Skip to main content
NCBI home page
BMC Oral Health logoLink to BMC Oral Health
. 2025 Jul 31;25:1289. doi: 10.1186/s12903-025-06632-9

Lactate inhibits mouse embryonic palatal mesenchyme cells chondrogenesis through AKT-PKM2 axis

Mingyue Meng 1, Xige Zhao 1, Xiaoyu Zheng 1, Xiaotong Wang 1, Xia Peng 1, Zhiwei Wang 1, Shiteng Wang 1, Cui Guo 2, Juan Du 1,2,✉
PMCID: PMC12315313  PMID: 40745297

Abstract

Background

The development of the palate is a complex and continuous process, occurring in a series of stages with cartilage of being particular significance. Chondrogenesis is influenced by many factors such as metabolism, and hypoxia which are also risk factors for cleft palate. Hypoxia can increase the intracellular lactate levels due to increased glycolysis. However, the precise role of lactate in palatal cartilage development remains unclear.

Methods

Mouse embryonic palatal mesenchyme (MEPM) cells isolated from embryonic day 13.5 (E13.5) and E12.5 were obtained and characterized using immunofluorescence. Subsequently, following a 21-day induction culture in a chondrogenic medium, the MEPM cells were subjected to alcian blue staining and to quantitative real-time PCR to examine the ability of the cells to form a cartilage matrix under the influence of lactate, hypoxia, and a combination of both. The expression levels of glycolysis-related enzymes, hypoxia-inducible factor-1α (HIF-1α), and the phosphoinositide 3-kinase/AKT signaling pathway were examined using western blot and quantitative real-time PCR to investigate the mechanism of lactate in palatal cartilage development.

Results

The findings indicated that extracellular lactate supplementation impeded the formation of cellular cartilage matrix in comparison to the control group. Then hypoxia was observed to induce intracellular lactate accumulation and also inhibited the capacity of MEPM cells to form cartilage matrix. This process was associated with an increased expression of glycolysis-related enzymes and enhanced AKT signaling pathway activity.

Conclusions

This study demonstrates that lactate can inhibit palatal cartilage development and affect the process of glycolysis. Lactate inhibits palatal cartilage matrix formation by activating the AKT-PKM2 axis. This study contributes to our understanding of the role of lactate in palatal cartilage development. It provides a new direction for the etiology of cleft palate and a theoretical basis for its prevention and early intervention.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12903-025-06632-9.

Keywords: Cleft palate, MEPM cells, Lactate, Chondrogenesis, Hypoxia, Glycolysis

Background

Congenital cleft palate is one of the most common developmental maxillofacial anomalies [1]. Cleft palate not only seriously affects facial aesthetics, but also leads to malnutrition due to difficulty in sucking, causing varying degrees of psychological and economic trauma to children and parents [2]. The craniofacial skeleton develops through two ossification patterns: intramembranous and endochondral [3]. Cartilage, made up of chondrocytes and a matrix of water, collagen fibers, aggrecan, and inorganic salts, serves as the primary scaffold in early embryonic development. Collagen fibers and aggrecan are crucial for the matrix’s functionality [4–6]. Type II collagen, made of α1 chains, is the main protein produced by chondrocytes [5], while aggrecan retains over 70% of the matrix’s water [7]. Both are vital for maxillary development. Previous research indicate Wnt9b dysfunction can lead to cleft palate by affecting type II collagen alpha1 (Col2α1) expression [8], and lack of the epigenetic regulator MLL4 can impair mid-palate suture closure by reducing Col2α1 and aggrecan expression [9]. These findings highlight the crucial role of Col2α1 and aggrecan in maintaining cartilage matrix stability, with their dysfunction linked to various developmental defects, especially cleft palate [10]. Glycolysis serves as the primary metabolic pathway in chondrocytes, playing a pivotal role in maintaining the stemness of chondrogenic progenitor cells [11]. A substantial amount of energy is required to sustain cellular stemness during embryonic development, suggesting that glycolysis is indispensable to this process [12]. While glycolysis is crucial for embryonic chondrocyte development, its abnormal activation may cause abnormal lactate accumulation [13]. Notably, lactate has been shown to influence several key biological processes [14–18], and its role in pregnancy is of significant interest [19–21]. Lactate can influence key processes such as vascular and nervous system formation, differentiation of neural crest stem cells towards the osteoblast lineage, and embryo implantation by regulating gene expression and cell signaling [14–18]. Elevated lactate levels resulting from maternal inflammation may traverse the placental barrier, potentially disrupting the microenvironment essential for embryonic development [22]. In our previous study, we observed an increase in lactate content in amniotic fluid, maternal plasma, and palatal tissue of offspring following induction of cleft palate by retinoic acid (RA) [23], suggesting the existence of a regulatory axis between mother and embryo mediated by lactate metabolism. Furthermore, lactate has been shown to inhibit type II collagen synthesis and to induce chondrocyte senescence in the context of rheumatoid arthritis[24]. Nevertheless, the contribution of aberrant lactate accumulation to the pathogenesis of cleft palate, particularly in relation to cartilage formation, remains insufficiently elucidated.

Lactate accumulation in the extracellular environment is commonly observed under pathological conditions, especially hypoxia [15]. Oxygen levels are precisely regulated during early human pregnancy [25]. During organogenesis, mammalian embryos are typically exposed to partial hypoxia, a condition crucial for the proper development of the cardiovascular system [26]. However, excessively prolonged hypoxia can result in congenital developmental defects in the embryo [27], including cleft palate [28]. Evidence suggests that under adverse conditions such as hypoxia, chondrocytes adapt to microenvironmental changes by modifying their metabolic pathways [13]. In chondrocytes lacking prolyl-hydroxylase (PHD), the metabolic changes induced by HIF-1α lead to decreased collagen synthesis and increased collagen modification [13, 28]. The PI3K/AKT signaling pathway is closely linked to glycolysis in hypoxia [29, 30]. However, the role of lactate in palatal chondrogenesis related to hypoxia also remains inadequately understood.

In this study, we focused on investigating the impact of elevated lactate levels on glycolysis and cartilage matrix formation, and explored the potential exacerbation of these effects under hypoxic conditions. Our findings indicate that both lactate and hypoxia can inhibit cartilage matrix formation through modulation of the AKT-PKM2 signaling axis. Notably, the concurrent presence of hypoxia and lactate results in a distinct pattern of change. By analyzing the influence of lactate and hypoxia on cartilage matrix formation in MEPM cells, we aim to provide a new direction for the etiology of cleft palate and a theoretical basis for its prevention and early intervention.

