Abstract
Background
Metabolic diseases such as obesity and type 2 diabetes are on the rise and have become a significant global public health issue. Mitochondrial function and biogenesis in visceral adipose tissue are key factors influencing the development of obesity and related metabolic disorders. In addition, chronic inflammation involving immune cells can lead to obesity-related metabolic disorders. Given these underlying mechanisms, we aimed to test whether the treatment of frozen-thawed isolated mitochondrial preparations (MRC-Q) from cultured cells had a protective effect on adipose tissue inflammation and remodeling in a high-fat diet-induced mouse model.
Methods and Results
MRC-Q was given intraperitoneally every 2 weeks to the mice in the diet-induced obesity (DIO) model. The results demonstrated that MRC-Q reduced the amount of adipose tissue and the body weight of the DIO mice, reduced blood glucose, and improved glucose tolerance. This process was accompanied by M2 macrophage polarization and suppression of pro-inflammatory responses in the visceral fat of mice. In addition, in vitro experiments indicated that MRC-Q could directly transform macrophages to the M2 phenotype.
Conclusions
A novel mitochondrial preparation, MRC-Q, protected against adipose tissue remodeling in DIO mice by promoting M2 macrophage polarization, and inhibiting pro-inflammatory responses in visceral fat.
Key Words: Adipose remodeling, M2 macrophages, Mitochondria, Mitochondrial biogenesis, Obesity
Article Highlights
• Administration of freeze-thawed isolated mitochondria (MRC-Q) significantly improved adipose tissue remodeling and attenuated high-fat diet (HFD)-induced obesity (DIO) in mice.
• MRC-Q induces macrophages toward M2 polarization.
• MRC-Q promoted endogenous mitochondria biogenesis as evidenced by increased expression of PGC1α and Tfam in the setting of adipose tissue remodeling.
Obesity and type 2 diabetes (T2DM) have become critical global health concerns, with the prevalence of obesity steadily rising over the past 50 years. Both conditions impose a significant socioeconomic burden worldwide.1 In recent years, the increase in T2DM, particularly, is largely attributed to DIO, stress, lack of exercise, and other lifestyle factors.2 Given the limited efficacy of lifestyle interventions, the current treatment for obesity and diabetes is mainly drug-based.3
Currently there are a limited number of drugs for the treatment of obesity, including orlistat, phentermine-topiramate (PHEN/TPM), naltrexone-bupropion (NB), and GLP-1 receptor agonists (GLP-1RAs), most of which also exhibit a certain degree of blood sugar-lowering effect.4 However, these treatments are not fully effective in controlling the onset and progression of obesity or its related metabolic disorders. Additionally, some medications for treating obesity and diabetes, such as NB, insulin, thiazolidinedione (TDZ), and etc., have been associated with adverse side effects, emphasizing the need for new therapeutic strategies.4,5
Obesity is a disease caused by excessive fat accumulation, leading to a chronic positive energy balance.6 Mitochondria, as the organelles responsible for energy production in eukaryotes’ cells, play a key role in this process. In obesity, mitochondrial dysfunction, particularly in white adipose tissue, has been identified as a major contributor to the development of obesity-related metabolic diseases. Impaired mitochondrial function or biogenesis in adipose tissue has been linked to metabolic dysregulation in obesity.7 Additionally, obesity is associated with the accumulation of immune cells in adipose tissue, which leads to increased production of inflammatory cytokines and chemokines.8 This inflammation triggers insulin resistance and ultimately contributes to the onset of obesity-related metabolic disorders.9 Studies have shown that reducing the number of macrophages in adipose tissue can potentially slow the progression of obesity and improve insulin resistance.10
Recent studies have shown that white adipose tissue (responsible for fat storage) and brown fat (responsible for heat production) can transform into each other depending on the status of the mitochondria. The higher mitochondrial density in brown fat compared to white fat is attributed to the unique expression of mitochondrial uncoupling proteins (UCPs).11 In this process, not only UCP-1 is expressed, but also transcription factors and coactivators, such as PPARγ and PGC1α, are involved.12 Therefore, promoting the conversion of white fat into brown fat has emerged as a promising strategy for treating obesity. However, it remains entirely unknown whether exogenous mitochondrial supplementation can suppress adipose tissue remodeling or the progression of obesity-related pathologies. Based on these recent advancements, we hypothesized that exogenous administration of isolated mitochondria could delay the progression of obesity by enhancing adipose tissue remodeling.
