DNA hypomethylated modified lncRNA MALAT1 promotes atherosclerotic cardiovascular disease progression through NF-κB signaling pathway regulating cholesterol metabolism and inflammatory response

Abstract

Atherosclerotic cardiovascular disease (ASCVD) is a major cause of death and disability worldwide. The pathological basis of these conditions is atherosclerosis (AS), which is associated with high mortality and significant morbidity rates. Long non-coding RNAs (lncRNAs) are crucial in various human diseases, including ASCVD; however, the specific mechanisms by which disease-associated lncRNAs are involved in ASCVD are not fully understood. In our study, we observed upregulated expression of metastasis-associated lung adenocarcinoma transcript-1 (MALAT1) and DNA hypomethylation levels in ASCVD patients. To investigate the role of MALAT1 in ASCVD, we used oxidized low-density lipoprotein (ox-LDL)-treated THP-1 macrophages as a cellular model. Functional experiments demonstrated that the knockdown of MALAT1 reversed ox-LDL-mediated inhibition of cell viability, promotion of apoptosis, cholesterol metabolism imbalance, and inflammatory responses. Furthermore, inhibition of MALAT1 ameliorated the progression of AS in ApoE^−/− mice by suppressing cholesterol metabolism and inflammation. Mechanistically, DNA methyltransferase 1 (DNMT1)-mediated DNA methylation modification inhibited the expression of lncRNA MALAT1, which in turn inhibbited the activation of the nuclear factor-κB (NF-κB) signaling pathway. Additionally, rescue experiments indicated that increasing DNMT1 levels attenuated ox-LDL-induced malignant progression of ASCVD, and this reduction was reversed by elevating MALAT1 levels. Notably, when NF-κB was inhibited (BAY11-7082) alongside MALAT1 overexpression, the reversal effect was abolished. Taken together, our findings suggest that decreased DNA hypomethylation mediated by DNMT1 leads to increased MALAT1 expression, subsequently activating the NF-κB pathway in ASCVD.

Highlights

• •LncRNA MALAT1 was increaseed in ASCVD patients and ox-LDL-treated THP-1 macrophages.
• •The upregulated MALAT1 was regulated by silenced DNMT1-mediated DNA hypomethylation.
• •Increased DNMT1 blocked malignant progression of ASCVD by inhibition of MALTA1.
• •LncRNA MALAT1 promoted ASCVD progression by activating NF-κB pathway.

1. Introduction

Atherosclerotic cardiovascular disease (ASCVD) refers to a broad range of diseases characterized by atherosclerosis (AS) as their underlying pathology [1]. The development and advancement of ASCVD is a lengthy process influenced by various factors [[2], [3], [4]]. This category encompasses conditions such as coronary heart disease, atherosclerotic stroke, and peripheral vascular disease [5]. AS commonly affects areas like the coronary arteries, cerebral blood vessels, peripheral arteries, carotid arteries, aorta, and renal arteries [6]. Notably, dyslipidemia and inflammation are the risk factors for ASCVD [7,8]. Currently, standard therapies for dyslipidemia, such as statins, fibrates, and ezetimibe, are the primary pharmacological approaches for lowering ASCVD risk [9,10]. A comprehensive understanding of the molecular mechanisms and regulatory networks involved in the progression of ASCVD is essential for identifying novel therapeutic targets.

Long noncoding RNAs (lncRNAs) are RNA molecules that exceed 200 nucleotides in length [11]. Although they do not encode proteins, they play a significant role in various biological processes, including epigenetic regulation (such as DNA methylation, histone modification), post-transcriptional regulation (acting as microRNA sponges), and regulation of protein translation. These functions enable lncRNAs to participate in diverse physiological and pathological processes, such as inflammation and lipid metabolism [12,13], which are critical in ASCVD progression [14]. For example, Bampatsias et al. uncovered that lncRNA β-secretase-1 (BACE1-AS) is related to ASCVD, and elevated levels of BACE1-AS are linked to an increased estimated risk of coronary artery disease [15]. Qu et al. indicated that inhibition of lncRNA Gpr137b-ps promotes macrophages autophagy and suppresses lesions in AS [16]. Notably, lncRNA metastasis-associated lung adenocarcinoma transcript 1 (MALAT1) is a highly conserved lncRNA that is widely expressed in a variety of tissues [17]. Liu et al. suggested that lncRNA MALAT1 may serve as a multifunctional biomarker in ASCVD [18]. Although MALAT1 has been reported to play an important role in coronary heart disease [19], large artery atherosclerotic stroke [20], and coronary AS [21], the molecular mechanism of lncRNA MALAT1 in ASCVD still needs further investigation.

