microfuge tube. Add 600 μL EDTA/Nuclei Lysis Solution to a 1.5 mL microfuge tube containing thawed cell pellet. Pipette 10 times with P1000 pipette, to resuspend cells and break up cell clumps. Add 20 μL Proteinase K (20 mg/mL or 800 units/mL) to nuclear lysate and mix the sample by inverting the tube 5 times. Incubate the mixture at 55 °C overnight. The next morning, allow the mixture to cool to room temperature for 5 min. Continue with RNase A treatment described in Step 112.
• 110Resuspend cell pellet (Step 108) in 1.4 mL PBS in a 50 mL centrifuge tube (optional: 200 μL in 1.5 mL tube for 0.5-5 x 10⁶ cells). If transferring cell pellet from a smaller tube, resuspend cells with 1 mL PBS, transfer cells to a 50 mL tube, then rinse the original tube with 400 μL PBS. Vortex for 20 s to ensure cells are completely resuspended. If required, pipette further with P1000 pipette, to break remaining cell clumps.
• 111Add 5 mL Nuclei Lysis Solution to the resuspended cells (optional: 600 μL for 0.5-5 x 10⁶ cells). Mix by pipetting with 10 mL pipette (5 times).
• 112Add 32 μL RNase A (20 mg/mL stock; final concentration of 100 μg/mL) to the nuclear lysate and mix the sample by inverting the tube 5 times (optional: 4 μL for 0.5-5 x 10⁶ cells). Incubate at 37 °C for 15 min, then let samples cool to room temperature (~10 min).
• 113Add 1.670 mL Protein Precipitation Solution (e.g. add 835 μL twice) to the nuclear lysate, and vortex vigorously for 20 s (optional: 200 μL for 0.5-5 × 10⁶ cells). Small protein clumps may be visible after vortexing.
• 114Centrifuge at 4,500g for 10 min at room temperature (optional: 13,000g for 0.5-5 x 10⁶ cells).

  CRITICAL We recommend using a swinging-bucket rotor centrifuge for best results during genomic DNA isolation.

• 115Using a 10 mL pipette, transfer the supernatant to a 50 mL centrifuge tube containing 5 mL isopropanol (optional: 600 μL for 0.5-5 x 10⁶ cells). Be very careful not to transfer any precipitate.
• 116Gently mix the solution 10 times by inversion, until the white thread-like strands of DNA form a visible mass.
• 117Centrifuge at 4,500g for 5 min at room temperature (optional: 13,000g for 5 min for 0.5-5 x 10⁶ cells). The DNA will be visible as a small white pellet.
• 118Carefully remove supernatant, avoid dislodging pellet. Add 5 mL room temperature 70% ethanol to the DNA (optional: 600 μL for 0.5-5 x 10⁶ cells). Gently rotate the tube to wash the DNA pellet and the sides of the centrifuge tube.
• 119Centrifuge at 4,500g for 5 min at room temperature (optional: 13,000g for 1 min for 0.5-5 x 10⁶ cells).
• 120Carefully remove supernatant, avoid dislodging pellet. If necessary, spin tube again and remove remaining ethanol with P200 pipette. Air-dry genomic DNA for 10-20 min at room temperature until pellet appears translucent. Do not over dry the pellet.
• 121Add 400 μL prewarmed TE buffer (DNA Rehydration Solution) to the tube (optional: 25 μL for 0.5-5 x 10⁶ cells). Let DNA dissolve by incubating at 65 °C for about 1 hour. Mix DNA by gently flicking the tube every 15 min until the pellet is completely dissolved. The suspension may be slightly viscous but should not contain any remaining clumps of DNA.
• 122If DNA does not dissolve completely, incubate tube at 65 °C for an additional 1 hour, gently flicking the tube every 15 min, and leave overnight at 4 °C. Addition of more TE buffer may also help to fully resuspend the DNA.
• 123Centrifuge at 4,500g for 1 min at room temperature and transfer genomic DNA to a 1.5 mL tube (optional: 13,000g for 0.5-5 x 10⁶ cells).
• 124Centrifuge at 20,000g for 3 min at 4 °C and transfer supernatant to a 1.5 mL low-binding tube. This step eliminates any unsuspended DNA pellet.
• 125Quantitate DNA and measure purity by spectrophotometry with a Nanodrop or Qubit instrument using Qubit dsDNA BR Assay (recommended) following manufacturer’s recommendation. Store genomic DNA at −20 °C where it can be kept for long-term storage for weeks to months.