Therefore, the aim of this study was to test whether the administration of a freeze-thawed isolated mitochondria preparation could have a protective effect on adipose-tissue remodeling in a well-established murine model of HFD induced-obesity.
Methods
Animals and Treatment
All procedures in this study were approved by the Animal Ethics Review Board of the Nagoya University School of Medicine (M240199-001). C57BL/6 mice aged 8 weeks were acquired from Charles River Laboratories Japan Inc. (Kanagawa, Japan), and housed in a controlled environment at the Animal Research Institute of Nagoya University, with a 12-h light/dark cycle, constant humidity, and temperature maintained at 23℃. The mice had ad libitum access to food and water. Mice were randomly assigned to normal diet group (SHAM) (n=5), DIO group (n=10) and DIO plus mitochondrial preparation (MRC-Q) intraperitoneal injection (DIO+MRC-Q) (n=5). The mice in the normal diet group were fed a normal diet for 12 weeks, while the mice in the DIO group and DIO+MRC-Q group were fed the HFD (60% calories from fat) for 12 weeks. The DIO+MRC-Q group received intraperitoneal injections of MRC-Q (20 μg per mouse) every 2 weeks. The SHAM and DIO groups were injected with the same volume of phosphate-buffered saline (PBS). The handling of animals was in accordance with the guidelines of the Institutional Animal Care and Use Committee of Nagoya University.
Mitochondria Preparation
The mitochondria used in the experiments in this study (allogenic mitochondrial organelle complex -Q: MRC-Q) from Hela cells were purified by intact Mitochondria Isolation Technology (iMIT) without homogenization/solubilization by the LUCA Science Inc. (Tokyo, Japan) (WO2021132735A2) as previously descrived.13
Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR)
RNA was isolated from visceral adipose samples and peritoneal macrophages using the RNeasy Micro kit according to the manufacturer’s instructions. In brief, 1 μg of total RNA was reverse transcribed in a standard manner using ReverTra Ace qPCR RT Master Mix (TOYOBO) supplemented with DNase treatment. Quantitative PCR analysis of TNF-α, IL-1β, IL-6, F4/80, CD68, CD11c, CD163, CD206, Arg-1, PPARγ, Pgc1α, Tfam, mt-Nd-1, mt-Nd-5, Ucp-1, Stat1, InhβA, Nos2, Socs3, Klf4, Lxrα, Irf4, Bmp7 and GAPDH mRNA was performed using SYBR Green I on CFX Connect (BIO-RAD) under the following conditions: 95℃ for 1 min, followed by 40 cycles of 95℃ for 15 s, 55℃ for 30 s, and 75℃ for 1 min.14
Immunofluorescence Staining
Immunofluorescence staining was performed as described previously.14 Visceral fat cryosections were collected from the abdominal cavity of mice at specific time points and embedded in optimal cutting temperature compound (SAKURA, USA). The sections were 20-μm thick, fixed with 4% paraformaldehyde (PFA), washed twice with PBS, and blocked with 0.5% bovine serum albumin for 1 h at room temperature. The sections were then incubated with primary antibodies CD68 (1 : 1,000, Biolegend, USA), CD163 mAb (1 : 1,000, Santa Cruz Biotechnology), CD206 (1 : 1,000, Biolegend) and F4/80 Ab (1 : 1,000, Santa Cruz Biotechnology, USA) at 4℃ overnight, followed by incubation with secondary antibodies (Alexa-Fluor 488-conjugated anti-rabbit antibody (1 : 1,000, Thermo Fisher Scientific, USA) and Alexa-Fluor 594-conjugated anti-mouse antibody (1 : 1,000, Molecular Probes) for 1 h room temperature.8 The cell nuclei were identified with 4’,6-diamidino-2-phenylindole (1 : 1,000, DOJINDO). Images were observed at ×20 magnification using a BZ-X710 fluorescence microscope (KEYENCE, Japan).
Intraperitoneal Glucose Test and Glucose Tolerance Test (GTT)
After 12 weeks’ treatment, mice underwent an intraperitoneal GTT. Briefly, mice were fasted overnight and then stimulated with 2 g/kg d-glucose (Sigma-Aldrich), and blood glucose was subsequently measured continuously for up to 120 min using a blood glucose level monitor (Glutest Ace, Sanwa Kagaku Kenkyusho Co, Nagoya, Japan).