DNA methylation serves as a crucial epigenetic mechanism for the regulation of gene expression, and abnormal lncRNA expression and DNA methylation patterns play a significant role in human diseases [22]. Aberrant hypomethylation at gene promoter regions, often resulting from reduced methyltransferase (DNMT) activity, can lead to enhanced gene expression. DNMTs (including DNMT1, DNMT3a/b) typically catalyze DNA methylation, and their dysfunction may contribute to hypomethylation-related gene activation [23]. Numerous studies have suggested a correlation between the DNA methylation of lncRNAs and various diseases. For example, Wang et al. uncovered that reduced methylation of the lncRNA H19 promoter elevated H19 levels and activated the ERK1/2 pathway, promoting osteogenic differentiation and vascular calcification in chronic kidney disease [24]. Similarly, Ding et al. illustrated that the transcription factor FosB prevented the lncRNA lncARF promoter from binding to DNMT1, resulting in DNA hypomethylation and increased lncARF expression, which in turn exacerbated AS progression [25]. In particular, lncRNA MALAT1 expression was associated with DNA methylation levels. For instance, Hu et al. figured out that DNMT1-mediated hypomethylation of MALAT1 promoter upregulates MALAT1 expression, which in turn promotes tumorigenesis in triple-negative breast cancer by sponging miR-137 and derepressing its target BCL11A [26]. However, whether MALAT1 is modified by DNA methylation in ASCVD and the underlying mechanisms remain unknown.

The nuclear factor-κB (NF-κB) signaling pathway is an essential intracellular signaling pathway involved in the regulation of a variety of biological processes, including cell growth, proliferation, metabolism, survival, and inflammation in human diseases [[27], [28], [29]]. For instance, Cheng et al. showed that Hsp90β activates the Srebp2 and NF-κB pathways, which enhances cholesterol production and osteoclast gene expression [30]. Chen et al. suggested that inhibition of NF-κB and AP-1 signal pathway by quercetin suppresses TNF-α-induced apoptosis and inflammatory responses in coronary heart disease [31]. Notably, the aberrant expression of the NF-κB signaling pathway may be associated with the early atypical characteristics of ASCVD [32]. Additionally, lncRNAs have been reported to be involved in disease progression by regulating the NF-κB pathway. Deng et al. revealed that lncRNA ANRIL activates the NF-κB signaling pathway, worsening tumor development in gastric cancer [33]. Zang et al. noted that lncRNA FIRRE elevates OGD/R-induced injury and inflammation in cerebral microglial cells by enhancing the NF-κB pathway [34]. Specifically, Lin et al. disclosed that silencing lncRNA MALAT1 visibly ameliorates septic lung injury in mice by blocking the p38 MAPK/p65 NF-κB pathway [35]. However, it has not yet been reported whether lncRNA MALAT1 plays a role in regulating the NF-κB pathway in ASCVD.

In our study, we created a cellular model of ASCVD by treating THP-1 macrophages with oxidized low-density lipoprotein (ox-LDL), and we developed an animal model of atherosclerosis (AS) using high-fat diet (HFA)-fed ApoE^−/− mice. We explored the molecular mechanism of lncRNA MALAT1 in the development of ASCVD, which may provide new insights into the treatment of ASCVD.

2. Materials and methods

2.1. Human tissues samples

This study was performed in line with the principles of the Declaration of Helsinki. Approval was granted by the Ethics Committee of the Fourth Affiliated Hospital of Xinjiang Medical University. Written informed consent was obtained from all participants prior to sample collection. Our study focuses on 40 outpatient patients diagnosed with ASCVD at the Fourth Affiliated Hospital of Xinjiang Medical University between June 2023 and June 2024. ASCVD is defined as coronary artery disease, cerebrovascular disease, or peripheral artery disease. A total of 40 cases from the normal control group were collected simultaneously at the Brain Disease Center and the Health Examination Center. Blood samples were collected from the veins of the study subjects using ethylenediaminetetraacetic acid (EDTA) anticoagulation tube. Isolation of human peripheral blood mononuclear cells (PBMCs) using Ficoll-Paque density gradient centrifugation according to previous reports [36].

2.2. Cell culture and treatment

THP-1 cells were purchased from Wuhan Pricella Biotechnology Co., Ltd, and cultured with RPMI medium 1640 with 10 % fetal bovine serum and 1 % penicillin-streptomycin at 37 °C and 5 % CO₂ incubator. Cells were treated with 100 ng/ml phorbol-12-myristate 13-acetate for 48 h to induce THP-1 monocyte differentiation into macrophages. The knockdown vectors of MALAT1, DNMT1, DNMT3a, and DNMT3b, as well as overexpression vectors of DNMT1 and MALAT1 and their controls were purchased from Genechem (Shanghai, China). Lipofectamine 2000 transfection reagent (Invitrogen, USA) was utilized to transfect THP-1 macrophages. THP-1 macrophages were treated with 50 μg/ml ox-LDL (Invitrogen, USA) for 24 h in the presence or absence of 10 μM NF-κB inhibitor BAY11-7082 (BAY, Selleck).

