Abstract
Background
African swine fever (ASF) is a highly lethal infectious disease caused by the African swine fever virus (ASFV). Due to the absence of effective vaccines and antiviral drugs, the slaughter of infected and exposed pigs is a current prevention and control measure. Early diagnosis is crucial for the management of ASFV, and the p15 protein plays a critical role in the maturation of ASFV particles.
Results
In this study, a prokaryotic expression system obtained highly pure soluble p15 protein, and four monoclonal antibodies (3 C, 4B, 5D, 8 F) were prepared. These antibodies demonstrated the specific recognition of exogenously expressed p15. Antigenic epitopes were initially mapped using six overlapping p15 truncated proteins. Results showed that the epitopes of 3 C, 5D, and 8 F were all located in P49-N65, which is highly conserved among genotypes I, II, VII, IX, X, and XX. In contrast, 4B identified an epitope located at K105-R132, which was conserved only in genotypes I, II, and XX ASFV.
Conclusions
This study identified two novel conserved epitopes, P49-N65 and K105-R132. This provided valuable insights into the antigenic epitopes of ASFV p15 protein, contributing to a better understanding of its functional properties and demonstrating potential utility for the development of ASFV diagnostic tools.
Supplementary Information
The online version contains supplementary material available at 10.1186/s12917-025-04954-y.
Keywords: African swine fever virus, p15 protein, Monoclonal antibody, Conserved epitopes
Background
African swine fever (ASF) is a highly contagious disease of swine caused by the African swine fever virus (ASFV), resulting in a near-100% mortality rate in domestic pigs [1]. The virus was first reported in Africa in 1921 and subsequently spread to Portugal in 1957, eventually reaching Europe and the Americas [2]. In China, the first documented case of ASFV was in the Shenyang area on August 3, 2018 [3]. Since then, outbreaks of ASFV have occurred in numerous provinces across China, including Heilongjiang, Hubei, and Shandong. Currently, owing to the absence of effective commercial vaccines and antiviral drugs, the devastating ASF epidemic continues to pose a severe threat to pork production and food security worldwide. The slaughter of infected and exposed pigs is the only effective strategy for controlling ASFV [4, 5].
ASFV is a large double-stranded DNA virus that belongs to the Asfarviridae family [1]. The genome size of ASFV ranges from 170–190 kb, and ASFV encodes more than 150 proteins with 150–167 open reading frames (ORFs), which are involved in viral particle assembly, DNA replication, immune escape, and other processes [6, 7]. ASFV has an icosahedral structure consisting of a genome and four-layer protein shell [8]. Its structure is more complex than that of other viruses, which allows ASFV to effectively evade the host immune defense system [9].
The pp62 protein, encoded by CP530R, is a polyprotein precursor highly conserved among different ASFV strains [10]. The pp62 protein is processed by the protease pS237R to produce three mature virosomal proteins: p8, p15, and p35. However, p8 undergoes rapid degradation [11, 12]. Similar to other immunogenic proteins, p15 is a good serological target for the detection and monitoring of ASF. Moreover, p15 and p35 play crucial roles as structural proteins in the viral icosahedron formation. The maturation products of pp62 and pp220 collectively contribute approximately 30% of the total virion proteins [12]. Further studies have shown that the expression of the multimeric protein precursor pp220 is required for processing pp62 precursor into the maturation products p15 and p35. Additionally, the capsid protein p72 is required for processing pp220 and pp62 [13]. The accurate processing of these protein precursors is vital for the maturation of ASFV particles [14, 15]. ASFV p15, as an important protective antigen, can induce a strong immune response. The p15 virus-like particle vaccine constructed can induce high antibody levels in pigs, achieving 100% protection against attacks by moderately virulent strains [16]. Additionally, the detection of pp62 and p15 proteins fulfills the requirements for early diagnosis and detection of ASF [17, 18]. Thus, the study of the p15 protein is crucial for elucidating the pathogenesis and immunological mechanisms underlying ASFV infection.
In this study, we successfully generated four mAbs against the ASFV p15 protein. Using the overlapping peptide method, we initially mapped the epitopes of these mAbs, thus identifying two conserved linear epitopes on the ASFV p15 protein that had not been previously reported. These findings enhance our understanding of the function of p15 and offer potential support for the development of diagnostic tools for ASFV infection.