Western Blot Analysis
Western Blot analysis was performed as described previously.14 Visceral adipose tissue samples were ground, and the total protein concentration was measured using the Pierce BCA protein assay kit (Thermo Scientific). Equal amounts of protein were separated by SDS-polyacrylamide gel electrophoresis and transferred to polyvinylidene difluoride membranes (Immobilon-P, USA). The membranes were cut according to molecular weight and then incubated with antibodies against total and cleaved Tfam (dilution, 1 : 1,000, Santa Cruz Biotechnology), and Pgc1α (dilution, 1 : 1,000, proteintech). The membranes were further incubated with horseradish peroxide-linked secondary antibodies (dilution, 1 : 2,000, Dako) at room temperature for 1 h. After washing 3 times with PBS plus Tween, protein expression was visualized using the enhanced Chemi-Lumi one system (BIO-RAD). The intensity of the protein bands was normalized to the amount of GAPDH (dilution, 1 : 2,000, Cell signaling) and expressed as the ratio (fold increase) of the control value.
Isolation of Peritoneal Macrophages
Mice were injected intraperitoneally with 5 mL of thioglycollate medium in and killed humanely 5 days later. Next, 4 mL of PBS was injected intraperitoneally, and the fluid was aspirated and centrifuged through a 70-μm mesh to obtain peritoneal macrophages. After 24 h of adaptation, the macrophages were divided into 2 groups. The PBS group was supplemented with PBS, and the MRC-Q group was supplemented with MRC-Q (final 150 μg/mL). After 24 h, the cells were collected for subsequent experiments.
Flow Cytometry Analysis
Flow cytometry analysis was performed as previously described.15 The treated peritoneal macrophages (as mentioned above) were resuspended in pre-prepared Zombie solution and kept away from light for 15 min. Prepared antibody solution was used for staining and kept away from light for 15 min. After centrifugation, the supernatant was discarded, 100 µL fixative solution was added and the sample placed on ice for 10 min. Next, 1.5 mL PBS was added and centrifuged for 10 min. After the supernatant was discarded, 700 µL of FACS buffer (PBS base 0.5% BSA, 2 mM EDTA) was added to each sample and set aside. Flow cytometry (LSRFortessa X-20, Becton Dickinson, USA) was used for analysis. The data obtained were analyzed using FlowJo software (Becton Dickinson).
Statistical Analysis
Continuous parametric data are expressed as mean±standard error of the mean (SEM) and were analyzed using GraphPad Prism 10 (GraphPad Software, USA). The Shapiro-Wilk normality test was used to evaluate data distribution. For variables with a normal distribution, statistical significance was evaluated using an unpaired Student’s t-test between 2 groups. One-way analysis of variance (ANOVA) with Tukey’s multiple comparison test was used for ≥3 groups. P<0.05 was considered statistically significant.
Results
Effect of MRC-Q Administration on HFD-Induced Obesity and Adipose Tissue Remodeling
MRC-Q attenuated the high-fat DIO in terms of body weight from 7 weeks after treatment through to 12 weeks (Figure 1A,B). In addition, the amount of visceral adipose was reduced by MRC-Q treatment (Figure 1C,D). Next, we measured the blood glucose of mice every two weeks at a fixed time (3 p.m.) and found that the casual blood glucose in the MRC-Q treatment group was lower than that of the DIO group (Figure 1E). Furthermore, the GTT experiment found that the glucose tolerance of mice was improved by MRC-Q treatment (Figure 1F). Histological analysis showed that the size of the adipocytes in visceral fat was significantly reduced after MRC-Q treatment (Figure 1G–I).
Figure 1.
Effect of MRC-Q treatment on obesity and the accumulation of visceral fat. (A) Representative photos 12 weeks after treatment. (B) Quantitative analysis of body weight from baseline to 12 weeks of respective treatments and diets. Data are shown as mean±SEM and analyzed by one-way ANOVA. (C) Representative images of visceral fat 12 weeks after treatment. (D) Quantitative analysis of the adipose tissue weights. Data are shown as mean±SEM and analyzed by one-way ANOVA. (E) Quantitative analysis of the casual blood glucose from baseline to 12 weeks of feeding. Data are shown as mean±SEM and analyzed by one-way ANOVA. (F) Quantitative analysis of the glucose tolerance test. Data are shown as mean±SEM and analyzed by one-way ANOVA. (G) Representative histopathology images stained by H&E for visceral fat 12 weeks after treatment. (H,I) Quantitative analysis of the adipocyte diameter or area (n=5 per group). Data are shown as mean±SEM and analyzed by one-way ANOVA. Data are expressed as mean±SD. *P<0.05, **P<0.01, ***P<0.005, ****P<0.001 for DIO compared with SHAM mice, #P<0.05, ##P<0.01, ###P<0.005, ####P<0.001 for DIO+MRC-Q compared with DIO mice. DIO, diet-induced obesity; SD, standard deviation; SEM, standard error of the mean.