2.3. Animals and treatment

All procedures were conducted in accordance with the Guiding Principles in the Care and Use of Animals and were approved by the Laboratory Animal Ethics Committee of the Fourth Affiliated Hospital of Xinjiang Medical University. C57BL/6 and ApoE^−/− mice (seven-week-old) were fed with a standard diet for a week, maintained on a light cycle of 12 h of light and 12 h of darkness, with food and water available ad libitum. The C57BL/6 mice were used in the control group, and ApoE^−/− mice were used to construct a model of AS. ApoE^−/− mice were randomly assigned to 2 groups: AS (ApoE^−/−) group and kd-MALAT1 (ApoE^−/− + kd-MALAT1) group (n = 8/group). ApoE^−/− mice were subjected to an HFD (consisting of 21 % fat and 1.25 % cholesterol; Xietong Organism Inc., China) for 8 weeks to promote the development of AS. The siRNA-MALAT1 lentivirus was injected into the tail vein of HFD-fed ApoE^−/− mice for 8 weeks. The control group remained on a normal diet.

2.4. Real-Time quantitative PCR (RT-qPCR)

Total RNA was extracted using TRIzol reagent (Invitrogen, USA). RNA was reverse transcribed into cDNA using a Thermo Fisher Revert Aid First Stand cDNA Synthesis Kits (Invitrogen, USA). The expression of MALAT1, DNMT1, DNMT3a, and DNMT3b was detected using SYBR Premix Ex Taq (Yeasen, China) on an ABI 7500 Real-Time PCR System (Applied Biosystems, USA). The sequences of primers are shown in Table 1.

Table 1.

Sequences of primers for RT-qPCR.

Name	Forward (5′–3′)	Reverse (5′–3′)
Human
MALAT1	GGGTGTTTACGTAGACCAGAACC	CTTCCAAAAGCCTTCTGCCTTAG
DNMT1	GGGGACGACGGGAAGACCT	CCGGCCAATTCGGTAGGG
DNMT3a	TATGAACAGGCCGTTGGCATC	AAGAGGTGGCGGATGACTGG
DNMT3b	GGCAAGTTCTCCGAGGTCTCTG	TGGTACATGGCTTTTCGATAGGA
GAPDH	GGAGCGAGATCCCTCCAAAAT	GGCTGTTGTCATACTTCTCATGG
Mouse
MALAT1	GGGAGTGGTCTTAACAGGGAGGAG	AACAGCATAGCAGTACACGCCTTC
GAPDH	TGGCCTTCCGTGTTCCTAC	GAGTTGCTGTTGAAGTCGCA

2.5. Methylation-specific polymerase chain reaction (MSP)

Genomic DNA was extracted using the QIAamp DNA Mini Kit (Qiagen, Germany) according to the manufacturer's instructions. Bisulfite conversion of DNA was performed using the EZ DNA Methylation-Gold Kit (Zymo Research, USA). MSP was conducted using specific primers for the MALAT1 promoter region. The primer sequences used for MSP are as follows: Methylated primers (M): Forward: 5′-TTTCGGCGTTTGTTTTTGAC-3′, Reverse: 5′-AACTAAAACTTCCCGACGC-3′. Unmethylated primers (U): Forward: 5′-TGGTGTTTGTTTTTGATGTAG-3′, Reverse: 5′-AACTAAAACTTCCCAACACC-3′. PCR was performed using the following conditions: initial denaturation at 95 °C for 5 min, followed by 40 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s, with a final extension at 72 °C for 5 min. The PCR products were analyzed by 2 % agarose gel electrophoresis.

2.6. Cell proliferation assay

Cells were seeded in a 96-well plate at 2 × 10⁵ cells/well density. After transfection, cells were treated with ox-LDL. Subsequently, 10 μl of CCK-8 solution was added to each well and incubated at 37 °C for 2 h. Absorbance was measured at 450 nm using a microplate reader (BioRed).

2.7. Cell apoptosis assay

Cells were plated in 6-well plates at 2 × 10⁵ cells/well density. Following transfection and treatment, the cells were harvested and resuspended in 100 μl of binding buffer. Solutions of propodeum iodide (PI) and Annexin V-FITC were then introduced to the cell suspension. After incubation for 15 min, 400 μl binding buffer was added. The rate of apoptosis in the cells was evaluated using a flow cytometer (Krefeld, Germany).

2.8. Hematoxylin and eosin (H&E) staining

The aortic roots were removed and preserved overnight in 4 % paraformaldehyde before being embedded in paraffin wax. The resulting tissue samples were sectioned to a thickness of 5 μm. H&E staining followed the manufacturer's protocol (Solarbio Biotechnology, China). Microscopic images of the lesions located in the aortic sinus were obtained using an optical microscope.