Methods

Isolation and culture of MEPM cells

MEPM cells were derived from pregnant ICR mice at embryonic day (E) 13.5 and E12.5 (obtained from Sibeifu Company, China). All experimental protocols were reviewed and approved by the Experimental Animal Ethics Committee of Beijing Stemmatological Hospital of Capital Medical University (Ethics Approval No. KQYY-202409-002). The experiments were conducted in accordance with the standards of the International Assessment and Accreditation of Laboratory Animals Care (AAALAC) and the Beijing Municipal Regulations on Laboratory Animal Management. The experimental animals were housed in the IVC independent ventilation system, and the environmental parameters were strictly controlled under the conditions of temperature (25 ± 1) °C, relative humidity (50 ± 5) %, and 12 h/12 h circadian rhythm. Animals were given free access to sterilized standard rodent feed and sterile drinking water, and bedding was changed daily with tertiary protection. Post-operative pain management was carried out in accordance with ISO 10,993 standards to ensure comprehensive protection of the five basic welfare principles for laboratory animals.

The palatal shelves were isolated and MEPM cells were obtained by digestion with 0.25% trypsin (25200-072, Gibco, USA) for 30 min at 37 °C. The cells were cultured in Dulbecco’s Modified Eagle Medium/F12 (DMEM/F12, SH30023.01, Cytiva, China) supplemented with 10% fetal bovine serum (C04400, Vivacell, China) and 1% penicillin/streptomycin (C100CS, NCM Biotech, China). The cells were also cultured in a chondrogenic-induced differentiation medium (MUXMX-90041, Oricell, China). MK-2206 (HY-10358, MCE, China) and shikonin (HY-N0822, MCE, China) were used as AKT inhibitors and PKM2 inhibitors in chondrogenic cultures.

Immunofluorescence staining

The slides were initially transferred to 12-well plates. Subsequently, MEPM cells in optimal condition were extracted and inoculated onto the slides. Following an overnight incubation period, the cells were washed three times with PBS. The cells were subsequently fixed with 4% paraformaldehyde for 30 min. Subsequently, the cells were incubated with a 0.25% Triton X-100 solution for 10 min, which served to permeabilize the cell membrane. Subsequently, the cells were blocked with 2.5% bovine serum albumin for one hour. The cells were treated with anti-vimentin (A19607, ABclonal, China, 1:200) and CK14 (60320-1-Ig, Proteintech, China, 1:200) at 4 °C overnight. On the subsequent day, the cells were incubated with a secondary antibody (35552 and A-11005, Thermo Fisher, China) for one hour at room temperature. The film was blocked with 4’,6-diamidino-2-phenylindole (DAPI) (P0131, Beyotime, China). Subsequently, the images were examined under a fluorescence microscope.

Quantitative real-time PCR (qRT-PCR)

Total RNA was extracted from cartilage tissue that had been cultured for 21 days using the Ultrapure RNA Kit (CW0580, CWbio, China). Subsequently, reverse transcription and real-time reverse transcription polymerase chain reaction were conducted using NovoScript Plus cDNA Synthesis SuperMix. Total RNA was extracted from palatal mesenchymal cells using TRIzol (ThermoFisher Scientific, Waltham, MA, USA). cDNA was prepared using NovoScript Plus cDNA Synthesis SuperMix (Evrogen, Moscow, Russia). Then it was amplified on a CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) using SsoAdvanced Universal SYBR Green SuperMix (Bio-Rad, Hercules, CA, USA), with a set of primer pairs. β-actin was used as an internal calibrator. The sequences of the primers used are given in Table 1. Data were processed by GraphPad Prism 9.

Table 1.

Primer sequences used for quantitative RT-PCR

Genes Primer sequences
Col2α1 Forward (5'-3') TGGCTTCCACTTCAGCTATG
Reverse (5'-3') AGGTAGGCGATGCTGTTCTT
Aggrecan Forward (5'-3') CCTGCTACTTCATCGACCCC
Reverse (5'-3') AGATGCTGTTGACTCGAACCT
Hif-1α Forward (5'-3') ACCTTCATCGGAAACTCCAAAG
Reverse (5'-3') ACTGTTAGGCTCAGGTGAACT
β-actin Forward (5'-3') GTGACGTTGACATCCGTAAAGA
Reverse (5'-3') GCCGGACTCATCGTACTCC
Open in a new tab

Lactate amount test

The lactate amount in E13.5 MEPM cells was tested by CheKine™ Lactate Colorimetric Assay Kit (Abbkine Scientific Co, China). The cells were collected into a centrifuge tube, washed with cold PBS, and then subjected to centrifugation. The resulting supernatant was discarded, and the cells were incubated in assay buffer at a ratio of 1 mL/5 million at 0 °C. Subsequently, the cells were disrupted by ultrasonic waves for five minutes (20% power or 200 W, 3 s on, 7 s off, repeated 30 times). Subsequently, the cells were subjected to centrifugation at 12,000 g for five minutes at a temperature of 4 °C. Following this, the supernatant was removed and placed on ice in preparation for measurement. The optical absorbance values were measured by a SpectraMax Paradigm microplate reader (Molecular Devices, CA, USA) at 450 nm.

Western blot

Following the isolation of total protein from chondrocytes using RIPA buffer containing a protease inhibitor and a phosphatase inhibitor, protein quantification was performed. The protein samples were subjected to sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS-PAGE) and subsequently transferred to a polyvinylidene fluoride (PVDF) membrane. Following a 1-hour incubation with 5% skimmed milk, the membranes were incubated with primary antibodies, including anti-HIF-1α (YT2133, Immunoway, China, 1:1500), anti-HK2 (22029-1-AP, Proteintech, China, 1:10000), anti-PKM2 (15822-1-AP, Proteintech, China, 5000), anti-LDHA (21799-1-AP, Proteintech, China, 1:10000), anti-α-tubulin (11224-1-AP, Proteintech, China, 1:10000), anti-p-AKT (9271, Cell Signaling, China, 1:1000), anti-AKT (4691, Cell Signaling, China, 1:1000), anti-p-PI3K (AP1463, ABclonal, China, 1:5000), anti-PI3K (27035-1-AP, Proteintech, China, 1:1500), anti-p-mTOR (2971, Cell Signaling, China, 1:1000), and anti-mTOR (28273-1-AP, Proteintech, China, 1:5000). These incubations were conducted overnight at 4 °C. Subsequently, the bands were incubated with the corresponding horseradish peroxidase (HRP)-conjugated goat anti-rabbit secondary antibodies (AS014, ABclonal, China, 1:10000) and HRP-conjugated goat anti-mouse secondary antibodies (AS003, ABclonal, China, 1:10000). Subsequently, visualization was conducted using SuperSignal West Pico ECL reagent (Thermo Fisher Scientific, Waltham, MA, USA) and a ChemiDoc imaging system (Bio-Rad, CA, USA).