Effect of MRC-Q Administration on HFD-Induced Pro-Inflammatory Response in Visceral Fat
Figure 2A,B shows that treatment with MRC-Q significantly reduced the crown-like structure (CLS) in the visceral fat of the DIO mice. In addition, the number of F4/80-positive cells was reduced, and the numbers of CD163- or CD206-positive cells were increased after MRC-Q treatment (Figure 2C–F). These findings were supported by altered expression of macrophage surface markers (Figure 2G, Supplementary Figure 1A, Table), indicating that MRC-Q may have promoted polarization towards M2 macrophages in the visceral fat of mice. As a result, pro-inflammatory cytokines (i.e., TNF-α, IL-1β, IL-6) were attenuated against DIO by the MRC-Q treatment (Figure 2H).
Figure 2.
Effect of MRC-Q on pro-inflammatory reactions and M2 macrophages in the visceral fat of DIO mice. (A) Representative histopathology images stained by CD68 (green) for visceral fat 12 weeks after treatment. (B) Quantitative analysis of crown-like structures (n=5 per group). White arrow indicates CLS in (A). Data are shown as mean±SEM and analyzed by one-way ANOVA. (C) Representative histopathology images stained by CD163 (green), F4/80 (red), and DAPI (blue) for visceral fat. (D) Quantitative analysis of F4/80 positive cells, and CD163 positive cells (n=5 per group). Data are shown as mean±SEM and analyzed by one-way ANOVA. (E) Representative histopathology images stained by CD206 (green), F4/80 (red), and DAPI (blue) for visceral fat. (F) Quantitative analysis of F4/80 positive cells, and CD206 positive cells (n=5 per group). Data are shown as mean±SEM and analyzed by one-way ANOVA. (G) F4/80, CD68, CD11c, CD163, CD206, and Arg-1 mRNA expression by qRT-PCR in adipose tissue (n=5 per group). Data are shown as mean±SEM and analyzed by one-way ANOVA. (H) TNF-α, IL-1β, and IL-6 mRNA expression by qRT-PCR in the visceral fat (n=5 per group). Data are shown as mean±SEM and analyzed by one-way ANOVA. *P<0.05, **P<0.01, ***P<0.005, ****P<0.001 for DIO compared with SHAM mice, #P<0.05, ##P<0.01, ###P<0.005, ####P<0.001 for DIO+MRC-Q compared with DIO mice. DIO, diet-induced obesity; qRT-PCR, quantitative reverse transcription polymerase chain reaction; SEM, standard error of the mean.
Table.
Primers
| TNF-α | F:CAGGCGGTGCCTATGTCTC |
| R:CGATCACCCCGAAGTTCAGTAG | |
| IL-1β | F:GAAATGCCACCTTTTGACAGTG |
| R:TGGATGCTCTCATCAGGACAG | |
| IL-6 | F:CTGCAAGAGACTTCCATCCAG |
| R:AGTGGTATAGACAGGTCTGTTGG | |
| F4/80 | F:CTGCACCTGTAAACGAGGCTT |
| R:GCAGACTGAGTTAGGACCACAA | |
| CD68 | F:TGTCTGATCTTGCTAGGACCG |
| R:GAGAGTAACGGCCTTTTTGTGA | |
| CD11c | F:CTGGATAGCCTTTCTTCTGCTG |
| R: GCACACTGTGTCCGAACTCA | |
| CD86 | F:GCAGCACGGACTTGAACAAC |
| R:CTTTGTAAATGGGCACGGC | |
| CD163 | F:GGTGGACACAGAATGGTTCTTC |
| R:CCAGGAGCGTTAGTGACAGC | |
| CD206 | F:CTCTGTTCAGCTATTGGACGC |
| R:TGGCACTCCCAAACATAATTTGA | |
| Arg-1 | F:CTCCAAGCCAAAGTCCTTAGAG |
| R:GGAGCTGTCATTAGGGACATCA | |
| Ppgrγ | F:GGAAGACCACTCGCATTCCTT |
| R:GTAATCAGCAACCATTGGGTCA | |
| Pgc1α | F:TATGGAGTGACATAGAGTGTGCT |
| R:GTCGCTACACCACTTCAATCC | |
| Tfam | F: AACACCCAGATGCAAAACTTTCA |
| R:GACTTGGAGTTAGCTGCTCTTT | |
| mt-Nd1 | F: TTACTTCTGCCAGCCTGACC |
| R:CCGGCTGCGTATTCTACGTT | |
| mt-Nd5 | F: ACCCAATCAAACGCCTAGCA |