2.9. Western blot analysis

Cells and tissue samples were lysed using RIPA lysis buffer (Beyotime, China) and supplemented with protease inhibitors (Thermo Fisher, USA). The proteins (20 μg) were separated by SDS-PAGE and then transferred to PVDF membranes. The membranes were incubated with 5 % skimmed milk at room temperature for 1 h, and then incubated with the primary antibodies, including ATP-binding cassette (ABC) transports A1 (ABCA1, 1:1000, Cell signaling technology), ABCG1 (1:2000, Abcam), p-p65 (1:1000, Cell signaling technology), p65 (1:1000, Cell signaling technology), p-IκBα (1:1000; Cell signaling technology), IκBα (1:1000, Cell signaling technology), and GAPDH (1:2500, Abcam). Following incubation with HRP-conjugated goat anti-rabbit secondary antibodies (1:10000, Abcam), protein expression levels were assessed using enhanced chemiluminescence (Beyotime, China).

2.10. Enzyme-linked immunosorbent assay (ELISA)

The levels of TNF-α and IL-1β in cell supernatants and mouse tissues were measured utilizing commercially available ELISA kits (human TNF-α and mouse IL-1β: Beyotime, China; mouse TNF-α and human IL-1β: Elabscinece, China), following the protocol provided by the manufacturer.

2.11. Chromatin immunoprecipitation (ChIP)

Cells were collected and fixed in 1 % formaldehyde for 10 min. They were treated with lysis buffer and sonicated. After centrifugation at 13,000 rpm at 4 °C, the supernatant was cultured overnight at 4 °C with the negative control antibody IgG and primary antibody DNMT1 (Abcam), respectively. The immune complexes were then isolated using protein A/G-Sepharose beads for 4 h. The immunoprecipitates were eluted with elution buffer and de-crosslinked at 65 °C overnight. Finally, the binding of DNMT1 and MALAT1 promoter regions was detected by RT-qPCR. The primer sequences used for ChIP are as follows: Forward primer: 5′-AGGCGGTTTCAGAGTTTGGA-3′, Reverse primer: 5′-TCCCAACTCTGAACCGCCTA-3'.

2.12. Statistical analysis

The statistical analyses conducted in this study utilized GraphPad Prism 8.0 software (La Jolla, CA, USA). Data from three independent experiments were expressed as mean ± standard deviation. To assess differences between the two groups, unpaired T-tests were employed, and One-way analysis of variance (ANOVA) with Tukey post hoc analysis was used for comparisons among multiple groups. Statistical significance was indicated by P values of less than 0.05.

3. Results

3.1. LncRNA MALAT1 was increased and the methylation level of MALAT1 was decreased in ASCVD patients and ox-LDL-induced THP-1 macrophages

First, we detected the levels of lncRNA MALAT1 by RT-qPCR, and the results indicated that the MALAT1 expression was higher in ASCVD patients compared to the normal controls (Fig. 1A). The ASCVD cellular model was constructed by treatment of THP-1 macrophages with the oxidized low-density lipoprotein (ox-LDL). RT-qPCR results showed that MALAT1 expression was elevated in ox-LDL-treated THP-1 macrophages (Fig. 1B). Furthermore, previous research has indicated that the lncRNA MALAT1 promoter undergoes DNA methylation modification [37]. In our study, we measured the methylation status of the MALAT1 promoter using MSP. We found that the MALAT1 promoter was hypomethylated in ASCVD samples compared to normal samples (Fig. 1C). Moreover, there was a noticeable reduction in the DNA methylation level of MALAT1 in ox-LDL-treated THP-1 macrophages compared to the control group (Fig. 1D). In addition, the clinical characteristics of the ASCVD patients and normal controls are summarized in Table 2. ASCVD patients had higher TC and LDL-C levels, lower HDL-C levels, and a higher smoking rate than controls, with no significant differences in age or sex. These data uncovered that the upregulated MALAT1 expression and hypomethylation of MALAT1 were found in ASCVD and ox-LDL-treated THP-1 macrophages.

Fig. 1.

LncRNA MALAT1 was increased and the methylation level of MALAT1 was decreased in ASCVD patients and ox-LDL-induced THP-1 macrophages. A: The expression of MALAT1 in PBMCs of ASCVD patients was detected by RT-qPCR (n = 40). B: The level of MALAT1 was measured in ox-LDL-stimulated THP-1 macrophages by RT-qPCR (n = 3). C: MALAT1 methylation in ASCVD patients was analyzed by MSP (n = 3). D: MALAT1 methylation in ox-LDL-stimulated THP-1 macrophages was analyzed by MSP (n = 3). Data are the mean ± SD. ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001.