Chondrogenic induction of differentiation

The palatal mesenchymal stem cells were taken in good condition and spread in six-well plates with 2 × 10⁵ cells per well. Once the cells had adhered to the surface, the chondrogenic medium was added. The medium was changed every two or three days for three consecutive weeks. The cells were cultured at 37 °C with 5% CO₂ in a humidified incubator.

Alcian blue staining

Following a three-week chondrogenic induction culture, the culture medium was discarded, the cells were washed three times with PBS, fixed with 4% paraformaldehyde for 30 min, washed three times with PBS, stained with 1% Alcian blue, and washed off the excess Alcian blue staining solution. The samples were then observed under a microscope. The proteoglycan was further quantified by adding 4 M guanidine hydrochloride overnight, after which the absorbance value at 600 nm was measured by a microplate reader the following day. Each sample was repeated three times, and the average value was calculated. The OD value was found to be proportional to the expression of proteoglycan.

Statistical analysis

The statistical analysis was conducted using the statistical software package SPSS 19.0 (SPSS Inc., USA) and GraphPad Prism 9 (GraphPad, USA). A Student’s t-test was employed to ascertain whether the two groups exhibited a statistically significant discrepancy. A one-way ANOVA, followed by Tukey’s multiple comparison tests, was employed to ascertain the significance of differences between multiple groups of experimental data. The data shown were from representative experiments with 3 biological replicates and 3 technical replicates. A p-value of less than 0.05 was considered statistically significant.

Result

Morphology and origin of mouse embryonic palatal mesenchyme (MEPM) cells

Firstly, we investigated the morphology and origin of E13.5 MEPM cells. Under the microscope, E13.5 MEPM cells were polygonal in shape (Fig. 1A). Vimentin is a mesenchymal type III intermediate filament protein whose expression is upregulated during epithelial-mesenchymal transition, making it a marker for cells of mesenchymal origin. Cytokeratin 14 (CK14) is an important part of the intermediate filament cytoskeleton of epithelial cells and can be used to label epithelial cells. Thus, we determined the origin of the MEPM cells by immunofluorescence staining for vimentin and CK14. As observed by fluorescence microscopy, vimentin was positively expressed in the cells, whereas CK14 was negatively expressed (Fig. 1B), confirming that the MEPM cells were of mesenchymal origin. Next, the medium was replaced with the chondrogenic medium when the aggregation of the cells had reached approximately 95%. We found there was no significant difference in cell morphology when cells were observed under the microscope before and after 21 days of chondrogenic culture (Fig. 1C).

Fig. 1.

Fig. 1

Open in a new tab

Identification of the source of MEPM cells. (A) Observation of P1 to P3 E13.5 MEPM cells morphology under the microscope. Scale bar: 500 μm. (B) E13.5 MEPM cells were identified by immunofluorescence staining for vimentin (green) and CK14 (red). Scale bar: 100 μm. (C) Comparison of cells before and after 21 days of chondrogenic culture. Scale bar: 500 μm

Extracellular lactate inhibits MEPM cells chondrogenesis

The objective of the investigation is to assess the impact of lactate on the capacity of MEPM cells to synthesize the palatal cartilage matrix. We added different concentrations of lactate extracellularly and evaluated the chondrogenic ability of MEPM cells after 21 days. Alcian blue staining and quantitative analysis showed that lactate inhibited glycosaminoglycan production in a concentration-dependent manner (Fig. 2A). The transcription levels of type Col2α1 and aggrecan, markers of chondrogenesis, were reduced, as shown by qRT-PCR (Fig. 2B). Consequently, the elevated extracellular lactate level can impede the synthesis of the cellular cartilage matrix of MEPM cells.

Fig. 2.

Fig. 2

Open in a new tab

Extracellular lactate inhibited the formation of the cartilage matrix. (A) The Alcian blue staining and quantification map of E13.5 MEPM cells after 21 days of chondrogenic culture with different concentrations of lactate. Scale bar: 100 μm. (B) The mRNA levels of Col2α1 and aggrecan gene expression. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001

Cobalt chloride (CoCl2)-induced hypoxia inhibits the formation of the cartilage matrix by increasing the level of intracellular lactate, which is further exacerbated by an increase in extracellular lactate

During embryonic development, transient hypoxia is beneficial for normal development. However, numerous studies have shown that severe hypoxia may result in abnormalities of embryonic development [25–27]. Given the above findings, a further investigation was carried out to ascertain the effect of hypoxia on the development of palatal cartilage. In our preceding investigations, the appropriate concentration of CoCl2 for optimal activity has been identified. Accordingly, a concentration of 5 µmol/L of CoCl2 was selected to conduct an experimental investigation. Then, the impact of hypoxia on the capacity of MEPM cells to synthesize cartilage matrix was observed. The analysis of Alcian blue staining and the quantitative results of proteoglycan expression demonstrated that hypoxia inhibited the formation of the cartilage matrix (Fig. 3A). Furthermore, the qRT-PCR result showed a reduction in the expressions of mRNA for Col2α1 and aggrecan under hypoxia (Fig. 3B). Since hypoxia was reported to increase intracellular lactate [31], the Micro Lactate Assay Kit was employed to detect alterations in intracellular lactate content in the cobalt chloride-induced hypoxia group. These findings demonstrated that hypoxia resulted in a notable elevation in the intracellular lactate concentration of MEPM cells when compared to the control group (Fig. 3C). Thus, hypoxia inhibits the formation of extracellular cartilage matrix in E13.5 MEPM cells.

Fig. 3.