| R: AGGACTGGAATGCTGGTTGG | |
| Ucp-1 | F:GTGAACCCGACAACTTCCGAA |
| R:TGCCAGGCAAGCTGAAACTC | |
| Stat1 | F:TCACAGTGGTTCGAGCTTCAG |
| R:CGAGACATCATAGGCAGCGTG | |
| inhβA | F:TCCGAAGGATGGACCTAACTC |
| R:GCTTTCTGATCGCGTTGAGAAG | |
| Nos2 | F:GTTCTCAGCCCAACAATACAAGA |
| R:GTGGACGGGTCGATGTCAC | |
| Socs3 | F:TGCGCCTCAAGACCTTCAG |
| R:GCTCCAGTAGAATCCGCTCTC | |
| Klf4 | F:GGCGAGTCTGACATGGCTG |
| R:GCTGGACGCAGTGTCTTCTC | |
| Lxrα | F:CTGATTCTGCAACGGAGTTGT |
| R:GACGAAGCTCTGTCGGCTC | |
| Irf4 | F:CCGACAGTGGTTGATCGACC |
| R:CCTCACGATTGTAGTCCTGCTT | |
| Bmp7 | F:CCTGTCCATCTTAGGGTTGCC |
| R:GGCCTTGTAGGGGTAGGAGA |
Effect of MRC-Q on Mitochondria Biogenesis and UCP-1 Expression Through PGC1α Upregulation Against HFD-Induced Adipose Tissue Remodeling
Figure 3A,B shows that the protein expression of PGC1α and Tfam in the visceral fat was recovered by MRC-Q treatment against DIO. These findings were supported by the upregulated expression of mitochondrial DNA (i.e., mt-Nd-1, mt-ND-5), indicating that mitochondria biogenesis was promoted by MRC-Q treatment (Figure 3C). Interestingly, the expression of UCP-1 was also upregulated by MRC-Q treatment in the adipose tissue (Figure 3D).
Figure 3.
Effect of MRC-Q on mitochondria biogenesis and UCP-1 expression in the visceral fat. (A,B) Representative western blots and quantification of PGC1α, TFAM, and GAPDH in the visceral fat. (C) mt-ND1 and mt-ND5 mRNA expression by qRT-PCR in the visceral fat. Data are shown as mean±SEM and analyzed by one-way ANOVA. (D) Ucp-1 expression by qRT-PCR in the visceral fat. Data are shown as mean±SEM and analyzed by one-way ANOVA. **P<0.01, ***P<0.005, ****P<0.001 for DIO compared with SHAM mice, ##P<0.01, ###P<0.005, ####P<0.001 for DIO+MRC-Q compared with DIO mice. DIO, diet-induced obesity; SEM, standard error of the mean; UCP, uncoupling protein.
Effect of MRC-Q on Modulating Macrophage Induction Toward M2 Polarity In Vitro
MRC-Q treatment of isolated peritoneal macrophage reduced M1 surface marker (CD11c, CD86) expression and conversely augmented M2 surface markers (CD163, CD206, and Arg-1) (Figure 4A). FACS analysis also revealed that the proportion of M2 phenotype in isolated macrophages was upregulated by MRC-Q (Figure 4B). Furthermore, pro-M1 phenotype signaling (i.e., STAT1, Activin A, iNOS, and SOCS3) was downregulated by MRC-Q treatment (Figure 4C). On the other hand, pro-M2 phenotype signaling (i.e., KLF4, PPARγ, LXRα, IRF4, and BMP-7) was upregulated (Figure 4D).
Figure 4.
Effect of MRC-Q treatment macrophage polarization to M2 phenotype in vitro. (A) CD11c, CD86, CD163, CD206, and Arg-1 mRNA expression by qRT-PCR in isolated peritoneal macrophages. (B) Representative FACS plots by CD163 and CD206 with and without MRC-Q treatment for isolated peritoneal macrophages. (C) STAT1, inhβa, nos2, and socs3 mRNA expression by qRT-PCR in isolated peritoneal macrophages. (D) Klf4, PPARγ, LXRα, irf4, and bmp-7 mRNA expression by qRT-PCR in isolated peritoneal macrophages. Data are shown as mean±SEM and analyzed by unpaired Student’s t-test. **P<0.01, ***P<0.005, ****P<0.0001 for indicated comparisons. qRT-PCR, quantitative reverse transcription polymerase chain reaction; SEM, standard error of the mean.