  ?TROUBLESHOOTING

Preparation of sequencing libraries amenable for next-generation sequencing (Timing 1-2 d)

CRITICAL It is crucial to work in a clean environment to avoid contamination of the PCR reagents with gDNA or plasmid DNA, which can substantially interfere with results. It is therefore recommended to prepare PCR master mixes (up to the step of addition of gDNA in Step 128) in a clean PCR hood. No genomic (or plasmid) DNA should enter the PCR hood. If setting up PCR reactions outside of a PCR hood it is recommended to physically separate from work areas where plasmid purification is performed. In general, it is highly recommended to carefully clean all working surface as well as pipettes and racks with 10% bleach following by wiping them with water and 70% ethanol. Aliquot out all required reagents to reduce contamination of stock reagents. Use filter tips for all steps and carefully eject tips to avoid creating aerosols. We also recommend to clean agarose gel equipment (gel tray, comb and tank) with 0.1 N HCl for 10 min prior to casting gels.

• 126Optional: Set up a diagnostic PCR (one single 50 μL reaction) using the conditions outlined in Step 127. Run 2 μL on a 1% agarose gel at 90 V for 1 h. If the correct PCR product (~660 bp) is detected proceed with setting up 16 reactions as described in Step 127.

  ?TROUBLESHOOTING

• 127
  Set up PCR 1 using total of 56 μg of genomic DNA. Add 3.5 μg of genomic DNA per 50 μL reaction. Set up 16 identical 50 μL reactions as follows to achieve a library coverage of around 100-fold (56 μg of genomic DNA yields a 95-fold coverage of a 90k hgRNA library assuming a diploid human genome - ~6.5 pg - and integration of a single hgRNA per genome). In addition, always perform one PCR without any genomic DNA template in order to ensure there is no contaminating template (for PCR 1 and 2, Steps 127, 131). Prepare master mix without genomic DNA in the PCR hood. Add genomic DNA at the workstation and distribute master mix into 0.2 mL PCR strip tubes (50 μL/tube).

  Component	Amount per reaction	Final concentration	Master mix (16.5x)
  Genomic DNA	3.5 μg	0.07 μg/μL	57.75 μg
  PCR1_Hybrid_Outer_F2, 10 μM	2.25 μL	0.45 μM	37.125 μL
  PCR1_Hybrid_Outer_R1, 10 μM	2.25 μL	0.45 μM	37.125 μL
  NEBNext Ultra II Q5 Master Mix, 2x	25 μL	1x	412.5 μL
  H2O	To 50 μL		To 825 μL
  Total	50 μL

• 128
  Amplify reactions in a thermocycler using the following program:

  Cycle number	Denature	Anneal	Extend
  1	98 °C, 30 s
  2-26	98 °C, 10 s	65 °C, 30 s	72 °C, 20 s
  27			72 °C, 2 min

• 129Run 2 μL of PCR 1 product on a 1% agarose gel containing SYBR Safe DNA stain at 90 V for 1 h. Visualize the PCR product on a gel imager. PCR 1 yields a product of 661 bp (Fig. 3f).
• 130Carefully pool all individual 50 μL reactions for each genomic DNA sample, mix by vortex.

  PAUSE POINT PCR products can be left overnight at 4 °C or frozen for several days at −20 °C.

• 131
  Set up PCR 2 using unique i5 and i7 index primer combinations (Table 1) for each individual sample to allow subsequent pooling of sequencing libraries (optional: avoid reusing the same primer in multiple combinations to reduce the effect of index hopping during Illumina sequencing), as follows. Set up one 50 μL reaction for each sample and use 1 μL of the pooled PCR 1 product as template. Set up PCR reaction without PCR 1 template in the PCR hood. At the workstation add 1 μL of pooled PCR 1 template.