Fig. 3

Open in a new tab

Hypoxia increased the level of intracellular lactate and inhibited the MEPM cells chondrogenesis. (A) The Alcian blue staining and quantification map of E13.5 MEPM cells after 21 days of chondrogenic culture with CoCl2 (5 µmol/L). Scale bar: 100 μm. (B) The mRNA levels of Col2α1 and aggrecan gene expressions. (C) The quantitative map of intracellular lactate content. The MEPM cells were treated by CoCl2 (5 µmol/L) for 7 days. (D) The Alcian blue staining and quantification map of E13.5 MEPM cells after 21 days of chondrogenic culture with lactate (5 mM), CoCl2 (5 µmol/L) and both together. Scale bar: 100 μm. ***p < 0.001, ****p < 0.0001

Numerous identified risk factors can increase extracellular lactate levels during embryonic development, including inflammation, intense exercise, and ischemia [31, 32]. We wondered what the effect would be of a combination of risk factors on abnormal changes in the intracellular and extracellular lactate levels. Extracellular lactate under hypoxia caused by Cobaltous chloride (CoCl2) was used as a model for abnormal changes in both the intracellular and extracellular lactate levels. In our preceding study, the combination of a high lactate level (10 mM) and CoCl2 was observed to result in a more extensive spectrum of cell death. Consequently, we found that the additional addition of lactate (5 mM) under hypoxia further inhibited cartilage matrix formation, as shown by Alcian blue staining and quantitative results (Fig. 3D).

Embryonic development is a highly sophisticated and dynamically and continuously regulated process. To investigate the effect of lactate on cartilage matrix formation at a much earlier stage of embryonic development, we initially isolated E12.5 MEPM cells by the same methodology and subsequently subjected these to extracellular and intracellular (CoCl2-induced) lactate treatments to explore their effects on the formation of palatal cartilage matrix. Alcian blue staining revealed that lactate significantly inhibited cartilage matrix formation at the E12.5 stage (Fig. S1A). Furthermore, the results of the qRT-PCR analysis indicated that the accumulation of both intra- and extracellular lactate suppressed the expression of col2α1 and aggrecan (Fig. S1B). These findings aligned with the outcomes observed in experimental studies conducted on E13.5 stage cells.

Lactate from extracellular or intracellular sources enhances glycolysis during the formation of the palatal cartilage matrix

It has been demonstrated that lactate, the end product of glycolysis, inhibits the formation of cartilage matrix in the palate. To gain further insight into the role of glycolysis in this process, we examined the expression of glycolysis-related metabolic enzymes. Western blot results showed that the expression of glycolysis-related enzymes in the CoCl2 group was enhanced compared with the control group, such as HK2, PKM2 and LDHA (Fig. 4A, B). The accumulation of extracellular lactate also increased the expression of LDHA (Fig. 4A, B). These results showed enhanced glycolysis whether extracellular or intracellular lactate was present. Interestingly, when both intracellular and extracellular lactate were increased (lactate under CoCl2), the glycolysis-related enzymes, particularly PKM2, were downregulated compared with CoCl2 alone.

Fig. 4.

Fig. 4

Open in a new tab

Glycolysis was activated by both extracellular and intracellular lactate. (A) The protein levels of HK2, PKM2, and LDHA after 7 days of chondrogenic culture. (B) The quantification map of protein levels. (C) The Alcian blue staining of E13.5 MEPM cells after 21 days of chondrogenic culture with lactate (5 mM), CoCl2 (5 µmol/L) and the PKM2 inhibitor shikonin. Scale bar: 100 μm. (D) The Alcian blue staining quantification map. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001

To further resolve the role of PKM2 in cartilage matrix formation, we specifically inhibited PKM2 activity under conditions of lactate accumulation. Alcian blue staining and quantitative analysis showed an increase in cartilage matrix formation following inhibition of PKM2 expression under conditions of abnormal lactate accumulation (Fig. 4C, D).

Lactate promotes AKT phosphorylation

Given that HIF-1α is a pivotal regulatory switch in hypoxic conditions, we initially investigated the expression and transcription of HIF-1α under disparate treatment groups. Our results confirmed that hypoxia increased HIF-1α protein expression (Fig. 5A, B), but had no significant effect on RNA levels (Fig. 5C). This might be because cellular hypoxia induced by CoCl2 mainly prevented HIF-1α protein degradation and thus maintained HIF-1α protein expression. The addition of a high lactate concentration extracellularly yielded no notable effect on HIF-1α protein expression relative to the control group (Fig. 5A, B). It was unexpected that the elevation in extracellular lactate concentration resulted in the repression of HIF-1α transcript levels (Fig. 5C), with no discernible alterations at the protein level in comparison to the CoCl2-treated group (Fig. 5A, B). In order to gain further insight into the potential regulatory mechanism, we investigated the expression of the PI3K/AKT signaling pathway. The western blot result showed that both the high concentration lactate and CoCl2-induced hypoxia groups increased the expression of phosphorylated AKT, which activates the PI3K/AKT pathway compared to the control group (Fig. 5A, B). However, compared to the CoCl2-induced hypoxia group alone, lactate supplementation under hypoxia resulted in a significant reduction in phosphorylated AKT (Fig. 5A, B), similar to the previous trend of reduced PKM2 expression (Fig. 4A, B).

Fig. 5.

Fig. 5

Open in a new tab

Lactate activated the AKT pathway. (A) The protein levels of HIF-1α, p-PI3K, PI3K, p-AKT, AKT, p-mTOR and mTOR after 7 days of chondrogenic culture. (B) The quantification map of HIF-1α, p-PI3K, PI3K, p-AKT, AKT, p-mTOR and mTOR. (C) The mRNA level of HIF-1α gene expression after 7 days of chondrogenic culture. ns > 0.05, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001

Lactate regulates cartilage matrix formation through the AKT-PKM2 signaling axis

In order to elucidate whether the effect of lactate on glycolysis-related enzymes was mediated through AKT signaling, the AKT inhibitor MK-2206 was utilized to inhibit its activity. The result showed that MK-2206 effectively blocked the activation of phosphorylated AKT (Fig. 6A). The upregulation of HK2, LDHA, and PKM2 expressions, induced by both intracellular (CoCl2-treated) and extracellular lactate accumulation, was significantly attenuated upon inhibition of AKT function, suggesting that lactate facilitates glycolytic processes through activation of AKT (Fig. 6B, C).

Fig. 6.

Fig. 6

Open in a new tab

Lactate regulates matrix formation in cartilage via AKT-PKM2 signaling. (A) The protein levels of p-AKT and AKT after treatment with the AKT inhibitor MK-2206. (B) The protein levels of HK2, PKM2, and LDHA after 7 days of chondrogenic culture. (C) The quantification map of protein levels. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001

In conclusion, these results show that lactate affects cartilage matrix formation in the palate via the AKT-PKM2 signaling axis. Lactate enhances the expression of glycolytic enzymes by activating AKT, and PKM2 acts as a downstream effector molecule directly involved in the regulation of cartilage development.