Results
Expression and purification of p15 recombinant protein
As shown in Fig. 1A, after digestion with BamH I and Xho I, a 650 bp band was released from the recombinant plasmid pET28a-Msyb-p15, which was consistent with p15 and preliminarily implied the successful construction of pET28a-Msyb-p15. Additionally, the recombinant plasmid was verified by sequencing (data not shown). Next, pET28a-Msyb-p15 was transformed into E. coli BL21 (DE3) competent cells, and as Fig. 1B shows, recombinant p15 was expressed in soluble form and migrated at a molecular mass of approximately 42 kDa. Recombinant p15 was purified using Ni Sepharose 6FF, and its purity was above 90% after purification (Fig. 1C). Finally, recombinant p15 was verified by western blotting using anti-His tag mAbs, and recombinant p15 developed in this study reacted specifically with anti-His tag mAbs (Fig. 1D). Results indicate that the recombinant protein p15 has been successfully prepared.
Fig. 1.
Expression and purification of recombinant ASFV p15 protein. (A) Recombinant plasmid pET28a-Msyb-p15 was digested with the restriction enzymes BamH I and Xho I, and then visualized by agarose electrophoresis. Lane 1: the recombinant plasmid pET28a-Msyb-p15; lane 2: double digestion product of recombinant pET28a-Msyb-p15. (B) SDS PAGE analysis of p15 recombinant protein expression. M: Marker; lane 1: total proteins of p15 expression strain after induction; lane 2: total proteins of p15 expression strain before induction; lane 3: supernatant proteins of p15 expression strain after induction; lane 4: precipitation proteins of p15 expression strain after induction. (C) Purification and SDS PAGE analysis of recombinant p15 protein; M: Marker; lane 1: Proteins before purification; lane 2: proteins eluent by 10 mM imidazole; lane 3: proteins eluent by 60 mM imidazole; lane 4–5: proteins eluent by 250 mM imidazole; lane 6–7: proteins eluent by 500 mM imidazole. (D) Western blot analysis of purified p15 protein using anti-His tag mAb
Development of anti-p15 mAbs
Three BALB/c female mice were immunized with recombinant p15 protein, and serum samples were collected one week after the third immunization (Fig. 2A). Serum antibodies reacted well with the recombinant p15 protein even after dilution 1:256,000, indicating the successful acquisition of specific antibodies against the ASFV p15 protein (Fig. 2B). The spleen was then removed after anesthesia, and cell fusion was conducted with SP2/0 cells using PEG1500. After fusion, ELISA was used to detect the anti-p15 antibody secreted by the hybridoma cell clones. Finally, four monoclonal antibody hybridoma cell strains (3 C, 4 B, 5D, and 8 F) were obtained after subcloned 3 times using the limited dilution method.
Fig. 2.
Determination of anti-p15 antibody titer in serum before fusion. (A) The immunization procedures for animals. (B) Purified p15 protein was diluted to 1 µg/mL in PBS and then coated into the microplate. Then, 2-fold serial dilution from 1:1 000 to 1:512 000 was added to the well after being blocked with 5% skim milk. Each bar represents the mean ± SD
Four mAbs reacted well with recombinant ASFV p15 protein
Sf9 cells were infected with the previously constructed recombinant baculovirus p15 (the p15 gene driven by the polyhedrin promoter), and the specificity of the mAbs was detected by WB and IFA. The IFA experimental results demonstrated that the generated mAbs specifically recognized p15 on the surface of Sf9 cells (Fig. 3A). As shown in Fig. 3B, western blot results showed that all four mAbs could recognize the purified proteins. The results presented above indicate that four monoclonal antibodies with high specificity have been successfully developed.
Fig. 3.
Four mAbs reacted well with recombinant ASFV p15 protein. (A) The reactivity of mAbs was analyzed with IFA. The green color is the reaction of anti-3C, 4B, 5D, and 8 F mAbs with corresponding proteins; The blue color is the nuclei of Sf9 cells. Positive control is the reaction of anti-ASFV E165R mAbs with corresponding proteins. Negative control is uninfected cells with the recombinant baculovirus p15. (B) Western blot analysis of the reactivity between p15 protein and 4 mAbs developed in this study
Potency and subtype identification of four mAbs
To further characterize the four mAbs, their potency was determined using indirect ELISA. As shown in Fig. 4A, the potencies of 3 C, 4 B, and 5D were 2.048 × 105, 8.192 × 105, and 2.048 × 105, respectively, while that of 8 F was 1.024 × 105, which indicated that the potencies of 3 C, 4 B, and 5D were significantly higher than that of 8 F.
Fig. 4.