Taken together, the findings suggested that MRC-Q treatment could change macrophages toward their anti-inflammatory phenotype.
Discussion
Obesity and T2DM caused by excessive energy intake have become global health issues.10 In this study, we investigated the effects of MRC-Q treatment on DIO mice and explored the potential underlying mechanisms (Figure 5). Our findings indicated that MRC-Q administration significantly improved HFD-induced obesity and reduced blood glucose levels in mice. In addition, the MRC-Q treatment alleviated the formation of the CLS in the visceral fat of DIO mice, suggesting a reduction in inflammatory cell infiltration, and promoted polarization to M2 macrophages. Recent studies have shown that mitochondrial transfer plays an important role in regulating immune responses. For instance, mesenchymal stem cell-mediated transfer of mitochondria rescued target organs from tissue damage mediating T-cell activation and T regulatory cell differentiation.16 In our study, we focused on the relationship of exogenous healthy mitochondria transfer and macrophages in terms of DIO. Obesity is a pro-inflammatory state in which mitochondrial functions are impaired,17,18 which creates a self-reinforcing pro-inflammatory state that exacerbates insulin resistance and glucose intolerance. Thus, inflammation and mitochondrial dysfunction are hallmarks of obesity-induced glucose intolerance. Our current study demonstrated that MRC-Q administration induced macrophages toward M2-polarization, resulting in decreasing inflammatory cytokine production in the setting of obesity. In other words, MRC-Q could exert anti-inflammatory effects and interrupt the pathological adverse feedback loop associated with metabolic syndrome, thereby mitigating the progression of obesity.
Figure 5.
Potential underlying mechanisms of MRC-Q effect against HFD-induced obesity. In the HFD-diet-induced obesity model, MRC-Q administration induced macrophages toward M2-polarity and exerted an anti-inflammatory effect in adipose tissue, leading to suppression of adipose-tissue remodeling, obesity, and improvement of glucose intolerance. HFD, high-fat diet.
Impaired mitochondrial dynamics, including reduced mitochondrial biogenesis, are closely linked to insulin resistance and hyperglycemia.19,20 Mitochondrial biogenesis plays a crucial role in adipogenesis, adipocyte differentiation, and thermogenesis. PGC1α, the primary regulator of mitochondrial biogenesis enhances the expression of Tfam, a key factor in mitochondrial DNA replication and transcription.21 Our results demonstrated that MRC-Q promoted mitochondria biogenesis as evidenced by increased protein expression of PGC1α and Tfam, as well as mitochondrial gene expression in adipose tissues, contributing to its protective effect against adipose tissue remodeling and potentially mitigating the detrimental changes associated with obesity.
Recent studies have demonstrated that mitochondria can be transferred between cells, and this process plays a critical role in regulating metabolic homeostasis. Adipocytes, and macrophages in particular, are key players in this intercellular mitochondrial transfer. Under normal physiological conditions, this transfer helps to maintain metabolic balance and proper adipose tissue function. However, in the context of obesity, particularly in DIO models, mitochondrial transfer from adipocytes to macrophages is significantly impaired, exacerbating metabolic dysfunction and contributing to the progression of obesity and its related complications.22 This reduction in mitochondrial transfer has been linked to increased inflammation, insulin resistance, and lipid accumulation in adipose tissues. We hypothesized that MRC-Q treatment could help to shift macrophage polarization toward the anti-inflammatory M2 phenotype, further promoting the uptake of healthy mitochondria. This positive feedback loop between mitochondrial transfer and macrophage polarization could be a crucial mechanism underlying the observed protective effects of MRC-Q in our study. Therefore, MRC-Q holds promise as an effective treatment strategy for metabolic diseases associated with HFD-induced obesity by targeting mitochondrial dysfunction and adipose tissue inflammation.
MRC-Q has been previously studied in the context of mitochondrial disease, particularly using the Ndufs4 KO mouse model of Leigh syndrome (LS). That study13 demonstrated that systemic administration of MRC-Q improves survival and motor function in LS models. In addition, after intravenous administration, MRC-Q-derived human mtDNA was detected in multiple tissues of Ndufs4KO mice, including blood, spleen, liver, bone marrow, heart, lung, and brain, indicating systemic biodistribution.13 However, direct mechanistic evidence in peripheral metabolic tissues or in acquired disease models has not been explored. Our current study identified a distinct and novel immunomodulatory mechanism of MRC-Q in an acquired metabolic disease model. These findings broaden the mechanistic understanding of MRC-Q and suggest its potential as a therapeutic across diverse inflammatory and metabolic disorders.