Discussion

Cleft palate is a common developmental defect with a complex etiology that is associated with both genetic and environmental factors [2]. In mice, early palatal shelves grow vertically on either side of the tongue, after which the palatal shelves elevate to grow horizontally above the tongue and eventually contact, fuse and ossify along the midline to form a complete palate [1]. Since the synthesis of the cartilage matrix in the palate is important for palatal shelves fusion, abnormal cartilage development might be one of the reasons for CP occurrence (8–10). On the other hand, abnormal cartilage development often affects multiple sites, for instance, patients diagnosed with chondrodysplasia typically exhibit both short limbs and structural defects of the palate with Col2α1 and Sox9 genes [33–35]. Also, the disturbance of the development of Meckel’s cartilage, which is important for mandibular development, could lead to CP [36, 37]. This suggested the importance of cartilage development during palatal formation.

Lactate plays a regulatory role in cartilage development and influences the development of associated diseases [38, 39]. Regulating imbalances in lactate metabolism provides a new therapeutic approach to the treatment of rheumatoid arthritis [39]. Our study revealed that lactate could inhibit the cartilage matrix formation by MEPM cells, which was in accord with previous studies.

Among many risk factors for the occurrence of cleft palate, hypoxia is a critical one [26]. Hypoxia is frequently associated with an elevated production and subsequent release of lactate [40, 41]. Therefore, we investigated the association between lactate and hypoxia in the context of palatal cartilage development. CoCl2, a typical hypoxia mimics, is able to increase HIF-1α protein stability by blocking HIF-1α protein degradation, which leads to intracellular hypoxia [42, 43]. In our study, CoCl2was used to mimic cellular hypoxic conditions, which could increase lactate and reduce cartilage matrix. There are numerous circumstances that may result in an elevated lactate concentration. For example, this may occur as a result of strenuous exercise, inflammatory reactions, vascular dysplasia, or ischemic encephalopathy [16, 44, 45]. These risk factors or lesion sites are frequently associated with hypoxia, which plays a crucial role in the development of various organ systems during normal fetal growth and development [26]. Furthermore, lactate can be employed as an early indicator of pregnancy [45, 46]. Maternal health plays a pivotal role in the normal development of the fetus [47–49]. When a pregnant woman is afflicted by conditions such as chronic hypoxia, uterine ischemia, and inflammatory reactions, the level of lactate in the maternal-fetal interface, plasma, and amniotic fluid is increased, which results in uteroplacental insufficiency and developmental toxicity [26, 49–52].

To enhance our comprehension of the function of multiple risk factor accumulation in palatal development, we added a CoCl2-lactate combined group to mimic the situation where both intracellular and extracellular lactate were increased. We found that either lactate or CoCl2 alone inhibited the formation of cartilage matrix and increased the expressions of glycolysis enzymes HK2, PKM2 and LDHA. Interestingly, when CoCl2 was combined with lactate, the expressions of glycolysis enzymes were downregulated, especially PKM2. PKM2 plays a significant role in cellular function [53–55]. In the context of cancer therapy, PKM2 knockdown has been observed to impede the survival and proliferation of cancerous cells [54]. To confirm the function of PKM2 on cartilage matrix formation, we then inhibited PKM2 expression under conditions of either intracellular (CoCl2-induced) or extracellular lactate accumulation and investigated the effective rescue of cartilage matrix formation of MEPM cells, which suggested PKM2 played a key role during palate cartilage matrix formation.

Much evidence has shown that the expression level of PKM2 is closely related to AKT activity [55–58]. For instance, it has been demonstrated that by phosphorylating the serine residue at position 37 of PKM2, AKT was able to enhance its dimer formation and promote its translocation to the nucleus, thereby regulating glycolytic flux and gene expression [58]. We then observed the expressions of AKT signaling under different lactate conditions. It was demonstrated that lactate was able to significantly activate AKT phosphorylation, which had the same tendency as PKM2 under different lactate conditions. As other studies have shown PKM2 could regulate AKT signaling [59], to confirm the relationship between PKM2 and AKT signaling, we used AKT inhibitor MK-2206 and found a significant decrease in protein expression of PKM2, which indicated that AKT regulated PKM2 when lactate existed during palate development. In addition to this, it was also observed that mTOR activity changed differently in the lactate and CoCl2 groups. The level of mTOR phosphorylation increased in the lactate-treated group, but decreased instead in the CoCl2-treated group. This discrepancy may be attributable to the multifaceted regulation of mTOR by downstream factors of AKT. For instance, it has been hypothesized that HIF-1α may inversely regulate mTOR activity through multiple pathways in hypoxic microenvironments [60, 61]. Furthermore, in our studies, we found that the HIF-1α protein level exhibited a negative correlation trend with mTOR activity. Consequently, we hypothesize that HIF-1α may exert a counterproductive effect on mTOR in the CoCl2-induced hypoxia model. However, this hypothesis requires further validation through rigorous experimentation.

In the group of CoCl2 combined with cellular lactate, the formation of cartilage matrix remained at a low level despite a decrease in PKM2 and phosphorylated AKT expression. This outcome may be attributable to the presence of additional pathways associated with cellular damage. For instance, it has been established that CoCl2 compromises mitochondrial membrane potential within cells by increasing the generation of reactive oxygen species [62, 63]. Moreover, lactate has been demonstrated to affect cell function [14]. These studies suggest that even in circumstances where PKM2 and AKT signaling are inhibited, the multiple stresses triggered by CoCl2 and lactate may still disrupt cellular structure and functions, ultimately impeding the recovery of cartilage matrix formation.

However, there are some limitations to our study. Firstly, the specific molecular mechanism has yet to be elucidated. Subsequent experiments will investigate how AKT regulates PKM2 through direct transcriptional regulation or indirect regulation of protein stability, etc. Secondly, the role of lactylation in this context requires further investigation.Thirdly, hypoxia induced by CoCl2 may interfere with chondrogenesis through other signaling pathways, for example, Sylvain Provot et al. found that hypoxia inhibits chondrocyte maturation and differentiation by activating the HIF-1α pathway [63], which needs further study. To overcome the limitations of current in vitro studies, we will expand our research to include both in vivo lactate models and in vitro palatal organoid cultures, which is necessary to comprehensively analyze lactate’s function in palatal development.