Affinity and subtype identification of four mAbs. (A) Ascites titers of p15 mAbs performed by ELISA. (B) Heavy chains of monoclonal antibodies. (C) Light chains of monoclonal antibodies
In addition, the subtypes of these mAbs were identified: 3 C, 5D, and 8 F were the IgG1 subtype, and 4B was the IgG2b subtype (Fig. 4B). The four mAbs were all Kappa light chains (Fig. 4C).
Mapping epitopes recognized by four mAbs
To map the epitopes of the four mAbs, the p15 protein was designed as six overlapping truncated fragments for recombinant expression (Fig. 5A). To prevent the truncated fragments from being too small to be easily detected, the pET32a vector was chosen to express the six truncated fragments, which could incorporate an 11.8 kD trxA tag sequence at the N-terminus. Western blotting showed that 3 C, 5D, and 8 F could recognize A1, A2, A3, and A4, while 4 B specifically recognized A3, A4, A5, and A6 (Fig. 5B). Therefore, we determined that 3 C, 5D, and 8 F recognize an epitope located within residues P49-N65 of the p15 protein in the overlapping region between A1, A2, A3, and A4, whereas 4B recognizes an epitope located within the overlapping regions of A3, A4, A5, and A6 within residues K105-R132. Furthermore, the four mAbs specifically recognized ASFV-infected MA104 cells (Fig. 5C and D). To determine the position of the epitope in the spatial structure of the ASFV p15 protein, we used software to show the spatial structure of the protein and label the position of the epitope (Fig. 5E). As a result, the four prepared mAbs demonstrated high specificity, and the recognition sites of 3 C, 5D, and 8 F were determined to be P49-N65, while the recognition site of 4B was determined to be K105-R132.
Fig. 5.
Mapping epitopes recognized by four mAbs. (A) Framework for design of truncated p15 protein. (B) Western blot analysis of the reactivity between mAbs screened and truncated p15 protein. (C) Western blot analysis of reactivity between monoclonal antibodies and ASFV-infected MA104 cells. (D) The reactivity between monoclonal antibodies (mAbs) and ASFV- infected MA104 cells was analyzed using IFA. Green indicates the reaction of anti-3 C, 4B, 5D, and 8 F monoclonal antibodies with their corresponding proteins; blue indicates the cell nuclei of MA104 cells. The positive control is the reaction of anti-ASFV E165R monoclonal antibodies with their corresponding proteins. The negative control was MA104 cells uninfected with ASFV. (E) The region of the epitope P49-N65(orange color) and the epitope K105-R132 (green color) are located on the spatial structure of the ASFV p15 protein
Conservative analysis of epitopes
To determine whether these epitope regions are conserved among the different genotypes of ASFV, we analyzed the p15 sequences of 28 ASFV isolates with eight genotypes. As shown in Fig. 6A, the epitope recognized by mAbs 3 C, 5D, and 8 F identified a region located at P49-N65, which was highly conserved in most genotypes. In contrast, 4 B identifies a region located at K105-R132 that is highly conserved in types I, II, and XX genotypes, whereas changes in T to K at position 106, V to I at position 121, or D to N at position 131 in the other genotypes did not affect identification. The results of the phylogenetic tree showed that the p15 sequences selected in this study were highly consistent with those of several prevalent strains in Asia and Europe (Fig. 6B). Therefore, the mAbs prepared in this study are highly conserved and provide a viable strategy for establishing an ASFV detection method.
Fig. 6.
Conservative analysis of epitopes. (A) The p15 sequences of ASFV strains from different genotypes were aligned. Matching residues are denoted with black dots, while the coordinate of the amino acid in the alignment was specified on the top and right terminus for each sequence. Epitope regions of P49-N65 were recognized by 3 C, 5D, and 8 F; and K105-R132 was recognized by 4B. (B) ASFV p15 genetic evolution analysis (maximum likelihood method (ML))
Discussion
ASFV infection in domestic pigs can be lethal (up to 100% mortality). China, the world’s largest pig breeding and consumption country, has been devastated by this disease in recent years [19]. The large genome of ASFV, complexity of the encoded proteins, and unknown mechanisms of immune escape [20] have hindered the development of a globally available commercial vaccine for ASF. Consequently, there are significant challenges to the prevention and control of this disease. Currently, new characteristics of the ASF epidemic have emerged, such as the existence of both naturally weak and strong strains of ASFV, a prolonged incubation period in infected pigs, and increased difficulties in accurate culling [21]. Therefore, there is an urgent need to develop an accurate and rapid antibody assay for ASFV detection.