In conclusion, our findings provide important insights into the therapeutic potential of MRC-Q treatment against DIO. MRC-Q could be a novel approach to mitigating obesity-related metabolic disorders, positioning it as a promising candidate for future therapeutic development.
Disclosures
T.M. is a member of Circulation Reports’ Editorial Team. The remaining authors have no conflicts of interest.
Author Contributions
T.L. designed and performed the experiments, analyzed the data, wrote the manuscript; Y.S. conceived the scientific idea, designed the experiments, analyzed the data, edited the manuscript, supervised the project.; H.O., conceived the scientific idea, edited the manuscript, supervised the project.; T.H. performed the experiments; H.L. performed the experiments; Y.C. performed the experiments; Y.M. conceived the scientific idea, performed the experiments; R.T. conceived the scientific idea, edited the manuscript, supervised the project; M.S. conceived the scientific idea, supervised the project; T.M. conceived the scientific idea, the supervised project.
Supplementary Files
Supplementary Figure 1. Supplementary Figure 2. Supplementary Figure 3..
Acknowledgments
We express our gratitude to the staff of the Division of Experimental Animals at the Nagoya University School of Medicine for their assistance with the animal experiments. We thank Ms. Yoko Inoue (Nagoya University Graduate School of Medicine) and Ms. Junko Hayashi (LUCA Science, Inc.) for technical assistance.
Funding Statement
Grants: This work was supported by a grant (No. 22K08201 to Y.S.) from the Ministry of Education, Culture, Sports, Science and Technology of Japan.
Data and Materials Availability
All data are available in the main text or the supplementary materials (Supplementary Figures 1–3).
References
- 1. Hanson P, Weickert MO, Barber TM.. Obesity: Novel and unusual predisposing factors. Ther Adv Endocrinol Metab 2020; 11: 2042018820922018, doi:10.1177/2042018820922018. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Kahn SE, Cooper ME, Del Prato S.. Pathophysiology and treatment of type 2 diabetes: Perspectives on the past, present, and future. Lancet 2014; 383: 1068–1083, doi:10.1016/S0140-6736(13)62154-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Ruze R, Liu T, Zou X, Song J, Chen Y, Xu R, et al.. Obesity and type 2 diabetes mellitus: Connections in epidemiology, pathogenesis, and treatments. Front Endocrinol (Lausanne) 2023; 14: 1161521, doi:10.3389/fendo.2023.1161521. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Davies MJ, D’Alessio DA, Fradkin J, Kernan WN, Mathieu C, Mingrone G, et al.. Management of hyperglycemia in type 2 diabetes, 2018: A Consensus Report by the American Diabetes Association (ADA) and the European Association for the Study of Diabetes (EASD). Diabetes Care 2018; 41: 2669–2701, doi:10.2337/dci18-0033. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Onakpoya IJ, Lee JJ, Mahtani KR, Aronson JK, Heneghan CJ.. Naltrexone-bupropion (Mysimba) in management of obesity: A systematic review and meta-analysis of unpublished clinical study reports. Br J Clin Pharmacol 2020; 86: 646–667, doi:10.1111/bcp.14210. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Lecoutre S, Clement K, Dugail I.. Obesity-related adipose tissue remodeling in the light of extracellular mitochondria transfer. Int J Mol Sci 2022; 23: 632, doi:10.3390/ijms23020632. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Heinonen S, Jokinen R, Rissanen A, Pietilainen KH.. White adipose tissue mitochondrial metabolism in health and in obesity. Obes Rev 2020; 21: e12958, doi:10.1111/obr.12958. [DOI] [PubMed] [Google Scholar]
- 8. Ying W, Fu W, Lee YS, Olefsky JM.. The role of macrophages in obesity-associated islet inflammation and beta-cell abnormalities. Nat Rev Endocrinol 2020; 16: 81–90, doi:101038/s41574-019-0286-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Hammarstedt A, Gogg S, Hedjazifar S, Nerstedt A, Smith U.. Impaired adipogenesis and dysfunctional adipose tissue in human hypertrophic obesity. Physiol Rev 2018; 98: 1911–1941, doi:10.1152/physrev.00034.2017. [DOI] [PubMed] [Google Scholar]