Table 2.

Clinical characteristics of the patients.

Characteristics	ASCVD patients (n = 40)	Normal controls (n = 40)	P-value
Age (years)	63.90 ± 10.80	64.45 ± 12.97	0.8373
Gender (male/female)	23/17	22/18	0.8217
Smoking (%)	60.00	27.50	0.0034∗
Disease type
Coronary artery disease	15	–	–
Cerebrovascular disease	12	–	–
Peripheral artery disease	13	–	–
Lipid profile
TC (mmol/L)	6.23 ± 0.60	5.21 ± 0.55	<0.001∗
LDL-C (mmol/L)	4.26 ± 0.63	2.74 ± 0.56	<0.001∗
HDL-C (mmol/L)	1.13 ± 0.27	1.48 ± 0.23	<0.001∗

TC: total cholesterol, LDL-C: Low-density lipoprotein cholesterol, HDL-C: High-density lipoprotein cholesterol.

3.2. Inhibition of MALAT1 expression reversed ox-LDL-mediated cell proliferation, apoptosis, cholesterol homeostasis and inflammatory response of THP-1 macrophages

To investigate the effect of MALAT1 on cellular function, we reduced MALAT1 levels in ox-LDL-treated THP-1 macrophages. RT-qPCR illustrated that the MALAT1 expression was increased in these macrophages, while silencing MALAT1 effectively diminished its levels (Fig. 2A). Next, the CCK-8 assay revealed that ox-LDL decreased the cell viability of THP-1 macrophages, whereas this negative effect was remarkably recovered by transfection of the MALAT1-depleted vector (Fig. 2B). Moreover, the flow cytometry analysis showed an increase in apoptotic cell death was improved in ox-LDL-treated THP-1 macrophages, which was reversed by MALAT1 inhibition (Fig. 2C–D). Furthermore, ABCA1 and ABCG1 play an important role in cholesterol homeostasis by regulating its efflux and transport [38]. To explore the role of MALAT1 in cholesterol homeostasis, we examined the protein expression of ABCA1 and ABCG1. Western blot analysis demonstrated that ox-LDL suppressed the protein levels of both ABCA1 and ABCG1, whereas repression of MALAT1 notably abolished the inhibition induced by ox-LDL in THP-1 macrophages (Fig. 2E–F). We also observed that the levels of pro-inflammatory cytokines TNF-α and IL-1β were greatly increased in ox-LDL-treated THP-1 macrophages, whereas depletion of MALAT1 partially rescued ox-LDL-induced pro-inflammatory effects (Fig. 2G). Taken together, our data showed that silencing MALAT1 reversed the ox-LDL-induced inhibition of cell viability and the promotion of cell apoptosis, cholesterol metabolism imbalance, and inflammatory responses.

Fig. 2.

Inhibition of MALAT1 expression reversed ox-LDL-mediated cell proliferation, apoptosis, cholesterol homeostasis, and inflammatory response of THP-1 macrophages. A: The expression of MALAT1 in the control, ox-LDL, ox-LDL + kd-NC, and ox-LDL + kd-MALAT1 group of THP-1 macrophages was assessed by RT-qPCR. B: CCK-8 assay was used to analyze the cell proliferation of THP-1 macrophages. C–D: Flow cytometry analysis was used to measure the cell apoptosis of four groups. E–F: The protein levels of ABCA1 and ABCG1 in THP-1 macrophages of four groups were measured by Western blot. G: The expression levels of TNF-α and IL-1β were analyzed by ELISA kits. Data are the mean ± SD (n = 3). ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001.

3.3. Depletion of MALAT1 alleviated atherosclerosis progression in mice

We fed ApoE^−/− mice an HFD to induce AS and investigated the role of MALAT1 in ASCVD. Initially, we measured MALAT1 levels in aortic tissues by RT-qPCR. Compared with the control group, MALAT1 expression was notably increased in ApoE^−/− model mice fed with an HFD, while knockdown MALAT1 led to a substantial reduction in its levels in the model mice (Fig. 3A). H&E staining suggested that ApoE^−/− model mice exhibited prominent atherosclerotic lesions compared to controls, which were visibly attenuated by treatment with the MALAT1 knockdown vector (Fig. 3B). Moreover, the levels of ABCA1 and ABCG1 were found to be suppressed in ApoE^−/− model mice relative to controls, whereas this inhibition was effectively neutralized by suppression of MALAT1 (Fig. 3C–D). Additionally, ELISA results showed an increase in TNF-α and IL-1β levels in ApoE^−/− mice, while inhibition of MALAT1 partially alleviated the secretion of these pro-inflammatory cytokines (Fig. 3E–F). These observations revealed that depletion of MALAT1 attenuated the progression of AS by impeding imbalance in cholesterol homeostasis and inflammation.