The ASFV polyprotein precursors pp220 and pp62 are hydrolyzed by pS273R cysteine methionine to generate p150, p37, p34, p14, p35, p15, and p8, respectively [10, 15]. These proteins form a dense nucleocapsid, which accounts for approximately 30% of viral particles [9]. Specifically, p35 and p15 proteins primarily localize in the inner core shell, where their matrix-like structural domains are positioned between the DNA-containing nucleoid and the inner capsid membrane [14, 15, 22]. Notably, p35 and p15 proteins and the hydrolysis products of pp220 are found in viral particles with identical molecular weights [23]. When the polyprotein cannot be properly cleaved by proteases, the newly assembled daughter virus particles mispackage and are susceptible to loss of infectivity [14, 15]. ASFV p15 may be involved in viral transcription, DNA replication, and genome packaging by binding to dsDNA [24]. In the absence of an effective commercial vaccine, the accurate and efficient early detection of ASF is particularly important. Structural proteins p54, along with p72, p30, and pp62 [17, 25], are immunogenic and are often included in vaccine formulations and serological tests. A study investigating the antigenicity of pp62, p32, and p54 used these recombinant proteins in ELISA and WB for ASF serological diagnosis. Studies have revealed that pp62 and p32 exhibit higher antigenic specificity than p54 [26, 27]. Interestingly, the p15 monomer shares a structural motif similar to that of FAS1 [9] and is also a component of the multiprotein precursor pp62, which may have implications for the immunological diagnosis of ASFV.
The p15 protein in this study had a high level of expression and solubility, which is crucial for maintaining the natural protein structure necessary for antibody preparation. In addition, mAbs prepared against epitopes showed good reactivity with heterologously expressed p15 protein, suggesting that epitopes have good immunogenicity. Moreover, the recognition epitopes of the prepared mAbs were initially localized by the expression of six truncated peptides. The results revealed that three mAb recognition regions were localized within residues 49–65 aa, while one epitope was identified within residues 105–132 aa. Upon analyzing the sequence conservativeness in this region, it was observed that the 49–65 aa region recognized by 3 C, 5D, and 8 F is highly conserved among different ASFV genotypes. Hence, it can serve as a broad detection spectrum for use. In contrast, the epitope identified by 4 B exhibited high conservation in genotypes I and II, with 1–3 base differences in genotypes VII, IX, and X. Therefore, it also has potential as a valuable detection tool for ASFV genotypes I and II. Given that the predominant genotype of ASF currently prevalent in Europe and Asia is type II, the mAbs prepared in this study have significant potential for ASFV detection [1, 28]. They also provide a solid foundation for further investigation of the antigenic role of ASFV p15 protein.
Conclusions
In this study, four strains of mAbs were generated against the ASFV p15 protein, and conserved and variable regions were identified. We identified two important immunodominant epitopes of p15, P49-N65, and K105-R132, which are highly conserved in genotypes I and II. This study provides a solid basis for further investigation of the antigenic function of the ASFV p15 protein and the development of a diagnostic method for ASFV.
Materials and methods
Gene, cells, and animals
ASFV strain GZ201801 (GenBank: MT496893.1) was isolated and stored at the Animal Biosafety Laboratory Level III, South China Agricultural University. The open reading frame (ORF) of p15 gene of the ASFV Pig/HLJ/2018 strain (GenBank: MK333180.1) was designed and synthesized by Sangon Bioengineering Co., Ltd. (Shanghai, China). The positive control group anti-ASFV E165R monoclonal antibody was prepared and stored in our laboratory [29]. The pET28a (+) prokaryotic vector, containing the Msyb solubility promotion label, was stored in our laboratory. SP2/0 cells were kindly provided by Yunrui Xing from Henan Key Laboratory of Immunobiology, cultured at 37 °C with 5% CO2 and maintained in RPMI medium 1640 (Solarbio, Beijing, China) mixed with 10% fetal bovine serum (Biological Industries, USA). Spodoptera frugiperda (Sf9) cells were grown and maintained at 28 °C in Sf 900III medium (Invitrogen). Monkey kidney epithelial cells (MA104) were cultured in Dulbecco’s modified DMEM (Solarbio, Beijing, China) supplemented with 10% fetal bovine serum (Biological Industries, USA) and 1% penicillin/streptomycin. Five 6-week-old female BABL/c mice were purchased from Autobio Diagnostics Co., Ltd. (Zhengzhou, China).