Conclusion

Lactate, a metabolite of glycolysis, can interfere with palatal development by inhibiting the formation of the cartilage matrix through the AKT-PKM2 axis, which provides a new direction for examining the etiology of cleft palate and a theoretical basis for its prevention and early intervention.

Electronic supplementary material

Below is the link to the electronic supplementary material.

12903_2025_6632_MOESM1_ESM.pdf (993.7KB, pdf)

Supplementary Material 1: Fig. S1. Effect of lactate on cartilage matrix formation in E12.5 MEPM cells. (A) The Alcian blue staining and quantification map of E12.5 MEPM cells after 21 days of chondrogenic culture with lactate (5 mM), CoCl2 (5 µmol/L) and both together. Scale bar: 100 μm. (B) The mRNA levels of Col2α1 and aggrecan gene expressions. ns > 0.05, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001

Acknowledgements

Not applicable.

Abbreviations

MEPM

Mouse embryonic palatal mesenchyme

E

Embryonic day

HIF-1α

Hypoxia-inducible factor-1α

CoCl2

Cobaltous chloride

RA

Retinoic acid

PKM2

Pyruvate kinase M2

GLUT

Glucose transporter proteins

HK2

Hexokinase2

LDHA

Lactate dehydrogenase A

CK14

Cytokeratin 14

Col2α1

Type II collagen alpha1

PHD

Prolyl-hydroxylase

Author contributions

J.D. and M.M. conceived and designed the study, reviewed the manuscript, and made final approval of the manuscript; M.M. carried out most of the experiments, X.Z., X.W., X.Z., X.P., Z.W, S.W. and C.G. acquired, analyzed, and interpreted the data; J.D., M.M. and X.Z. reviewed the manuscript; All authors read and approved the final manuscript.

Funding

This research was funded by grants from the National Natural Science Foundation of China (grant numbers 82170912, and 82370910), and Beijing Natural Science Foundation (grant numbers 7252059).