  Component	Amount per reaction	Final concentration
  PCR 1 product	1 μL
  TruSeq i5 Fwd, 10 μM	2.5 μL	0.5 μM
  TruSeq i7 Rev, 10 μM	2.5 μL	0.5 μM
  NEBNext Ultra II Q5 Master Mix, 2x	25 μL	1x
  Water	19 μL
  Total	50 μL

• 132
  Amplify reaction in a thermocycler using the following program:

  Cycle number	Denature	Anneal	Extend
  1	98 °C, 30 s
  2-11	98 °C, 10 s	55 °C, 30 s	65 °C, 15 s
  12			65 °C, 5 min

• 133Run 50 μL of PCR 2 product on a 2% agarose gel containing SYBR Safe DNA stain at 90 for 1.5-2 h (low voltage is recommended for resolving PCR 2 product). Use large combs and allow for ample space between samples. PCR 2 yields a product of ~ 330 bp. Multiple bands may be visible (including PCR 1 product) and thus it is important to separate bands well (Fig. 3f).
• 134Visualize the PCR product on blue light transilluminator (UV-light may damage sequencing libraries) and excise the 330 bp band.

  ?TROUBLESHOOTING

  PAUSE POINT Gel slices can be left overnight at −20 °C.

• 135Purify DNA from agarose gel slice using a gel extraction kit, following manufacturer’s instructions. We recommend performing a wash step with binding buffer following binding of the PCR product to the extraction column. We also recommend a double elution to maximize yield.
• 136Quantitate and measure purity of sequencing library on both NanoDrop and Qubit fluorometer using the Qubit dsDNA BR Assay Kit.
• 137Store gel-purified DNA in a 1.5 mL low-binding tube at −20 °C for days to weeks.

Next-generation sequencing of CHyMErA screening libraries (Timing 2 d)

CRITICAL Steps 138-140 are usually performed by NGS sequencing centers.

• 138Assess the fragment size distribution of the generated libraries using a BioAnalyzer. One single product of 330 bp should be detected for the purified libraries. Estimate final concentrations by quantitative PCR with reverse transcription following Illumina’s guidelines (Illumina SY-930-1010).

  ?TROUBLESHOOTING

• 139
  Pool sequencing libraries and sequence on Illumina NextSeq 500 or NovaSeq 6000 using paired-end sequencing (other instruments may also be used). For NextSeq 500/550 use Mid/High Output 150-cycle chemistry with dual-index. For NovaSeq 6000, use 100-cycle chemistry with dual-index (30 cycle excess provided). We recommend the use of dark cycles, (i.e. base additions without imaging), to read through the constant region covering the end of the U6 promoter and the transcription terminator (Fig. 5). The actual read begins after the dark cycles. The following paired-end sequencing strategy is recommended for CHyMErA hgRNA libraries (126 reads in total): The first read should start with 29 dark cycles, followed by 27 cycles for reading the Cas12a guide and an index read of 8 cycles. The paired read should start with an index read of 8 cycles followed by 20 dark cycles and 27 cycles for reading the Cas9 guide.

  Step	Number of reads
  Dark cycles (DC)	29
  Read 1 (R1)	27
  Index read 1 (IR1)	8
  Index read 2 (IR2)	8
  Dark cycles (DC)	20
  Read 2 (R2)	27

  ?TROUBLESHOOTING

• 140For dropout screens, it is recommended to read each sample at 200-fold library coverage. A higher coverage of 400-fold is recommended for T0 samples. For strong positive selection screens, a 50-fold coverage may be sufficient for the identification of enriched hgRNAs. Always include T0 sample to determine library representation for the particular screen and for the determination of fold change of hgRNAs over time.

Analysis of next-generation sequencing data (Timing 1-4 weeks)

CRITICAL Steps 141-148 provide a broad overview about the procedure required to analyze CHyMErA sequencing data. Please refer to ‘Procedure 1: Processing CHyMErA Data’ of the accompanying Orthrus protocol which describes the computational steps in more details and provides scripts for the processing and analysis of CHyMErA combinatorial screens⁶⁵.