Construction of p15 recombinant plasmid
According to the gene sequence of ASFV Pig/HLJ/2018 (GenBank: MK333180.1), p15 gene was designed and synthesized, which contains a BamH I site in the N-terminal and an Xho I site in the C-terminal. To improve the solubility of the p15 protein, the double digestion product of the p15 gene was cloned into a pET28a (+) expression vector, which has an Msyb-soluble tag, and then transformed into E. coli. TOP10 competent cells (Weidi Biotechnology, Shanghai, China) to generate the plasmid pET28a-Msyb-p15 and recombinant plasmid pET28a-Msyb-p15 were verified by double digestion with BamH I and Xho I. The p15 gene was also truncated into six fragments containing overlapping parts, amplified by PCR (PCR primers see Table 1), and ligated to the pET32a (+) prokaryotic expression vector for the subsequent identification of monoclonal antibody epitopes. All the constructed plasmids were sent to Sangon Bioengineering Co. Ltd. (Shanghai, China) for DNA sequencing and validation.
Table 1.
Primers used in this study
| Primer names | Primer sequences | Fragments |
|---|---|---|
| A1 |
F: CGCGGATCCatgCCCTCTAATATGAAA R: CCGGAATTCGTGGTGGTGGTGGTGGTGATTGGAGTAGGCATGTTT |
1–65 aa |
| A2 |
F: cgcGGATCCatgCCCTCTAATATGAAA R: ccgGAATTCGTGGTGGTGGTGGTGGTGTTTTTCAACCTCTAATTT |
1-105 aa |
| A3 |
F: cgcGGATCCatgCCCTCTAATATGAAA R: gccGAATTCGTGGTGGTGGTGGTGGTGGCGATCAGGAAAGGGCTT |
1-132 aa |
| A4 |
F: CGCGGATCCATGAAACAGGCAAAGATC R: GCCGAATTCGTGGTGGTGGTGGTGGTGATTCCCCCCACCCTCCTT |
49–160 aa |
| A5 |
F: cgcGGATCCatgGACCCTTCACAAGCC r: gccGAATTCGTGGTGGTGGTGGTGGTGGCGATCAGGAAAGGGCTT |
66–132 aa |
| A6 |
F: CGCGGATCCATGAAAACGGAGGCGAAT R: GCCGAATTCGTGGTGGTGGTGGTGGTGATTCCCCCCACCCTCCTT |
105–160 aa |
Preparation of the recombinant protein p15
The recombinant plasmid, pET28a-Msyb-p15, was transformed into BL21 (DE3) competent cells (Weidi Biotechnology, Shanghai, China). Single colonies were selected, transferred to liquid LB medium containing 50 µg/mL ampicillin, and grown overnight in a 37 °C shaker. The bacterial solution was then transferred to 100 mL of liquid LB medium at a ratio of 1:100 and incubated at 37 °C until the optical density at 600 nm (OD600) was 0.6. A final concentration of 0.5 mmol/L isopropyl-β-D-thiogalactopyranoside (IPTG) was added, a blank control was set, and the culture was induced at 37 °C for 6 h. The bacterial precipitates were harvested by centrifugation and sonicated, and the supernatants were isolated, precipitated, and stored at -80 °C. Forty microliters of each component sample were used for SDS-PAGE analysis of expression and solubility.
The protein was purified using Ni Sepharose 6FF (Solarbio, Beijing, China), according to the manufacturer’s instructions, and eluted with imidazole liquid at different concentrations. SDS-PAGE and Western blotting were performed to identify purified p15 protein.
Generation and identification of monoclonal antibodies against ASFV p15
Three 6-week-old female BABL/C mice were immunized with 50 µg of purified p15 protein per mouse, and the antigen was emulsified with an equal volume of Freund’s complete adjuvant, while a PBS control group was set up. Then, equal volumes of antigen were emulsified with Freund’s incomplete adjuvant at weeks 4th and 6th weeks, respectively. Seven days after the third immunization, tail vein blood was collected to isolate serum, and titers were determined using enzyme-linked immunosorbent assay (ELISA).