Data availability

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

All animal protocols were approved by the Animal Care and Use Committee at Beijing Stomatological Hospital, affiliated with Capital Medical University (permit number: KQYY-202409-002, Beijing, China). Animal suffering is minimized.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Mossey PA, Little J, Munger RG, Dixon MJ, Shaw WC. Cleft lip and palate. Lancet (London England). 2009;374(9703):1773–85. [DOI] [PubMed] [Google Scholar]
  • 2.Dixon MJ, Marazita ML, Beaty TH, Murray JC. Cleft lip and palate: understanding genetic and environmental influences. Nat Rev Genet. 2011;12(3):167–78. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Roth DM, Bayona F, Baddam P, Graf D. Craniofacial development: neural crest in molecular embryology. Head Neck Pathol. 2021;15(1):1–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Benders KE, van Weeren PR, Badylak SF, Saris DB, Dhert WJ, Malda J. Extracellular matrix scaffolds for cartilage and bone regeneration. Trends Biotechnol. 2013;31(3):169–76. [DOI] [PubMed] [Google Scholar]
  • 5.Eyre DR, Weis MA, Wu JJ. Articular cartilage collagen: an irreplaceable framework? Eur Cell Mater. 2006;12:57–63. [DOI] [PubMed] [Google Scholar]
  • 6.Eyre DR. Collagens and cartilage matrix homeostasis. Clin Orthop Relat Res. 2004;S118–22. [DOI] [PubMed]
  • 7.Hardingham TE, Fosang AJ, Dudhia J. The structure, function and turnover of aggrecan, the large aggregating proteoglycan from cartilage. Eur J Clin Chem Clin Biochem. 1994;32(4):249 − 57. [PubMed]
  • 8.Curtin E, Hickey G, Kamel G, Davidson AJ, Liao EC. Zebrafish wnt9a is expressed in pharyngeal ectoderm and is required for palate and lower jaw development. Mech Dev. 2011;128(1–2):104 − 15. [DOI] [PubMed]
  • 9.Lee JM, Jung H, Pasqua BPM, Park Y, Tang Q, Jeon S, Lee SK, Lee JW, Kwon HE. MLL4 regulates postnatal palate growth and midpalatal suture development. Front Cell Dev Biol. 2025;13:1466948. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Li SW, Prockop DJ, Helminen H, Fässler R, Lapveteläinen T, Kiraly K, Peltarri A, Arokoski J, Lui H, Arita M, et al. Transgenic mice with targeted inactivation of the Col2 alpha 1 gene for collagen II develop a skeleton with membranous and periosteal bone but no endochondral bone. Genes Dev. 1995;9(22):2821–30. [DOI] [PubMed] [Google Scholar]
  • 11.Shi J, Du G. Metabolic reprogramming of Glycolysis favors cartilage progenitor cells rejuvenation. Joint Bone Spine. 2024;91(2):105634. [DOI] [PubMed] [Google Scholar]
  • 12.Chi F, Sharpley MS, Nagaraj R, Roy SS, Banerjee U. Glycolysis-Independent glucose metabolism distinguishes TE from ICM fate during mammalian embryogenesis. Dev Cell. 2020;53(1):9–e264. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Mobasheri A, Vannucci SJ, Bondy CA, Carter SD, Innes JF, Arteaga MF, et al. Glucose transport and metabolism in chondrocytes: a key to Understanding chondrogenesis, skeletal development and cartilage degradation in osteoarthritis. Histol Histopathol. 2002;17(4):1239–67. [DOI] [PubMed] [Google Scholar]
  • 14.Philp A, Macdonald AL, Watt PW. Lactate–a signal coordinating cell and systemic function. J Exp Biol. 2005;208(Pt 24):4561–75. [DOI] [PubMed] [Google Scholar]
  • 15.Li X, Yang Y, Zhang B, Lin X, Fu X, An Y, et al. Lactate metabolism in human health and disease. Signal Transduct Target Therapy. 2022;7(1):305. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Tian Q, Zhou LQ. Lactate activates germline and cleavage embryo genes in mouse embryonic stem cells. Cells. 2022;11(3):548. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Hannan NJ, et al. Analysis of fertility-related soluble mediators in human uterine fluid identifies VEGF as a key regulator of embryo implantation. Endocrinology. 2011;152(12):4948–56. [DOI] [PubMed] [Google Scholar]
  • 18.Ratter JM, et al. In vitro and in vivo effects of lactate on metabolism and cytokine production of human primary PBMCs and monocytes. Front Immunol. 2018;9:2564. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Ouyang J, Wang H, Huang J. The role of lactate in cardiovascular diseases. Cell Commun Signal. 2023;21(1):317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Wiberg-Itzel E, Pembe AB, Wray S, Wihlbäck AC, Darj E, Hoesli I, Åkerud H. Level of lactate in amniotic fluid and its relation to the use of oxytocin and adverse neonatal outcome. Acta Obstet Gynecol Scand. 2014;93(1):80–5. 10.1111/aogs.12261. Epub 2013 Oct 15. PMID: 24102442. [DOI] [PubMed]
  • 21.Murphy M, Butler M, Coughlan B, Brennan D, O’Herlihy C, Robson M. Elevated amniotic fluid lactate predicts labor disorders and Cesarean delivery in nulliparous women at term. Am J Obstet Gynecol. 2015;213(5):e6731–8. [DOI] [PubMed] [Google Scholar]
  • 22.Pierce M, Kurinczuk JJ, Spark P, Brocklehurst P, Knight M, UKOSS. Perinatal outcomes after maternal 2009/H1N1 infection: National cohort study. BMJ. 2011;342:d3214. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Wang Y, Chen J, Wang X, Guo C, Peng X, Liu Y, Li T, Du J. Novel investigations in retinoic-acid-induced cleft palate about the gut Microbiome of pregnant mice. Front Cell Infect Microbiol. 2022;12:1042779. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Huang YF, Wang G, Ding L, Bai ZR, Leng Y, Tian JW, Zhang JZ, Li YQ, Ahmad, Qin YH, Li X, Qi X. Lactate-upregulated NADPH-dependent NOX4 expression via HCAR1/PI3K pathway contributes to ROS-induced osteoarthritis chondrocyte damage. Redox Biol. 2023;67:102867. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Hartshorne GM. Factors controlling embryo viability. Hum Fertil (Cambridge England). 2001;4(4):225–34. [DOI] [PubMed]
  • 26.Webster WS, Abela D. The effect of hypoxia in development. Birth Defects Res Part C Embryo Today: Reviews. 2007;81(3):215–28. [DOI] [PubMed] [Google Scholar]
  • 27.Dunwoodie SL. The role of hypoxia in development of the mammalian embryo. Dev Cell. 2009;17(6):755–73. [DOI] [PubMed] [Google Scholar]
  • 28.Küchler EC, Silva LAD, Nelson-Filho P, Sabóia TM, Rentschler AM, Granjeiro JM, et al. Assessing the association between hypoxia during craniofacial development and oral clefts. J Appl Oral Science: Revista FOB. 2018;26:e20170234. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Semenza GL. HIF-1 mediates metabolic responses to intratumoral hypoxia and oncogenic mutations. J Clin Invest. 2013;123(9):3664–71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Xie Y, Shi X, Sheng K, Han G, Li W, Zhao Q, Jiang B, Feng J, Li J, Gu Y. PI3K/Akt signaling transduction pathway, erythropoiesis and Glycolysis in hypoxia (Review). Mol Med Rep. 2019;19(2):783–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Ivashkiv LB. The hypoxia-lactate axis tempers inflammation. Nat Rev Immunol. 2020;20(2):85–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Rabinowitz JD, Enerbäck S. Lactate: the ugly duckling of energy metabolism. Nat Metab. 2020;2(7):566–71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Ain NU, Makitie O, Naz S. Autosomal recessive chondrodysplasia with severe short stature caused by a biallelic COL10A1 variant. J Med Genet. 2018;55(6):403–7. [DOI] [PubMed] [Google Scholar]