• 141Demultiplex sequencing reads using the i5/i7 barcode key used to generate the sequencing libraries.

  ?TROUBLESHOOTING

• 142Process FASTQ files from paired-end sequencing to trim off flanking sequences up- and downstream of the guide sequence. Discard reads that do not contain the expected 3′ anchor sequence, allowing up to two mismatches.
• 143Align preprocessed paired reads to a FASTA file containing the library guide sequences using Bowtie with the following parameters: -v 3 (allowing three mismatches) -l 18 (requiring minimum guide length of 18 nts) -chunkmbs 256 (number of megabytes of memory a given thread is given to store path descriptors) –t <library_name> (all-clock time for library).

  ?TROUBLESHOOTING

• 144Count the number of mapped read pairs for each hgRNA construct and merge along with annotations into a matrix using a customized R script⁶⁵.
• 145Normalize read counts to 1 million reads per sample using the Bioconductor package edgeR or other packages. Following depth normalization, only constructs with more than one count per million (CPM) in at least two samples should be retained.
• 146Determine the read count distribution across the hgRNA library for each time point. For the starting time point (i.e. T0), a tight library distribution is expected as no hgRNAs are expected to drop out or become enriched during the relatively short puromycin selection period. Thus, most hgRNAs should be present at similar numbers. For later time points or sorted populations, the distribution is expected to broaden as certain constructs will likely drop out or enrich over time.

  CRITICAL It is important to check for individual hgRNA outliers that may be present at much higher read numbers in the starting population or at individual time points. Such outliers can be manually removed from the data set to avoid bias in downstream analysis.

  ?TROUBLESHOOTING

• 147Determine fold-change of hgRNAs between end time points and starting reference time point (i.e. T0) using the Bioconductor package edgeR or other packages.

  Following these general data processing steps, use different analytical approaches depending on the biological question addressed in the screen. This may include analysis of depleted or enriched hgRNAs targeting a given gene or genetic fragment with the Bioconductor package edgeR or other packages. Codes for dual-targeting, genetic interaction and exon-deletion scoring are available on GitHub (https://github.com/HenryWard/chymera-scoring; https://github.com/BlencoweLab/CHyMErA_exonDelScoring)²¹. An accompanying protocol describes in detail computational approaches for genetic interaction mapping using CHyMErA combinatorial screens⁶⁵.

• 148Assess screen performance using positive and negative controls built into the library (e.g. dropout of hgRNAs targeting core essential and non-essential genes).

Timing

Steps 1-20: Generation of mammalian cell lines that stably express Cas9 and Cas12a (Timing 3-4 weeks)

Generation of Cas9 and Cas12a lentivirus (Timing 4 d)

Transduction of mammalian cell lines with Cas9 and Cas12a lentivirus (Timing 2-3 weeks)

Steps 21-22: Cell line characterization and assessment of CHyMErA editing efficiency (Timing 4-9 d)

1. Exon deletion assay (Timing 4-5 d)

2. 6-thioguanine and thymidine toxicity assay (Timing 8-9 d)

Steps 23-33: Amplification of existing screening library (Timing 2-3 d)

Steps 34-69: Cloning of hybrid guide (hg)RNA screening libraries into pLCHKO vector (Timing 4-6 weeks)

Design and synthesis of DNA oligo libraries (Timing 2-4 weeks)

Cloning of hgRNA libraries into pLCHKO vector (Timing 2-3 weeks)

Step 70: Cloning of individual hgRNAs into pLCHKO vector

1. hgRNA cloning using restriction enzymes (Timing 1 week)

2. Cloning of individual hgRNAs using DNA synthesis services (Timing 4 weeks)

3. Cloning of dsDNA fragments into pLCHKO (Timing 2 weeks)

Steps 71-80: Lentivirus production for (hg)RNAs (Timing 4 d)

Steps 81-107: Pooled CHyMErA screens (Timing 4-6 weeks)