Fig. 3.

Depletion of MALAT1 alleviated atherosclerosis progression in mice. A: Aorta tissues were collected from atherosclerosis mice, and the expression level of MALAT1 was detected by RT-qPCR. B: H&E staining was performed in the aortic roots of mice. C–D: The protein levels of ABCA1 and ABCG1 in the aorta of mice were measured by Western blot. E–F: The expression levels of TNF-α and IL-1β were analyzed by ELISA kits. Data are the mean ± SD (n = 8).∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001.

3.4. DNMT1-mediated methylation of MALAT1 was involved in cell proliferation, apoptosis, cholesterol metabolism, and inflammatory response

As depicted in Fig. 1C–D, the increased levels of MALAT1 may be associated with the DNA hypomethylation of its promoter. We investigated the specific mechanisms through which DNA methylation regulates MALAT1. We silenced the three major DNA methyltransferases DNMT1, DNMT3a, and DNMT3b, and then assessed MALAT1 expression by RT-qPCR. Our results illustrated that we successfully knocked down DNMT1, DNMT3a, and DNMT3b; however, only the silencing of DNMT1 led to a significant increase in MALAT1 expression, while DNMT3a and DNMT3b did not have this effect (Fig. 4A–C). ChIP results indicated that DNMT1 was concentrated in the MALAT1 promoter region (Fig. 4D). In addition, MSP analysis indicated that DNMT1 knockdown significantly reduced MALAT1 promoter methylation (Fig. 4E). As indicated in Fig. 4F, ox-LDL-induced upregulation of MALAT1 was blocked by overexpression of DNMT1, whereas enforced expression of MALAT1 counteracted this inhibition. The CCK-8 assay suggested that DNMT1 diminished the inhibition of cell viability induced by ox-LDL, which was recovered by overexpressing MALAT1 (Fig. 4G). Furthermore, flow cytometry analysis figured out that the elevated DNMT1 effectively blocked cell apoptosis induced by ox-LDL, while overexpression of MALAT1 neutralized this effect caused by DNMT1 (Fig. 4H–I). The results of western bot analysis uncovered that ox-LDL-mediated the suppression of ABCA1 and ABCG1 was visibly restored by the upregulation of DNMT1, while the increased expression of MALAT1 abolished the effects of overexpression of DNMT1 (Fig. 4J). Finally, the forced expression of DNMT1 inhibited the increase of inflammatory cytokines TNF-α and IL-1β in ox-LDL-treated THP-1 macrophages, but this effect was observably reversed by overexpressing MALAT1 (Fig. 4K). Based on these data, we uncovered that DNMT1 improved cell proliferation, reduced cell apoptosis, cholesterol homeostasis imbalance, and inflammatory response by repressing lncRNA MALAT1 expression.

Fig. 4.

DNMT1-mediated methylation of MALAT1 was involved in cell proliferation, apoptosis, cholesterol metabolism, and inflammatory response. A–C: The expression of DNA methyltransferases (including DNMT1, DNMT3a, and DNMT3b) and MALAT1 was detected by RT-qPCR after depletion of DNMT1, DNMT3a, and DNMT3b, respectively. D: Relative enrichment of DNMT1 in the MALAT1 promoter was detected by chromatin immunoprecipitation (ChIP). E: Methylation levels of MALAT1 promoter in DNMT1-silencing cells was detected by MSP. F: The expression level of MALAT1 was detected in control, ox-LDL, ox-LDL + DNMT1, and ox-LDL + DNMT1+MALAT1 groups. G: Cell viability of four groups was assessed by CCK-8 assay. H–I: Cell apoptosis in THP-1 macrophages of four groups was measured by flow cytometry analysis. J: The protein levels of ABCA1 and ABCG1 were measured by Western blot. K: The protein levels of TNF-α and IL-1β were analyzed by ELISA kits. Data are the mean ± SD (n = 3). ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001.

3.5. MALAT1 activated the NF-κB signaling pathway

Western blot analysis was conducted to detect the protein levels associated with the NF-κB signaling pathway in both cellular and mice models. In ox-LDL-treated THP-1 macrophages, there was an increase in phosphorylated NF-κB p65 and IκBα (referred to as p-p65 and p-IκBα), which was partially reversed by silencing MALAT1, although the total levels of p65 and IκBα remained unchanged (Fig. 5A–B). In addition, compared with the control group, levels of p-p65 and p-IκBα were elevated in ApoE^−/− mice model, while this effect was also partially rescued by inhibition of MALAT1 (Fig. 5C–D). These findings revealed that the NF-κB signaling pathway was activated in both ox-LDL-treated THP-1 macrophages and the ApoE^−/− mice model, and that silencing MALAT1 can reverse this activation.

Fig. 5.