All animal protocols were performed in accordance with the guidelines of the ethical committee of the Nanyang Normal University (No. NYNU 2023-0006). Mice with the highest serum titers were selected for booster immunization on the 3rd day before fusion, that is, 100 µg of antigen without adjuvant was injected intraperitoneally. Mice were humanely euthanized via intraperitoneal injection of 0.3% sodium pentobarbital at a dosage of 40 mg/kg. Eyeball blood samples were used as positive serum controls. Mouse spleens were collected and prepared as individual splenocytes by screening on 200 mesh nylon mesh. Well-grown hybridoma cells, with a density of approximately 2–5 × 107 cells, were collected. Splenocytes and SP2/0 cells were washed with RPMI 1640 medium and mixed. The reaction was terminated by gently blowing the cell mass and slowly adding 1 mL 50% PEG 1500. Cells were resuspended in a selective medium containing RPMI 1640 with 10% fetal bovine serum and HAT, placed in 96-well cell culture plates, and incubated in an incubator containing 5% CO2. After 10–12 days of cell fusion, the fused hybridoma cells formed cell cluster clones and occupied a certain bottom area in the culture wells. A p15 protein-coated plate was used for indirect ELISA to assess antibody titers. The assay was repeated three times, and the strongly positive wells were selected for cloning using the limited dilution method to ensure the appearance of the cell monoclonal.
ELISA
Indirect ELISA was used to detect the titer of the anti-ASFV p15 mAb. The purified p15 protein was coated onto ELISA plates at 100 µL per well overnight at 4 °C. The cells were blocked with 5% skimmed milk in PBST (1×PBS containing 0.05% Tween-20) at 37 °C for 2 h. The mAb ascites was added as the primary antibody from 1:400 to 1:819 200 in 2-fold multiple dilution order, along with the SP2/0 cell supernatant as a negative control. HRP-conjugated goat anti-mouse IgG (H + L) was used as the secondary antibody. After adding 100 µL 3,3′,5,5′ of tetramethylbenzidine (TMB) liquid (Biosharp, China) to each well, the plates were incubated for 10 min at room temperature. The reaction was terminated using 2 mol/L sulfuric acid, and the OD450 nm was measured using a multifunctional enzyme standard; when the ratio of positive control (P) to negative control (N) was greater than 2.1, the result was judged usable.
The isotype of the monoclonal antibody was determined according to the instructions of the mouse monoclonal antibody isotype identification kit (Proteintech, Wuhan, China).
IFA
The specificity of monoclonal antibodies (mAbs) was validated through immunofluorescence analysis (IFA). For this validation, Sf9 cells were infected with the recombinant baculovirus AcMultiBac-p15(driven by the polyhedron protein promoter), and MA104 cells wereinfected with ASFV, respectively. The anti-ASFV E165R antibody group served as the positive control, while uninfected cells as the negative control. After 72 h, the supernatant was discarded, fixed using 4% paraformaldehyde for 20 min at room temperature, washed three times with PBST, and blocked with 5% skimmed milk powder at 37 °C for 1 h. After washing with PBST, the cells were treated with anti-p15 protein monoclonal antibody (1:100 dilution) at 37 °C for 1 h. Goat Anti-Mouse IgG H&L FITC-conjugated fluorescent secondary antibody (1:100 dilution, Affinity, USA) was incubated for 1 h at 37 °C in the dark. Cell nuclei were stained with DAPI ( Biosharp, China). After washing, cells were observed under an inverted fluorescence microscope.
Western blot
Western blotting was used to examine the reactivity of the monoclonal antibodies with the p15 protein expressed in the baculovirus expression system. The p15 protein was separated by 12% SDS-PAGE, with 20 µg of total protein loaded per well. The protein was then transferred to a 0.2 μm polyvinylidene fluoride (PVDF) membrane. A panel of four prepared anti-ASFV p15 mAbs was diluted 1:1 000 and incubated for 1 h at 37 °C as the primary antibody and then incubated for 45 min at 37 °C with HRP-conjugated goat anti-mouse IgG (H + L) (1:5 000 dilution, Proteintech, Wuhan, China) as the secondary antibody. Enhanced chemiluminescence (ECL) reagents (Biosharp, China) were used to observe reactivity. To initially identify the epitopes recognized by the monoclonal antibody, six vectors containing the overlapping parts of the p15 gene were transformed into BL21 (DE3) receptor cells, and protein expression was verified by western blotting and named A1, A2, A3, A4, A5, and A6. mAbs (1:2000) were used as the primary antibody, and the other steps were performed as described above. Western blotting was used to validate the truncated proteins recognized by the monoclonal antibodies. MA104 cells were infected with 100 TCID50/ 50µL ASFV and incubated at 37 °C with 5% CO2 for 24–48 h, after which the specificity of the mAbs was verified by western blotting.