Optimization of culture conditions. (Timing 1-2 weeks)

Determination of lentivirus Multiplicity of Infection (MOI) for CHyMErA screens. (Timing 4 d)

Pooled screen. (Timing 3-4 weeks)

Steps 108-125: Genomic DNA extraction of CHyMErA screening samples (Timing 4-6 h)

Steps 126-137: Preparation of sequencing libraries amenable for next-generation sequencing (Timing 1-2 d)

Steps 138-140: Next-generation sequencing of CHyMErA screening libraries (Timing 2 d)

Steps 141-148: Analysis of next-generation sequencing data (Timing 1-4 weeks)

Troubleshooting

Troubleshooting advice can be found in Table 2.

Table 2.

Troubleshooting table.

Step	Problem	Possible reason	Solution
22	Low editing efficiency of generated Cas9/Cas12a cell lines.	Silencing of Cas nucleases, integration into silent genomic regions, low expression of Cas nucleases or poor nuclear localization.	Single cell cloning of the pool of Cas9/Cas12a expressing cells may allow selection of cell clones with more robust editing efficiency (Steps 17-20). Besides assessing editing efficiency using the listed assays it is also recommended to assess protein levels and nuclear expression of the Cas nucleases using western blotting and immunofluorescence microscopy.
41	Low yield of the oligo amplification PCR.	Oligo used as input in the PCR reaction may be too high or too low.	Titrate the amount of oligos to be used in the PCR reaction to determine the optimized concentration. Set up large scale PCR reaction using the optimized amount.
42	In addition to the expected 157 bp library product an additional low molecular size band (~ 40 bp) may be visible on the agarose gel.	Primer dimers may not be efficiently removed during the PCR purification step.	Run the complete remaining purified PCR product on a 2.5% agarose gel, excise the amplified library product and purify using a gel extraction kit following manufacturer’s recommendations. Quantify the product with a NanoDrop UV spectrophotometer and analyze 3 μL to check its integrity on a 2.5% agarose gel.
51, 56	Missing guide sequences or detection of wrong guide combinations.	Recombination between the lentiviral plasmid backbone or template switching during library amplification47,61–63.	Make sure to use recombination-deficient bacterial strains and culture bacteria at 30 °C to further reduce recombination rates. To minimize template switching during the PCR amplification of the library oligos it is recommended to keep the number of cycles in step 41 low (10 cycles or less).
70A x	Degradation of plasmid during digestion reaction.	The plasmid DNA may be contaminated with endonuclease I. Endonuclease I contamination can occur when purifying plasmids from E. coli strains with an intact EndA gene (e.g. Stbl3 cells).	Use a plasmid purification kit that supplies a wash buffer that can be used to remove traces of endonuclease during an additional wash step. Alternatively, E. coli strains carrying an inactivating mutation in the EndA gene may be used (e.g. NEB Stable Competent E. Coli, New England Biolabs, cat. no. C3040H).
125	DNA yield lower than expected based on harvested cell number.	Low DNA yield may indicate incomplete resuspension of cell pellet, loss of DNA during wash steps or incomplete resuspension of DNA pellet.	Try to further resuspend the DNA pellet by incubating it for longer at 65 °C or by adding additional TE buffer. Alternatively, repeat genomic DNA extraction with cell pellets replicates (if possible, we recommend collecting three cell pellets for each time point replicate). Pay attention to completely resuspend cells, carefully wash DNA pellet and completely resuspend DNA pellet. If low yield persists, cell number during harvest may have been miscalculated. Combine extracted DNA from all replicate pellets, precipitate using 0.2 M final concentration of NaCl and 2 volumes of ethanol, and resuspend the pellet in smaller volume of TE buffer.