MALAT1 activated the NF-κB signaling pathway. A–B: The expression levels of NF-κB p65, IκBα, phosphorylated p65, and IκBα (p-p65 and p-IκBα) were detected in control, ox-LDL, ox-LDL + kd-NC, and ox-LDL + kd-MALAT1 group of THP-1 macrophages were assessed by Western blot analysis. C–D: Western blotting of p65, IκBα, p-p65, and p-IκBα protein expression in aortic plaques of mice. Data are the mean ± SD (n = 3). ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001.

3.6. Hypomethylation of MALAT1 promoted ASCVD progression through activation of the NF-κB signaling pathway

Finally, we aimed to investigate the role of down-regulated DNMT1-mediated hypomethylation of MALAT1 in cellular functions through regulating the NF-κB signaling pathway. The expression levels of phosphorylated NF-κB p65 (p-p65), total NF-κB p65 (p65), phosphorylated IκBα (p-IκBα), and total IκBα (IκBα) were detected in BAY11-7082-treated THP-1 macrophages. The results showed that the treatment with BAY11-7082 (BAY) reduced the levels of p-p65 and p-IκBα compared to the control group, indicating the inhibition of the NF-κB signaling pathway (Figure S1A-B). CCK-8 assay uncovered that overexpressing DNMT1 increased the cell viability in ox-LDL-treated THP-1 macrophages, but the increased MALAT1 neutralized the positive effect of DNMT1. However, the use of the NF-κB inhibitor BAY11-7082 counteracted the negative impact of MALAT1 on cell growth (Fig. 6A). Furthermore, in ox-LDL-treated THP-1 macrophages, the upregulation of DNMT1 decreased cell apoptosis, which was reversed by overexpressing MALAT1; however, co-treatment with BAY11-7082 restored the anti-apoptotic effect of DNMT1 (Fig. 6B–C). Strikingly, Western blot analysis showed that the upregulation of ABCA1 and ABCG1 was observed in an ox-LDL + DNMT1 group compared with the ox-LDL group, whereas overexpression of MALAT1 declined the promoting effect of DNMT1, however, the combination of MALAT1 upregulation and BAY11-7082 treatment reinstated this enhancement (Fig. 6D–E). Besides, increased DNMT1 diminished ox-LDL-induced pro-inflammatory effects were reversed by MALAT1 overexpression, but the inflammatory response were efficiently alleviated in the ox-LDL + DNMT1+MALAT1+BAY11-7082 group (Fig. 6F). In summary, we concluded that the DNMT1/MALAT1/NF-κB signaling axis is crucial in the ASCVD cellular model.

Fig. 6.

Hypomethylation of MALAT1 promoted ASCVD progression through activation of the NF-κB signaling pathway. A: CCK-8 assay was used to detect the cell viability of the control, ox-LDL, ox-LDL + DNMT1, ox-LDL + DNMT1+MALAT1 and ox-LDL + DNMT1+MALAT1+ BAY groups of THP-1 macrophages. B–C: Cell apoptosis in the five groups of THP-1 macrophages was assessed by flow cytometry analysis. D–E: The levels of ABCA1 and ABCG1 in the five groups of THP-1 macrophages were measured by Western blot. F: The protein levels of TNF-α and IL-1β in five groups were analyzed by ELISA kits. Data are the mean ± SD (n = 3). ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001.

4. Discussion

ASCVD is one of the primary causes of illness and mortality globally [39]. Macrophages play a core role in the development of ASCVD and are primarily involved in multiple biological functions such as inflammatory regulation, lipid metabolism, promotion of plaque development, and thrombosis [40,41]. Although the molecular mechanism of MALAT1 in ASCVD has not been extensively studied, it is known to be significantly upregulated in several conditions, including myocardial infarction [42], osteoarthritis [43], human cancers [44], and lower limb AS in diabetes [45]. For example, research by Shi et al. showed that suppression of MALAT1 blocks cell formation, reduces apoptotic cell death, and diminishes inflammatory responses in foam cells derived from THP-1 macrophages in AS [46]. Zhu et al. figured out that lncRNA MALAT1 represses autophagy and apoptosis in endothelial progenitor cells through regulating the miR-15b-5p/MAPK1/mTOR pathway, thereby aggravating the development of coronary atherosclerotic heart disease [47]. In our study, we used ox-LDL-treated THP-1 macrophages to construct a cellular model to investigate the potential role of lncRNA involvement in ASCVD. We found that lncRNA MALAT1 levels were elevated in ASCVD patients and in ox-LDL-treated THP-1 macrophages. Furthermore, inhibiting MALAT1 reversed ox-LDL-mediated suppression of cell growth, and promotion of cell apoptosis, cholesterol metabolism disruption, and inflammation, and it also alleviated the AS progression in HFD-fed ApoE^−/− mice. Taken together, lncRNA MALAT1 may be a promising biomarker for ASCVD.