- 10. Aouadi M, Tencerova M, Vangala P, Yawe JC, Nicoloro SM, Amano SU, et al.. Gene silencing in adipose tissue macrophages regulates whole-body metabolism in obese mice. Proc Natl Acad Sci USA 2013; 110: 8278–8283, doi:10.1073/pnas.1300492110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Chouchani ET, Kajimura S.. Metabolic adaptation and maladaptation in adipose tissue. Nat Metab 2019; 1: 189–200, doi:10.1038/s42255-018-0021-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Puigserver P, Spiegelman BM.. Peroxisome proliferator-activated receptor-gamma coactivator 1 alpha (PGC-1 alpha): Transcriptional coactivator and metabolic regulator. Endocr Rev 2003; 24: 78–90, doi:10.1210/er.2002-0012. [DOI] [PubMed] [Google Scholar]
- 13. Nakai R, Varnum S, Field RL, Shi H, Giwa R, Jia W, et al.. Mitochondria transfer-based therapies reduce the morbidity and mortality of Leigh syndrome. Nat Metab 2024; 6: 1886–1896, doi:10.1038/s42255-024-01125-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Che Y, Shimizu Y, Hayashi T, Suzuki J, Pu Z, Tsuzuki K, et al.. Chronic circadian rhythm disorder induces heart failure with preserved ejection fraction-like phenotype through the Clock-sGC-cGMP-PKG1 signaling pathway. Sci Rep 2024; 14: 10777, doi:101038/s41598-024-61710-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Tsuzuki K, Shimizu Y, Suzuki J, Pu Z, Yamaguchi S, Fujikawa Y, et al.. Adverse effect of circadian rhythm disorder on reparative angiogenesis in hind limb ischemia. J Am Heart Assoc 2021; 10: e020896, doi:10.1161/JAHA.121.020896. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Court AC, Le-Gatt A, Luz-Crawford P, Parra E, Aliaga-Tobar V, Batiz LF, et al.. Mitochondrial transfer from MSCs to T cells induces Treg differentiation and restricts inflammatory response. EMBO Rep 2020; 21: e48052, doi:10.15252/embr.201948052. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Clemente-Postigo M, Oliva-Olivera W, Coin-Araguez L, Ramos-Molina B, Giraldez-Perez RM, Lhamyani S, et al.. Metabolic endotoxemia promotes adipose dysfunction and inflammation in human obesity. Am J Physiol Endocrinol Metab 2019; 316: E319–E332, doi:10.1152/ajpendo.00277.2018. [DOI] [PubMed] [Google Scholar]
- 18. Li E, Ji J, Zong G, Liu H, Sun Y, Wei L, Xia Z, et al.. Myeloid PGC1beta attenuates high-fat-diet induced inflammation via mitochondrial fission/mtDNA/Nlrp3 pathway. Biochim Biophys Acta Mol Basis Dis 2025; 1871: 167528, doi:10.1016/j.bbadis.2024.167528. [DOI] [PubMed] [Google Scholar]
- 19. Hojlund K, Mogensen M, Sahlin K, Beck-Nielsen H.. Mitochondrial dysfunction in type 2 diabetes and obesity. Endocrinol Metab Clin North Am 2008; 37: 713–731, x, doi:10.1016/j.ecl.2008.06.006. [DOI] [PubMed] [Google Scholar]
- 20. Wu H, Wang Y, Li W, Chen H, Du L, Liu D, et al.. Deficiency of mitophagy receptor FUNDC1 impairs mitochondrial quality and aggravates dietary-induced obesity and metabolic syndrome. Autophagy 2019; 15: 1882–1898, doi:10.1080/15548627.2019.1596482. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Yakubovskaya E, Guja KE, Eng ET, Choi WS, Mejia E, Beglov D, et al.. Organization of the human mitochondrial transcription initiation complex. Nucleic Acids Res 2014; 42: 4100–4112, doi:10.1093/nar/gkt1360. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Brestoff JR, Wilen CB, Moley JR, Li Y, Zou W, Malvin NP, et al.. Intercellular mitochondria transfer to macrophages regulates white adipose tissue homeostasis and is impaired in obesity. Cell Metab 2021; 33: 270–282.e8, doi:10.1016/j.cmet.2020.11.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supplementary Figure 1. Supplementary Figure 2. Supplementary Figure 3..
Data Availability Statement
All data are available in the main text or the supplementary materials (Supplementary Figures 1–3).