Homology analysis of the identified p15 epitopes
Using DNAstar MegAlign software 7.0 (DNASTAR, Inc., Madison, WI, USA), the p15 amino acid sequences of 28 ASFV strains from various nations or areas were aligned using DNAstar MegAlign software (DNASTAR, Inc., Madison, WI p15 mAbs. The structure of ASFV p15 (PDB code: 6LNL) was simulated using PyMOL software and the recognized antibody epitopes were labeled.
Statistical analysis
DNAstar MegAlign software (version 7.0; DNASTAR lnc., WI, USA) was used to perform protein sequence alignment. A phylogenetic tree was constructed using MEGA-X software (version 10.2.6, Mega Limited, Auckland, New Zealand). All statistical differences were analyzed by one-way ANOVA using the GraphPad Prism 9.3.0 software (GraphPad Software Inc., San Diego, CA, USA). P < 0.05.
Electronic supplementary material
Below is the link to the electronic supplementary material.
Acknowledgements
The authors gratefully acknowledge the support of Yunrui Xing from Henan Key Laboratory of Immunobiology.
Author contributions
J.H. and L.Y. designed experiments. J.H., M.L., M.Z., X.H. and Y.L. performed the experiments and analyzed the data. J.H., M.L. and L.Y. wrote and edited the manuscript. L.Y. obtained funding. All the authors have read and agreed to the published version of the manuscript.
Funding
This study was funded by the Science and Technology Innovation Leading Talent Project of the Central Plains of China (244200510040).
Data availability
Data is provided within the manuscript or supplementary information files”. Find some help on our Data availability statements page.
Declarations
Ethics approval and consent to participate
The experiments and protocols in this study were approved by Nanyang Normal University (Belongs to Chinese Association for Laboratory Animal Sciences, CALAS; NO. NYNU 2023-0006), which was approved by the Animal Care Committee of the Nanyang Normal University, China.
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Jian He and Mingzhan Luo contributed equally to this work.
References
- 1.Li Z, Chen W, Qiu Z, Li Y, Fan J, Wu K, Li X, Zhao M, Ding H, Fan S, et al. African swine fever virus: A review. Life (Basel Switzerland). 2022;12(8):1255. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Penrith ML, Vosloo W. Review of African swine fever: transmission, spread and control. J S Afr Vet Assoc. 2009;80(2):58–62. [DOI] [PubMed] [Google Scholar]
- 3.Zhou X, Li N, Luo Y, Liu Y, Miao F, Chen T, Zhang S, Cao P, Li X, Tian K, et al. Emergence of African swine fever in china, 2018. Transbound Emerg Dis. 2018;65(6):1482–4. [DOI] [PubMed] [Google Scholar]
- 4.Dixon LK, Sun H, Roberts H. African swine fever. Antiviral Res. 2019;165:34–41. [DOI] [PubMed] [Google Scholar]
- 5.Lin Y, Cao C, Shi W, Huang C, Zeng S, Sun J, Wu J, Hua Q. Development of a triplex real-time PCR assay for detection and differentiation of gene-deleted and wild-type African swine fever virus. J Virol Methods. 2020;280:113875. [DOI] [PubMed] [Google Scholar]
- 6.Alejo A, Matamoros T, Guerra M, Andres G. A proteomic atlas of the African swine fever virus particle. J Virol. 2018;92(23):e01293–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Dixon LK, Stahl K, Jori F, Vial L, Pfeiffer DU. African swine fever epidemiology and control. Annu Rev Anim Biosci. 2020;8:221–46. [DOI] [PubMed] [Google Scholar]
- 8.Rojo G, Garcia-Beato R, Vinuela E, Salas ML, Salas J. Replication of African swine fever virus DNA in infected cells. Virology. 1999;257(2):524–36. [DOI] [PubMed] [Google Scholar]
- 9.Fu D, Zhao D, Zhang W, Zhang G, Li M, Zhang Z, Wang Y, Sun D, Jiao P, Chen C, et al. Structure of African swine fever virus p15 reveals its dual role for membrane-association and DNA binding. Protein Cell. 2020;11(8):606–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Gallardo C, Blanco E, Rodriguez JM, Carrascosa AL, Sanchez-Vizcaino JM. Antigenic properties and diagnostic potential of African swine fever virus protein pp62 expressed in insect cells. J Clin Microbiol. 2006;44(3):950–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Jia N, Ou Y, Pejsak Z, Zhang Y, Zhang J. Roles of African swine fever virus structural proteins in viral infection. J Vet Res. 2017;61(2):135–43. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Simon-Mateo C, Andres G, Almazan F, Vinuela E. Proteolytic processing in African swine fever virus: evidence for a new structural polyprotein, pp62. J Virol. 1997;71(8):5799–804. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Andres G, Alejo A, Salas J, Salas ML. African swine fever virus polyproteins pp220 and pp62 assemble into the core shell. J Virol. 2002;76(24):12473–82. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Heath CM, Windsor M, Wileman T. Membrane association facilitates the correct processing of pp220 during production of the major matrix proteins of African swine fever virus. J Virol. 2003;77(3):1682–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Suarez C, Salas ML, Rodriguez JM. African swine fever virus polyprotein pp62 is essential for viral core development. J Virol. 2010;84(1):176–87. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Yu Q, Fu W, Zhang Z, Liang D, Wang L, Zhu Y, Sun E, Li F, Bu Z, Chen Y, et al. The p15 protein is a promising immunogen for developing protective immunity against African swine fever virus. Protein & cell; 2025. [DOI] [PubMed]
- 17.Zhong K, Zhu M, Yuan Q, Deng Z, Feng S, Liu D, Yuan X. Development of an indirect ELISA to detect African swine fever virus pp62 Protein-Specific antibodies. Front Veterinary Sci. 2021;8:798559. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Wu Z, Lu H, Zhu D, Xie J, Sun F, Xu Y, Zhang H, Wu Z, Xia W, Zhu S. Developing an indirect ELISA for the detection of African swine fever virus antibodies using a Tag-Free p15 protein antigen. Viruses. 2023;15(9):1939. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Revilla Y, Perez-Nunez D, Richt JA. African swine fever virus biology and vaccine approaches. Adv Virus Res. 2018;100:41–74. [DOI] [PubMed] [Google Scholar]
- 20.Blome S, Franzke K, Beer M. African swine fever - A review of current knowledge. Virus Res. 2020;287:198099. [DOI] [PubMed] [Google Scholar]
- 21.Aicher SM, Monaghan P, Netherton CL, Hawes PC. Unpicking the secrets of African swine fever viral replication sites. Viruses. 2021;13(1):77. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Alejo A, Andres G, Salas ML. African swine fever virus proteinase is essential for core maturation and infectivity. J Virol. 2003;77(10):5571–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Andres G, Alejo A, Simon-Mateo C, Salas ML. African swine fever virus protease, a new viral member of the SUMO-1-specific protease family. J Biol Chem. 2001;276(1):780–7. [DOI] [PubMed] [Google Scholar]
- 24.Guo F, Shi Y, Yang M, Guo Y, Shen Z, Li M, Chen Y, Liang R, Yang Y, Chen H, et al. The structural basis of African swine fever virus core shell protein p15 binding to DNA. FASEB J. 2021;35(3):e21350. [DOI] [PubMed] [Google Scholar]
- 25.Gallardo C, Reis AL, Kalema-Zikusoka G, Malta J, Soler A, Blanco E, Parkhouse RM, Leitao A. Recombinant antigen targets for serodiagnosis of African swine fever. Clin Vaccine Immunol. 2009;16(7):1012–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Neilan JG, Zsak L, Lu Z, Burrage TG, Kutish GF, Rock DL. Neutralizing antibodies to African swine fever virus proteins p30, p54, and p72 are not sufficient for antibody-mediated protection. Virology. 2004;319(2):337–42. [DOI] [PubMed] [Google Scholar]
- 27.Alcaraz C, Rodriguez F, Oviedo JM, Eiras A, De Diego M, Alonso C, Escribano JM. Highly specific confirmatory Western blot test for African swine fever virus antibody detection using the Recombinant virus protein p54. J Virol Methods. 1995;52(1–2):111–9. [DOI] [PubMed] [Google Scholar]
- 28.Nurmoja I, Petrov A, Breidenstein C, Zani L, Forth JH, Beer M, Kristian M, Viltrop A, Blome S. Biological characterization of African swine fever virus genotype II strains from north-eastern Estonia in European wild Boar. Transbound Emerg Dis. 2017;64(6):2034–41. [DOI] [PubMed] [Google Scholar]
- 29.He J, Li J, Luo M, Liu Y, Sun J, Yao L. Identification of two novel linear epitopes on the E165R protein of African swine fever virus recognized by monoclonal antibodies. Front Veterinary Sci. 2024;11:1392350. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
Data is provided within the manuscript or supplementary information files”. Find some help on our Data availability statements page.