127	Low yield of PCR product.	Input gDNA may be too high or impure.	Reduce the amount of genomic DNA per reaction or further purify the genomic DNA by precipitation with NaCl (0.2 M final concentration) and ethanol (2 volumes).
134	No or low yield of PCR 2 product.	Input of PCR 1 product may be too low.	Increase the amount of PCR 1 template to 2-5 μL per reaction. It is not recommended to increase the cycle numbers as PCR 2 only serves to attach the adapter sequences and indexes rather than further amplifying the PCR 1 product.
138	Impure sequencing library.	Contamination with primers, primer dimers or intermediate PCR products during agarose gel band excision or during gel extraction.	Repeat PCR 2 and gel extraction if the sequencing libraries are not pure. Ensure that the bands are well separated to allow precise excision of the 330 bp fragment.
139	Option to run dark cycles is not available.	No dark cycle protocol available or not implemented by sequencing facility.	If dark cycles are not available, it is necessary to include stagger regions in the PCR 2 primers to promote sequence diversity during the first few imaging cycles that read the constant promoter and transcription terminator regions.
141	Detection of unwanted combinations of i5-i7 indices in sequencing data.	Index hopping during Illumina sequencing of pooled sample libraries.	The problem of index hoping may be enhanced with the use of patterned flow cells with exclusion amplification chemistry. To mitigate this problem, only pool libraries prior to sequencing and try to use unique dual indexing pooling combinations (if possible, avoid reusing the same i5 and i7 indexes in multiple combinations).
143	Detection of guide combinations that have not been designed as part of the library.	Recombined guide constructs are predominantly generated as a result of template switching by viral reverse transcriptase during production of the lentiviral library or viral transduction.	Typically, ~5% of reads from plasmid samples and ~20% of screen samples may represent recombined guide constructs. These reads may be discarded in downstream analysis. To reduce intermolecular recombination during lentivirus production, a non-integrating lentiviral co-packaging plasmid may be transfected along with the screening library62. However, this will come with the caveat of reduced lentiviral titers and may require concentration of the lentivirus using ultracentrifugation.
146	Broad distribution of hgRNA library detected at the beginning of the screen.	A broad library distribution peak at T0 may indicate unequal representation of hgRNAs in the plasmid library. This may be due to low library coverage during the cloning or amplification of the plasmid library.	We recommend sequencing the plasmid library to assess library quality. If problems with the library plasmid are detected it may be necessary to re-clone the library or perform a second amplification at a higher library coverage.
146	A single hgRNA construct may dominate the sequencing reads of an individual time point or across the screen.	The plasmid library, genomic DNA, DNA extraction reagents or PCR reagents may be contaminated with a hgRNA plasmid.	An outlier sequence may be removed computationally from the sequencing data but depending on the situation, further sequencing rounds may be needed to reach a sufficient library coverage. To overcome the contamination, genomic DNA extraction and sequencing libraries may need to be repeated. To avoid contamination with single hgRNA plasmids, take extra caution when cloning screening libraries, extracting genomic DNA and preparing sequencing library PCRs. We recommend aliquoting reagents and careful cleaning of all work surfaces and equipment prior to library cloning and screen sample processing. Ideally, a dedicated area devoid of any hgRNA plasmids should be used to prepare PCR master mixes (i.e. PCR hood).