  • 34.Vissers LE, Lausch E, Unger S, Campos-Xavier AB, Gilissen C, Rossi A, Del Rosario M, Venselaar H, Knoll U, Nampoothiri S, Nair M, Spranger J, Brunner HG, Bonafé L, Veltman JA, Zabel B, Superti-Furga A. Chondrodysplasia and abnormal joint development associated with mutations in IMPAD1, encoding the Golgi-resident nucleotide phosphatase, gPAPP. Am J Hum Genet. 2011;88(5):608–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Bi W, Huang W, Whitworth DJ, Deng JM, Zhang Z, Behringer RR, de Crombrugghe B. Haploinsufficiency of Sox9 results in defective cartilage primordia and premature skeletal mineralization. Proc Natl Acad Sci U S A. 2001;98(12):6698–703. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Seegmiller RE, Fraser FC. Mandibular growth retardation as a cause of cleft palate in mice homozygous for the chondrodysplasia gene. J Embryol Exp Morphol. 1977;38:227–38. [PubMed] [Google Scholar]
  • 37.Pitirri MK, et al. Meckel’s cartilage in mandibular development and dysmorphogenesis. Front Genet. 2022;13:871927. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Zhang X, Wu Y, Pan Z, Sun H, Wang J, Yu D, Zhu S, Dai J, Chen Y, Tian N, Heng BC, Coen ND, Xu H, Ouyang H. The effects of lactate and acid on articular chondrocytes function: implications for polymeric cartilage scaffold design. Acta Biomater. 2016;42:329–40. [DOI] [PubMed] [Google Scholar]
  • 39.Yi O, Lin Y, Hu M, Hu S, Su Z, Liao J, Liu B, Liu L, Cai X. Lactate metabolism in rheumatoid arthritis: pathogenic mechanisms and therapeutic intervention with natural compounds. Phytomedicine. 2022;100:154048. 10.1016/j.phymed.2022.154048. Epub 2022 Mar 15. [DOI] [PubMed] [Google Scholar]
  • 40.Tian Q, Li J, Wu B, Wang J, Xiao Q, Tian N, et al. Hypoxia-sensing VGLL4 promotes LDHA-driven lactate production to ameliorate neuronal dysfunction in a cellular model relevant to alzheimer’s disease. FASEB Journal: Official Publication Federation Am Soc Experimental Biology. 2023;37(12):e23290. [DOI] [PubMed] [Google Scholar]
  • 41.Yang Z, Su W, Wei X, Qu S, Zhao D, Zhou J, et al. HIF-1α drives resistance to ferroptosis in solid tumors by promoting lactate production and activating SLC1A1. Cell Rep. 2023;42(8):112945. [DOI] [PubMed] [Google Scholar]
  • 42.Zhang YB, Wang X, Meister EA, Gong KR, Yan SC, Lu GW, Ji XM, Shao G. The effects of CoCl2 on HIF-1α protein under experimental conditions of autoprogressive hypoxia using mouse models. Int J Mol Sci. 2014;15(6):10999–1012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Chen R, Xu J, She Y, Jiang T, Zhou S, Shi H, et al. Necrostatin-1 protects C2C12 myotubes from CoCl2-induced hypoxia. Int J Mol Med. 2018;41(5):2565–72. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Faude O, Kindermann W, Meyer T. Lactate threshold concepts: how valid are they? Sports Med (Auckland NZ). 2009;39(6):469–90. [DOI] [PubMed] [Google Scholar]
  • 45.Bakker J, Postelnicu R, Mukherjee V, Lactate. Where Are We Now? Crit Care Clin. 2020;36(1):115–24. [DOI] [PubMed] [Google Scholar]
  • 46.Ma LN, Huang XB, Muyayalo KP, Mor G, Liao AH. Lactic acid: A novel signaling molecule in early pregnancy? Front Immunol. 2020;11:279. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Gardner DK. Lactate production by the mammalian blastocyst: manipulating the microenvironment for uterine implantation and invasion? BioEssays: news and reviews in molecular, cellular and developmental biology. 2015;37(4):364–71. [DOI] [PMC free article] [PubMed]
  • 48.Li L, Zheng P, Dean J. Maternal control of early mouse development. Development. 2010;137(6):859–70. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Condic ML. The role of Maternal-Effect genes in mammalian development: are mammalian embryos really an exception?? Stem Cell Reviews Rep. 2016;12(3):276–84. [DOI] [PubMed] [Google Scholar]
  • 50.DeSesso JM. Maternal factors in developmental toxicity. Teratog Carcinog Mutagen. 1987;7(3):225–40. [DOI] [PubMed] [Google Scholar]
  • 51.Orczyk-Pawilowicz M, Jawien E, Deja S, Hirnle L, Zabek A, Mlynarz P. Metabolomics of human amniotic fluid and maternal plasma during normal pregnancy. PLoS One. 2016;11(4):e0152740. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Faa G, Manchia M, Pintus R, Gerosa C, Marcialis MA, Fanos V. Fetal programming of neuropsychiatric disorders. Birth Defects Res Part C Embryo Today: Reviews. 2016;108(3):207–23. [DOI] [PubMed] [Google Scholar]
  • 53.Damasceno LEA, Prado DS, Veras FP, Fonseca MM, Toller-Kawahisa JE, Rosa MH, Públio GA, Martins TV, Ramalho FS, Waisman A, Cunha FQ, Cunha TM, Alves-Filho JC. PKM2 promotes Th17 cell differentiation and autoimmune inflammation by fine-tuning STAT3 activation. J Exp Med. 2020;217(10):e20190613. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Qin X, Du Y, Chen X, Li W, Zhang J, Yang J. Activation of Akt protects cancer cells from growth Inhibition induced by PKM2 knockdown. Cell Biosci. 2014;4:20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Yang X, Chen W, Zhao X, Chen L, Li W, Ran J, et al. Pyruvate kinase M2 modulates the Glycolysis of chondrocyte and extracellular matrix in osteoarthritis. DNA Cell Biol. 2018;37(3):271–7. [DOI] [PubMed] [Google Scholar]
  • 56.Feng J, Li J, Wu L, Yu Q, Ji J, Wu J, Dai W, Guo C. Emerging roles and the regulation of aerobic Glycolysis in hepatocellular carcinoma. J Exp Clin Cancer Res. 2020;39(1):126. 10.1186/s13046-020-01629-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Hoxhaj G, Manning BD. The PI3K-AKT network at the interface of oncogenic signalling and cancer metabolism. Nat Rev Cancer. 2020;20(2):74–88. 10.1038/s41568-019-0216-7. Epub 2019 Nov 4. PMID: 31686003; PMCID: PMC7314312. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Niu J, Li W, Liang C, Wang X, Yao X, Yang RH, Zhang ZS, Liu HF, Liu FY, Pei SH, Li WQ, Sun H, Fang D, Xie SQ. EGF promotes DKK1 transcription in hepatocellular carcinoma by enhancing the phosphorylation and acetylation of histone H3. Sci Signal. 2020;13(657):eabb5727. [DOI] [PubMed] [Google Scholar]
  • 59.Wang C, Delogu S, Ho C, Lee SA, Gui B, Jiang L, Ladu S, Cigliano A, Dombrowski F, Evert M, Calvisi DF, Chen X. Inactivation of Spry2 accelerates AKT-driven hepatocarcinogenesis via activation of MAPK and PKM2 pathways. J Hepatol. 2012;57(3):577–83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Brugarolas J, Lei K, Hurley RL, Manning BD, Reiling JH, Hafen E, Witters LA, Ellisen LW, Kaelin WG Jr. Regulation of mTOR function in response to hypoxia by REDD1 and the TSC1/TSC2 tumor suppressor complex. Genes Dev. 2004;18(23):2893–904. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Hou Y, Zhang Y, Jiang S, Xie N, Zhang Y, Meng X, Wang X. Salidroside intensifies mitochondrial function of CoCl2-damaged HT22 cells by stimulating PI3K-AKT-MAPK signaling pathway. Phytomedicine. 2023;109:154568. [DOI] [PubMed] [Google Scholar]
  • 62.He Y, Gan X, Zhang L, Liu B, Zhu Z, Li T, Zhu J, Chen J, Yu H. CoCl2 induces apoptosis via a ROS-dependent pathway and Drp1-mediated mitochondria fission in periodontal ligament stem cells. Am J Physiol Cell Physiol. 2018;315(3):C389–97. [DOI] [PubMed] [Google Scholar]
  • 63.Provot S, Zinyk D, Gunes Y, Kathri R, Le Q, Kronenberg HM, Johnson RS, Longaker MT, Giaccia AJ, Schipani E. Hif-1alpha regulates differentiation of limb bud mesenchyme and joint development. J Cell Biol. 2007;177(3):451–64. 10.1083/jcb.200612023. Epub 2007 Apr 30. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

12903_2025_6632_MOESM1_ESM.pdf (993.7KB, pdf)

Supplementary Material 1: Fig. S1. Effect of lactate on cartilage matrix formation in E12.5 MEPM cells. (A) The Alcian blue staining and quantification map of E12.5 MEPM cells after 21 days of chondrogenic culture with lactate (5 mM), CoCl2 (5 µmol/L) and both together. Scale bar: 100 μm. (B) The mRNA levels of Col2α1 and aggrecan gene expressions. ns > 0.05, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001

Data Availability Statement

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Articles from BMC Oral Health are provided here courtesy of BMC

RESOURCES