Epigenetic modifications, such as DNA methylation, are instrumental in the regulation of gene expression during the growth and development of organisms [48]. In particular, lncRNA MALAT1 expression is affected by DNA methylation. For instance, Guo et al. uncovered that MALAT1 has a pro-cancer effect in non-small cell lung cancer, which is regulated by the hypomethylation of its promoter [48]. Hu et al. highlighted that the levels of lncRNA H19 and MALAT1 are highly expressed in gastric cancer and are inversely related to DNA methylation [49]. In our study, we observed that the DNA methylation of MALAT1 was decreased in ASCVD patients and in ox-LDL-treated THP-1 macrophages. Functional experiments indicated that DNMT1-mediated DNA methylation ameliorated the development of ASCVD by regulating cell viability, apoptosis, cholesterol metabolism, and inflammation, whereas this beneficial effect was reversed by the upregulation of MALAT1. These results demonstrated that targeting DNMT1-mediated DNA methylation modification of lncRNA MALAT1 could be a promising approach for the treatment of ASCVD.

The NF-κB pathway serves a significant role as a pro-inflammatory signaling pathway in various human diseases [50]. For instance, Huang et al. disclosed that circ-RELL1 promotes endothelium inflammation by regulating the miR-6873-3p/MyD88/NF-κB signal in ASCVD [51]. Similarly, González-López et al. showed that the repression of miR-15a-5p and miR-199a-3p leads to increased uptake of ox-LDL and heightened inflammation by activating the NF-κB pathway, thus aggravating AS development [52]. Furthermore, lncRNA MALAT1 has been proven to regulate the NF-κB signaling pathway across various diseases. For example, Zhu et al. uncovered that exosomes derived from human umbilical cord mesenchymal stem cells play a crucial role in mitigating cardiac dysfunction associated with aging by releasing lncRNA MALAT1, which subsequently inhibits the NF-κB/TNF-α signaling pathway [53]. In our findings, the NF-κB pathway was activated in ox-LDL-treated THP-1 macrophages and in HFD-fed AS mice, while the knockdown of MALAT1 reduced this activation. Moreover, in the presence of ox-LDL, the upregulation of MALAT1 neutralized the DNMT1-mediated reduction of ASCVD progression. However, the NF-κB inhibitor BAY11-7082 counteracted the effects caused by the overexpression of MALAT1. Furthermore, it is noteworthy that the epigenetic regulation of NF-κB, particularly the regulation associated with histone modifications, has garnered significant attention in recent years [54]. Histone modifications, such as acetylation and methylation, have been shown to influence the activity and stability of NF-κB, thereby modulating inflammatory responses and cell survival [55,56]. For example, Leus et al. elucidated the pivotal role of HDAC3 in modulating NF-κB-mediated inflammatory responses through histone and non-histone protein lysine acetylation, underscoring the potential of HDAC3-selective inhibitors as therapeutic agents for inflammation [55]. In our study, we identified a role for DNMT1-mediated MALAT1 DNA methylation in ASCVD, which may be associated with activation of the NF-κB signalling pathway. Future studies could further explore the interaction between MALAT1 and NF-κB and whether this interaction involves the regulation of histone modifications.

Our research revealed that DNMT1-mediated methylation modifications suppressed MALAT1 expression, which subsequently inhibited the NF-κB signaling pathway to regulate ox-LDL-induced cell proliferation, apoptosis, cholesterol metabolism, and inflammatory responses, ultimately helping to mitigate the progression of ASCVD. The study is based on cell and mouse models, which may not fully reflect human ASCVD. There may be other regulatory mechanisms beyond DNMT1. Future research should validate findings in clinical cohorts and explore additional pathways that affect MALAT1. Targeting the DNMT1/MALAT1/NF-κB axis may offer therapeutic potential for ASCVD.

Author contribution

Jinfeng Xu: conceptualization, methodology, and writing-original draft; Qian Zhang: investigation and resources; Rong Wang: validation, formal analysis, and data curation; Jianbo Yang: writing-review & editing and supervision.

Ethics statement

This study was performed in line with the principles of the Declaration of Helsinki. Approval was granted by the Ethics Committee of the Fourth Affiliated Hospital of Xinjiang Medical University. All procedures were conducted in accordance with the Guiding Principles in the Care and Use of Animals and were approved by the Laboratory Animal Ethics Committee of the Fourth Affiliated Hospital of Xinjiang Medical University.

Funding

Our study was supported by the Xinjiang Uygur Autonomous Region Natural Science Foundation Project (No. 2022D01C549).

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Appendix A. Supplementary data

The following are the Supplementary data to this article:

Data availability

Data is available on request from the corresponding author.