Anticipated results

This protocol describes the generation of mammalian cell lines expressing SpCas9 and LbCas12a as well as the construction of CHyMErA hgRNAs that can be employed for robust combinatorial genome editing for focused and screening applications. We recommend characterizing the cell line before applying this system to large-scale high-throughput screening libraries. This includes assessing Cas9 and Cas12a protein expression. An example for anticipated Cas9 and Cas12a protein levels is provided in the western blot presented in Fig. 3a. Note that expression of the nucleases alone is not the sole requirement for high performance of the CHyMErA system. It is expected that the editing efficiency will vary between individual hgRNAs but also between cell lines and subpopulations of the same cell line. It is thus critical to test the editing efficiency of newly established CHyMErA cell lines using the exon-deletion and drug resistance assays described in Steps 21-22 of this protocol before applying this system to large-scale high-throughput screening libraries. The data presented in Figs. 3b and 3c depict anticipated results of these experiments in human HAP1 and RPE-1 cell lines.

This protocol further describes the generation of pooled screening libraries and focused hgRNA constructs using restriction enzyme-based cloning of CHyMErA hgRNA libraries. It is recommended to check the product of the library oligo amplification reaction on an agarose gel in order to confirm the correct size of the anticipated amplification product (Fig. 3d). It is also critical to ensure complete digestion of the pLCHKO vector backbone (Fig. 3e) to increase ligation efficiency.

The generated screening libraries can be applied for the systematic perturbation of cohorts of genes, gene combinations or genetic sites, but also for the targeted interrogation of specific editing events that is dependent on lentiviral delivery of guide constructs. Given the use of lentivirus infection, hgRNA expression cassettes become stably integrated into the host genome and thus the hgRNA sequence serves as a barcode carrying the information of the specific genetic perturbation of a given cell. Accordingly, at the start and end point of the screen, genomic DNA (gDNA) is extracted from the assayed cell pool and hgRNA barcodes are amplified, indexed and subjected to Illumina sequencing (Fig. 5) to determine hgRNA barcode abundance over time or in response to a certain treatment. As an example of an anticipated result from a proliferation-based dropout screen we refer the reader to previously published data for a screen performed in HAP1 cells (Fig. 3g)²¹. This data highlights the improved performance of combinatorial CHyMErA screens demonstrated by the enhanced dropout of hgRNAs targeting core essential genes compared to single Cas9- or Cas12a-targeting systems. This dropout is specific to the targeting of core essential genes and not observed when targeting other protein-coding genes or intergenic sites (Fig. 3g). As described in the ‘Experimental design’ section above, the targeting of core essential and non-essential genes may also be used to assess screen performance independently of the chosen phenotypic screening readout.

The anticipated size for pooled screening libraries traditionally ranges between 2-90k guides which allows the interrogation of several thousand genomic targets with multiple hgRNA constructs. The application of such libraries in combination with various phenotypic readouts holds promise to uncover fundamental insights into the functional role of genomic elements in an unbiased, systematic manner. While the analysis and interpretation of sequencing data for guide pairs may be more challenging than for traditional gRNA screens with a single nuclease, software packages such as Orthrus (presented in an accompanying protocol⁶⁵) aim to simplify this analysis for combinatorial negative selection dropout screens.

Overall, the CHyMErA system provides an efficient, programmable and modular combinatorial genome editing platform suitable for various applications. The specific design of individual guide pairs (or further multiplexed) encoded within a hgRNA enables selected combinations of targets as opposed to random pairing of individual guides. This feature is crucial for the targeted perturbation of paralogs or the excision of genetic segments, both of which depend on the selected pairing of Cas9 and Cas12a guides. Importantly, hgRNAs are expressed from a single promoter which, in conjunction with the distinct guide structure and sequences between Cas9 and Cas12a guides, help to reduce recombination between guide pairs during library cloning and template switching during library PCR preparation. Furthermore, the single promoter ensures equal expression of the multiple guide components. Finally, the use of two nucleases that each depend on a different PAM site greatly expands the targeting space across the genome. CHyMErA’s ability to concurrently target up to four genetic sites in addition to the option to fuse different effector domains to the Cas nucleases open the door for the high-throughput investigation of more complex and higher-order combinatorial genome perturbations. In summary, the versatility of CHyMErA makes it a powerful tool to systematically study a variety of loci and thus uncover individual genes, genetic segments, and genetic networks with critical phenotypic roles.

Data availability

All plasmids and CHyMErA screening libraries described in this protocol are available from Addgene (http://www.addgene.org/) and a detailed list of the respective Addgene reagent numbers are provided in the reagent section of this protocol. Published example data sets²¹ can be accessed via Gene Expression Omnibus (GEO) GSE144281, https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE144281.

Code Availability Statement

Published codes for dual-targeting, genetic interaction and exon-deletion scoring are available on GitHub (https://github.com/HenryWard/chymera-scoring; https://github.com/BlencoweLab/CHyMErA_exonDelScoring)²¹. An accompanying protocol describes in detail computational approaches for the processing of Illumina sequencing data and the mapping of genetic interaction using CHyMErA combinatorial screens⁶⁵.